Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2000 Oct 15;28(20):3999–4004. doi: 10.1093/nar/28.20.3999

Elongation of repetitive DNA by DNA polymerase from a hyperthermophilic bacterium Thermus thermophilus

Norio Ogata 1,a, Hirofumi Morino 1
PMCID: PMC110782  PMID: 11024180

Abstract

Short repetitive DNA sequences are believed to be one of the primordial genetic elements that served as a source of complex large DNA found in the genome of modern organisms. However, the mechanism of its expansion (increase in repeat number) during the course of evolution is unclear. We demonstrate that the DNA polymerase of the hyperthermophilic bacterium Thermus thermophilus can elongate oligoDNA with several tandem repeats to very long DNA in vitro. For instance, 48mer repetitive oligoDNA (TACATGTA)6, which has 25% GC content and a palindromic sequence, can be elongated up to ∼10 000 bases by DNA polymerase at 74°C without template DNA. OligoDNA having a different GC content or a quasi-palindromic sequence can also be elongated, but less efficiently. A spectroscopic thermal melting experiment with the oligoDNA showed that its hairpin–coil transition temperature was very close to the elongation reaction temperature (74°C), but was much higher than the temperature at which duplex oligoDNA can exist stably. Taken together, we conclude that repetitive oligoDNA with a palindromic or quasi-palindromic sequence is elongated extensively by a hyperthermophilic DNA polymerase through hairpin–coil transitions. We propose that such an elongation mechanism might have been a driving force to expand primordial short DNA.

INTRODUCTION

The complex genomes of higher organisms are believed to have diversified by means of various mechanisms, such as unequal crossing over and gene duplication (1,2). Ohno proposed that modern coding sequences of DNA evolved from primordial oligomeric repeats and that these primordial oligomeric repeats were elongated progressively during the course of evolution (3–6). Other investigators also independently arrived at the conclusion that all polypeptide chains were originally endowed with short periodicity, thus implying an original internal repetitive structure in all coding sequences (7,8). Tandem repetitive DNA sequences are found in many organisms (9–23). Although the functions of these tandem repetitive sequences are not fully understood, some have recently been elucidated. For instance, telomere DNA has the structure (TTGGGG)n and it is believed to maintain the integrity of the end of chromosomal DNA (21–23). However, except for telomere DNA, the mechanism of elongation (expansion of repeat number) of repetitive sequences is not well understood.

We have recently found (24–26) that the DNA polymerase of the hyperthermophilic archaeon Thermococcus litoralis (24,25) and eubacterium Thermus thermophilus (Tth) (26) can ‘creatively’ synthesize a large stretch of DNA from the four deoxyribonucleoside triphosphates (dNTPs), namely dATP, dTTP, dGTP and dCTP, without adding a primer–template DNA complex, an element required for common replicative DNA synthesis by DNA polymerases (27). Such ab initio DNA synthesis can be interpreted as the ‘creation’ of genetic information by a protein, because in this reaction (24–26) genetic material is not copied from pre-existing genetic material, namely template DNA needed for the common reaction by DNA polymerases, but is made from a hitherto unknown source of information, if it ever existed. The DNA product synthesized without primer and template DNAs by these DNA polymerases of hyperthermophilic bacteria had the sequences, for instance, (TACATGTA)n, (TGTATGTATACATACATA)n and (TATACGTA)n (24–26,28,29). These DNA sequences primarily had a structure of palindromic or quasi-palindromic tandem repeats and the motif sequence (unit sequence) of the repeats had a length of 4–36 bases. The GC content of these sequences is linearly related to the reaction temperature and ranges from 0 to 83% depending upon the reaction temperature (24–26,28,29).

Based upon the above findings we thought that oligoDNA having such a repetitive motif sequence might be elongated to long DNA with the same tandem repeat sequence structure in the complete absence of a primer–template complex when added to a DNA polymerase reaction mixture. As expected, we demonstrate in this paper that such oligoDNA, added to a reaction mixture of Tth DNA polymerase, strongly enhances DNA synthesis, due to elongation, by a unique reaction mechanism different from the common replicative DNA synthesis reaction. We further demonstrate that the presence of a palindromic sequence and defined GC content in the oligoDNA are important in this reaction. As DNA synthesis (predominantly elongation of the added oligoDNA) occurs around the hairpin–coil transition temperature of the added oligoDNA, we speculate that elongation of the oligoDNA occurs through a hairpin–coil transition. The implication of this DNA elongation mechanism, in terms of expansion of primordial genetic material, is discussed.

MATERIALS AND METHODS

DNA synthesis reaction by Tth and ΔTth DNA polymerases

DNA synthesis by Tth DNA polymerase (Boehringer Mannheim, Mannheim, Germany) or recombinant ΔTth DNA polymerase (Toyobo, Osaka, Japan), a mutant of Tth DNA polymerase in which 5′→3′ exonuclease activity is lacking (30), was carried out essentially as described previously (26). The ‘standard reaction mixture’ (20 µl) consisted of 50 mM KCl, 10 mM Tris–HCl buffer (pH 9.0 at 25°C, pH 7.5 at 74°C), 1.5 mM MgCl2, 200 µM each of four dNTPs and 25 U/ml of either Tth or ΔTth DNA polymerase. The dNTPs were unlabeled or labeled at the α position with 32P, the final specific activity being 110 µCi/µmol (4.0 MBq/µmol). OligoDNA was added at a concentration of 1 µg/ml, unless specified otherwise. The oligoDNA most frequently used was (TACATGTA)6; it is referred to as the ‘standard oligoDNA’. (The DNA sequence is always written 5′→3′.) Other oligoDNAs had similar but slightly different sequences from the standard oligoDNA. As a negative control a 48mer single-stranded DNA having the sequence GAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACG was used; this sequence was derived from the sequence (nt 1705–1752) of the β-galactosidase gene of Escherichia coli (31). All oligoDNAs were purchased from Amersham Pharmacia Biotech (Tokyo, Japan) and their 5′-end was phosphorylated. Except for the time course study, the DNA synthesis reaction was carried out at 74°C for 30 min.

The DNA synthesis reaction was terminated by the addition of 0.8 µl of 500 mM EDTA (pH adjusted to 8.0 with NaOH). An aliquot (2 µl) of the reaction mixture was next transferred to another tube containing a solution (98 µl) of 1 mg/ml salmon testis DNA (Sigma, St Louis, USA) in 10 mM Tris–HCl buffer (pH 8.0) and 1 mM EDTA. Next, 500 µl of a solution containing 6% (w/v) trichloroacetic acid and 1.2% (w/v) pyrophosphoric acid was added to the mixture. The acid-insoluble material thus formed was next collected on a glass microfibre filter disc (24 mm diameter GF/C filter; Whatman, Maidstone, UK) by gentle aspiration. The filter disc was washed immediately four times with 5 ml of 5% (w/v) trichloroacetic acid containing 1% (w/v) pyrophosphoric acid and finally with 5 ml of ethanol. The filter disc was dried and radioactivity was counted using a liquid scintillation counter. The coefficient of variation of the assay was 5%.

Analysis by electrophoresis

The DNA synthesis reaction mixture (20 µl) was electrophoresed on a 1% (w/v) agarose gel (Seakem GTG; FMC, Rockland, USA) under non-denaturing conditions as described (32). The gel was stained with 0.5 µg/ml ethidium bromide and photographed under UV illumination (32). In another experiment an aliquot (4 µl) of the DNA synthesis reaction mixture containing four [α-32P]dNTPs was electrophoresed on a 6% (w/v) polyacrylamide gel under denaturing conditions (8 M urea) and the gel was visualized by autoradiography.

Characterization of the product of the DNA synthesis reaction

3′-End-labeling of the standard oligoDNA was performed by extending the 47mer oligoDNA (TACATGTA)5TACATGT by 1 nt with [α-32P]dATP with ΔTth DNA polymerase at 74°C for 30 min, as in the so-called ‘fill-in reaction’ of DNA having a 5′-overhang end (32) making use of the repetitive and palindromic nature of the sequence of the oligoDNA. We expected that the oligoDNA strand would fold back and its 5′-arm would serve as an ‘intramolecular template’ for incorporation of [α-32P]dATP at the 3′-end. The labeled oligoDNA was next treated with phenol/chloroform and recovered by ethanol precipitation (32).

The amount of DNA chains before and after the reaction with DNA polymerase was measured as the amount of [α-32P]dNTP incorporated as 1 nt at the 3′-end, based upon the mechanism described above for 3′-end-labeling. However, because of uncertainty as to the 3′-end sequence of the DNA obtained after the elongation reaction with DNA polymerase, the DNA product was divided into four portions and each portion was incubated with one of the four [α-32P]dNTPs individually.

Spectroscopic measurement of thermal melting temperature

The thermal melting temperature (Tm) of each oligoDNA was determined from a temperature versus absorbance curve at 260 nm, using a spectrophotometer (Ubest-50; Jusco, Tokyo, Japan) equipped with a cell holder connected to a temperature controlled water circulator (F-25; Julabo, Seelbach, Germany) which was provided with a computer controlled temperature programmer. The absorbance curve was obtained at an oligoDNA concentration of 10 µg/ml by increasing the temperature from 20 to 100°C at a rate of 0.25°C/min in a 700 µl solution containing 10 mM KCl, 10 mM (NH4)2SO4, 6 mM MgSO4 and 20 mM Tris–HCl buffer (pH 8.8). The cuvette containing the sample solution was layered with mineral oil and was capped loosely during the measurement of absorbance to prevent evaporation. The Tm was measured from the peak of the derivative of the temperature versus absorbance curve. The concentrations of oligoDNA were determined using an extinction coefficient of 7000 M–1 cm–1 for pyrimidine bases and 14 000 M–1 cm–1 for purine bases. The coefficient of variation of Tm measurement was 0.1%.

RESULTS

Enhancement of DNA synthesis by oligoDNA: its elongation by Tth and ΔTth DNA polymerases

When Tth DNA polymerase was incubated for 30 min with the four dNTPs, DNA synthesis occurred, as measured by the amount of radioactive deoxyribonucleoside monophosphate (dNMP) incorporated in acid-insoluble material, at 74°C without a primer–template complex (Fig. 1A). The result confirmed our previous observation of ab initio DNA synthesis by Tth DNA polymerase (26). The amount of DNA synthesized was 12 pmol by Tth DNA polymerase and <1 pmol by ΔTth DNA polymerase, a mutant Tth DNA polymerase lacking 5′→3′ exonuclease activity (30), when no oligoDNA was added to the reaction mixture (Table 1). On the other hand, when the 48mer standard palindromic oligoDNA (TACATGTA)6 was added to the reaction mixture DNA synthesis increased markedly, with both Tth DNA polymerase (recombinant and native forms from five manufacturers) and ΔTth DNA polymerase (Fig. 1A and Table 1). This result indicates that the oligoDNA can enhance DNA synthesis catalyzed by Tth and ΔTth DNA polymerase and that the endogenous 5′→3′ exonuclease activity of Tth DNA polymerase is not required for this phenomenon. At a concentration of 1 µg/ml oligoDNA the amount of DNA synthesized in 30 min (∼600 ng) was ∼30 times greater than the amount of oligoDNA added to the reaction mixture (20 ng). This means that the reaction is not a result of DNA synthesis in which the added oligoDNA merely served as a primer–template complex, an element required for common replicative DNA synthesis (27). If this were the case, the maximum amount of DNA synthesized would be about the same as the amount of added oligoDNA. A 48mer DNA fragment derived from the β-galactosidase gene, used as a control, showed no activity in increasing DNA synthesis (Table 1), indicating that the activity found in the above 48mer standard oligoDNA is not a general phenomenon found in any DNA.

Figure 1.

Figure 1

The time course of DNA synthesis by Tth and ΔTth DNA polymerases in the presence of oligoDNA. DNA synthesis was carried out in a standard reaction mixture at 74°C for the various times indicated by Tth DNA polymerase (circles) or ΔTth DNA polymerase (triangles) in the presence (filled symbols) or absence (open symbols) of 1 µg/ml 48mer standard oligoDNA (TACATGTA)6. The amount of DNA synthesized was measured as acid-insoluble radioactivity (A) or the product DNA was electrophoresed on an agarose gel under non-denaturing conditions (B). The size markers for (B) are shown in kb on the left. To monitor elongation of the added oligoDNA, the standard reaction mixture containing 3′-end-labeled standard oligoDNA (TACATGTA)6 and either Tth or ΔTth DNA polymerase was incubated as above for 0, 0.3, 1, 5, 10 and 30 min. The reaction mixture was next electrophoresed on a polyacrylamide gel under denaturing conditions and the gel was subjected to autoradiography (C). The size markers for (C) are shown in bases on the left. The positions of (TACATGTA)6 (open arrow) and dNMP (filled arrow) are also shown.

Table 1. The effect of a palindromic structure in the oligoDNA on DNA synthesis by Tth and ΔTth DNA polymerases.

OligoDNA added DNA synthesis (nmol dNMP)
  Tth DNA polymerase ΔTth DNA polymerase
(TACATGTA)6 1.8 (100%) 3.0 (100%)
(TACATGTT)6 0.4 (22%) 0.001 (0.03%)
(TACATGAA)6 0.3 (17%) 0.001 (0.03%)
(TACATCTA)6 0.3 (17%) 0 (0%)
(TACAAGTA)6 0.3 (17%) 0.3 (10%)
(TACATGAT)6 0.2 (11%) 0 (0%)
(TACAACTA)6 0 (0%) 0 (0%)
(TACATCAT)6 0.2 (11%) 0 (0%)
(TACAACAT)6 0.2 (11%) 0 (0%)
β-Gal genea 0.01 (0.6%) 0.001 (0.03%)
None 0.01 (0.6%) 0.001 (0.03%)

The DNA synthesis reaction was carried out in a standard reaction mixture (20 µl) at 74°C for 30 min in the presence of the 48mer repetitive oligoDNA indicated (1 µg/ml). Nucleotides different from the standard oligoDNA (TACATGTA)6 are shown in bold. Each oligoDNA, except for the standard oligoDNA, has a quasi- or non-palindromic sequence. DNA sequences are shown 5′→3′.

aA 48 base single-stranded DNA fragment derived from the β-galactosidase gene of E.coli was used as a control.

The time course of DNA synthesis with and without 1 µg/ml oligoDNA was examined next; the initial rate of synthesis by Tth DNA polymerase was 3.3 pmol/min without oligoDNA (Fig. 1A, open circles). This result confirmed our previous finding of ab initio DNA synthesis (24–26), where DNA synthesis was observed without adding a primer–template complex. The initial rate of synthesis increased markedly (130 pmol/min) when the 48mer standard oligoDNA (TACATGTA)6 was added (Fig. 1A, filled circles). The result suggests that the added standard oligoDNA acted as a ‘precursor’ for DNA synthesis. As the oligoDNA has a palindromic sequence, it is self-complementary. Therefore, it is possible that it merely formed a bimolecular homoduplex structure and worked as a primer–template complex (27). An alternative possibility is that each molecule of the oligoDNA formed a hairpin structure (33–40). We will discuss these possibilities later.

Essentially the same result was found in the reaction catalyzed by ΔTth DNA polymerase in the presence of the standard oligoDNA, but the initial rate of synthesis was greater (300 pmol/min) (Fig. 1A, filled triangles) than the initial rate by Tth DNA polymerase. The maximum amount of DNA synthesized was 5.2 nmol after 24 h. This corresponds to 32.5% of the theoretically possible maximal amount of DNA that could be synthesized if all four dNTPs present in the reaction mixtures were converted to DNA (16 nmol). No DNA synthesis was seen with ΔTth DNA polymerase when the standard oligoDNA was absent from the reaction mixture (Fig. 1A, open triangles). The size of DNA synthesized with and without the standard oligoDNA was >7 kb, as demonstrated by gel electrophoresis (Fig. 1B). These results strongly suggest that the oligoDNA added to the reaction mixture served as precursor DNA for DNA synthesis and that it was elongated by Tth and ΔTth DNA polymerases. Elongation of the added oligoDNA was confirmed by the increase in the size of 3′-end-labeled oligoDNA after the reaction (Fig. 1C).

The effect of the added oligoDNA on the amount of the DNA synthesized was further examined by changing the length of oligoDNA of the (TACATGTA)n series. An enhancing effect of the oligoDNA added to the Tth DNA polymerase reaction mixture was observed for oligoDNAs having lengths of (TACATGTA)3 to (TACATGTA)15, but was maximal with the 48mer (TACATGTA)6 (data not shown). The same trend was observed for DNA synthesis by ΔTth DNA polymerase.

Effect of the nucleotide sequence of oligoDNA on DNA synthesis: importance of GC content and a palindromic sequence

We next examined the effect of nucleotide sequence of the oligoDNA added to the reaction mixture by changing its repetitive motif sequence without changing its length or the number of repeats from those of the standard oligoDNA, (TACATGTA)6 (data not shown). For instance, when palindromic oligoDNA (GACATGTC)6 (nucleotides different from the standard oligoDNA are shown in bold) was added to the reaction mixture in place of the standard oligoDNA, DNA synthesis was 0.02 nmol with Tth DNA polymerase compared to 1.8 nmol for the standard oligoDNA. With the exception of (AGGTACCT)6, DNA synthesis decreased when the GC content of the oligoDNA was different from that of the standard oligoDNA, whose GC content was 25%, although all the oligoDNAs examined had a palindromic sequence and were the same length. The results indicate that the GC content of the oligoDNA is important for oligoDNA elongation.

The standard oligoDNA has a palindromic structure in its repetitive motif sequence. (Note that the entire sequence of tandem repetitive DNA also has a palindromic structure if its repetitive motif sequence has a palindromic structure.) We next addressed the question of whether destruction of the palindromic structure in oligoDNA had an effect on DNA synthesis by Tth and ΔTth DNA polymerases. For instance, when the repetitive motif sequence TACATGTA in the standard oligoDNA was replaced by TACATGTT, which had a quasi-palindromic structure due to substitution of T for A, DNA synthesis by Tth DNA polymerase decreased markedly (0.4 nmol, Table 1). The same effect of destruction of the palindromic structure was also found for ΔTth DNA polymerase, but the effect was much more marked than for Tth DNA polymerase (0.001 nmol, Table 1).

Characterization of DNA products synthesized by Tth and ΔTth DNA polymerases

The nucleotide sequences of the reaction products of Tth and ΔTth DNA polymerases in the presence of oligoDNA were analyzed by treating them with various restriction enzymes. As shown in Figure 2, the product DNA was digested by restriction enzymes having a recognition sequence that was found in the oligoDNA added to the DNA synthesis reaction. For instance, AccI has a recognition sequence GTATAC and the standard oligoDNA added to the DNA synthesis reaction had the sequence (TACATGTA)6, which contains five AccI recognition sequences. As shown in Figure 2 (lanes 2 and 4), the product DNAs made by Tth DNA polymerase (lane 1) and ΔTth DNA polymerase (lane 3) were completely digested by AccI, indicating that the product DNAs have many GTATAC sequences. The results suggest that the product DNAs have the same sequence as the oligoDNA added to the reaction mixture. The finding that the sequence of the oligoDNA added to the reaction mixture was also present in the product DNA was further confirmed by molecular cloning of the product DNA. As expected, the cloned DNA had the same sequence as the oligoDNA added to the DNA synthesis reaction (data not shown).

Figure 2.

Figure 2

The analysis of DNA product synthesized by Tth and ΔTth DNA polymerases by restriction enzymes. The DNA product synthesized in the standard reaction mixture at 74°C for 30 min by Tth or ΔTth DNA polymerase in the presence of 1 µg/ml of the indicated oligoDNA (third line) was electrophoresed on an agarose gel under non-denaturing conditions before (lanes 1, 3, 5 and 7) or after (lanes 2, 4, 6 and 8) treatment with 1 U/ml of the restriction enzyme indicated at the bottom. The size markers are shown in kb on the left. The recognition sequence of the restriction enzyme is shown below each enzyme.

The amount of DNA chains measured by the 3′-end-labeling method was 1.26 pmol before the reaction, which was consistent with 20 ng (1.35 pmol) of 48mer oligoDNA added to the reaction mixture. On the other hand, the amounts of DNA chains were 3.16 and 1.60 pmol after the reaction with Tth and ΔTth DNA polymerase, respectively. While there was a slight increase in the amount of DNA chains after the reaction, this increase was much smaller than the increase in the amount of total DNA synthesized in terms of dNMP incorporation (30-fold increase). This means that the DNA synthesis found in the standard reaction predominantly reflects elongation of the added oligoDNA. We also found that DNA polymerases from the hyperthermophilic eubacterium Thermus flavus and two hyperthermophilic archaea Pyrococcus furiosus and Pyrococcus kodakaraensis could also elongate repetitive palindromic oligoDNA at 74°C (data not shown).

Thermal melting temperature of oligoDNA

Repetitive palindromic oligoDNA, for instance (TACTAGTA)6, can potentially make a hairpin structure (33–41). It is also possible that it forms a bimolecular homoduplex structure, because the sequence is self-complementary. When a solution of repetitive palindromic oligoDNA (TACTAGTA)6 was heated, the absorbance of the solution at 260 nm increased, a phenomenon known as hyperchromicity of DNA (Fig. 3). There were two temperatures at which an abrupt increase in the absorbance occurred, namely 27.4 and 71.0°C. The first abrupt increase in absorbance was caused by a duplex–hairpin transition (transition 1), the second abrupt increase by a hairpin–coil transition (transition 2), as pointed out by Xodo et al. in various palindromic DNAs (35–37,39,41). (The coil is defined as unstructured single-stranded DNA having no specific secondary structure.) Such a biphasic absorbance profile of palindromic DNAs has also been confirmed by other investigators (33,34,38).

Figure 3.

Figure 3

The spectroscopic thermal melting profile of oligoDNA. The absorption spectrum (260 nm) of oligoDNA (TACTAGTA)6 was measured at a concentration of 10 µg/ml by increasing the temperature at a rate of 0.25°C/min. The solid line represents the absorbance as a function of temperature and the dotted line represents its derivative. The melting temperatures of the duplex–hairpin (transition 1) and hairpin–coil (transition 2) transitions are shown by arrowheads. Structures of DNA are shown schematically above each transition point.

We next examined whether there was any difference in the Tm of the hairpin–coil transition (transition 2) of various 48mer repetitive oligoDNAs having a palindromic structure and 25% GC content in a repetitive motif sequence. All the oligoDNAs having these characteristics had Tm values of the hairpin–coil transition in the range 70.9–74.6°C (72.6 ± 1.4°C, mean ± SD of seven oligoDNAs). The fact that the reaction temperature (74°C) is very close to the Tm of the hairpin–coil transition strongly suggests that the DNA synthesis reaction, as shown by elongation of the added oligoDNA (Fig. 1), involves hairpin–coil transitions and that the duplex–hairpin transition is not involved in this elongation reaction, because it is hardly possible for the oligoDNA added to the reaction mixture to take a duplex conformation at 74°C. Note that the Tm of the duplex–hairpin transition is much lower (25.7 ± 3.3°C) than 74°C, which means that almost no duplex DNA exists at 74°C. Based on these results, we conclude that short repetitive sequence DNA having a palindromic or quasi-palindromic sequence motif can be elongated by Tth DNA polymerase at high temperature through hairpin–coil transitions.

DISCUSSION

Based upon the above results, we propose a novel mechanism for the elongation of tandem repetitive DNA. As the standard oligoDNA has a repetitive structure and its motif sequence is palindromic, there are many potential (11 in the standard oligoDNA) fold-back points to form a hairpin structure (Fig. 4). For instance, as shown in Figure 4, the oligoDNA can form a hairpin structure by folding back at one of the potential fold-back points. DNA polymerase next extends the hairpin oligoDNA from its 3′-end until the growing 3′-end reaches the 5′-end. The extended oligoDNA then melts completely or partially and again forms a hairpin structure. When the hairpin again forms a 5′-end overhang structure (Fig. 4), it will be extended. DNA elongation proceeds by repeating the cycle of melting (complete or partial) and hairpin formation.

Figure 4.

Figure 4

A proposed model of ‘hairpin elongation’ for the expansion of a tandem repetitive sequence with a palindromic or quasi-palindromic sequence through hairpin–coil transitions near the melting temperature. The newly elongated stretch of DNA is shown by a thick line. According to this model, DNA is elongated by repeating such a hairpin–coil interconversion. While the scheme shows complete melting of the hairpin, the melting may be incomplete.

Kornberg et al. reported elongation of oligo(dAT) using DNA polymerase I of E.coli at 37°C (42). Regarding this work, Elson suggested that the reaction occurred by a ‘slippage’ mechanism (43). According to his model, oligo(dAT) is elongated by repeated ‘slipping’ of the oligo(dAT) along the product strand to expose template sites; the rate of synthesis is proportional to the equilibrium concentration of either exposed template sites or template sites occupied by substrate molecules. The Elson model indicates that oligo(dAT) is elongated by a mechanism involving a duplex–coil transition, but not involving a hairpin–coil transition. This is in agreement with the duplex–coil transition temperature (Tm) of oligo(dAT), which is between 10 and 40°C. This Tm value is within the range of the optimal reaction temperature of E.coli DNA polymerase I.

Schlotterer and Tautz reported elongation of oligo(dTCC)/oligo(dGGA) using the Klenow fragment of E.coli DNA polymerase I at 37°C (44). They also suggested a ‘slippage’ mechanism for the elongation of oligo(dTCC)/oligo(dGGA) (44). In the DNA synthesis model of Kornberg et al. (42) and Schlotterer and Tautz (44) the authors postulated the presence of bimolecular duplex DNA having a 5′-overhang. Such bimolecular duplex DNA is commonly known as a primer–template complex, and it is required for DNA synthesis (27). As demonstrated in Figure 3, the melting temperature of duplex oligoDNA is 25.7 ± 3.3°C, which is much lower than the reaction temperature employed in our reaction (74°C), whereas the reaction temperature employed by Kornberg et al. (42) and Schlotterer and Tautz (44) was 37°C. This means that a hairpin–coil transition (transition 2, Fig. 3) could not be involved in their reaction, whereas a duplex–hairpin transition (transition 1, Fig. 3) [in the case of oligo(dAT), as it is palindromic and can form a hairpin structure] or duplex–coil transition may well be involved, judging from the temperature of 37°C employed in their reactions. In the reaction shown in our present work the reaction temperature (74°C) was too high for a duplex structure to stably exist (Fig. 3); we need to introduce a reaction mechanism of ‘elongation in a hairpin–coil transitional state’ as an alternative mechanism of elongation (Fig. 4). According to this mechanism, a hairpin–coil transitional state is required for elongation of simple repetitive oligoDNA having a palindromic or quasi-palindromic sequence.

Vallone et al. found an increase in the Tm of the hairpin–coil transition in oligoDNA when its GC content increased (38). It is plausible that elongation of the oligoDNA occurs at or near the equilibrium condition of the hairpin–coil transition and that if the Tm of the hairpin–coil transition of a certain oligoDNA is close to the reaction temperature, the oligoDNA is elongated, whereas if the Tm is far from the reaction temperature, because of increased or decreased GC content, it is not elongated, exactly as we found. This view is consistent with our previous finding that DNA synthesized ab initio by the DNA polymerase of T.litoralis had a GC content which is dependent upon the reaction temperature: there was a good linear correlation between the GC content and the reaction temperature (25).

A tandem repetitive sequence is one of the major components of the genomes of modern organisms (11–23). Although it is believed that they originated from short sequences, the process involved in elongation (expansion) remains unclear. When we searched the GenBank DNA database for a tandem repetitive sequence of (8mer)2 structure, where the nucleotide sequence of the 8mer motif was chosen arbitrarily, to determine the frequency of a palindromic structure in natural genes, we found that 2.3% of matched sequences were palindromic for the 8mer motif sequence. This value is 6.0 times higher (P < 0.05, t-test) than that expected if palindromic sequences are found at random. When we further searched the database for the presence of a matched sequence of 25% GC palindromic (8mer)2, which has the potential ability to be elongated in the standard assay (eight sequences examined), we found matched sequences in six species of eubacteria, four species of eukaryotes and no species of archaea. Our present finding that a short repetitive sequence is elongated at high temperature by the DNA polymerase of a hyperthermophilic bacterium in a hairpin–coil transitional state suggests that a repetitive array could have been created by this mechanism at an early stage of the evolution of primordial genetic material in high temperature environments.

Acknowledgments

ACKNOWLEDGEMENT

The authors acknowledge Mr T. Miura for the measurement of thermal melting temperatures.

REFERENCES


Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES