miR-29b-1-5p exacerbates myocardial injury induced by sepsis in a mouse model by targeting TERF2

Abstract

Myocardial damage is a critical complication and a significant contributor to mortality in sepsis. MicroRNAs (miRNAs) have emerged as key players in sepsis pathogenesis. In this study, we explore the effect and mechanisms of miR-29b-1-5p on sepsis-induced myocardial damage. Sepsis-associated Gene Expression Omnibus datasets (GSE72380 and GSE29914) are examined for differential miRNAs. The mouse sepsis-induced cardiac injury was established by Lipopolysaccharide (LPS) or cecal ligation and puncture (CLP). LPS-treated HL-1 mouse cardiomyocytes simulate myocardial injury in vitro. miR-29b-1-5p is co-upregulated in both datasets and in cardiac tissue from sepsis mouse and HL-1 cell models. miR-29b-1-5p expression downregulation was achieved by antagomir transduction and confirmed by real-time quantitative reverse transcription PCR. Survival analysis and echocardiography examination show that miR-29b-1-5p inhibition improves mice survival cardiac function in LPS- and CLP-induced sepsis mice. Hematoxylin and eosin and Masson’s trichrome staining and Immunohistochemistry analysis of mouse myocardial α-smooth muscle actin show that miR-29b-1-5p inhibition reduces myocardial tissue injury and fibrosis. The inflammatory cytokines and cardiac troponin I (cTnI) levels in mouse serum and HL-1 cells are also decreased by miR-29b-1-5p inhibition, as revealed by enzyme-linked immunosorbent assay. The expressions of autophagy-lysosomal pathway-related and apoptosis-related proteins in the mouse cardiac tissues and HL-1 cells are evaluated by western blot analysis. The sepsis-induced activation of the autophagy-lysosomal pathway and apoptosis are also reversed by miR-29b-1-5p antagomir. MTT and flow cytometry measurement further confirm the protective role of miR-29b-1-5p antagomir in HL-1 cells by increasing cell viability and suppressing cell apoptosis. Metascape functionally enriches TargetScan-predicted miR-29b-1-5p target genes. TargetScan prediction and dual luciferase assay validate the targeting relationship between miR-29b-1-5p and telomeric repeat-binding factor 2 (TERF2). The expression and function of TERF2 in HL-1 cells and mice are also evaluated. MiR-29b-1-5p negatively regulates the target gene TERF2. TERF2 knockdown partly restores miR-29b-1-5p antagomir function in LPS-stimulated HL-1 cells. In summary, miR-29b-1-5p targetedly inhibits TERF2, thereby enhancing sepsis-induced myocardial injury.

Introduction

Sepsis is defined as a potentially fatal multiorgan failure resulted from a deficient response of a host to a serious infection [ 1, 2]. Sepsis is one of the leading causes of morbidity and mortality worldwide due to the lack of effective interventions [3]. Sepsis-induced cardiomyopathy is a common myocardial dysfunction induced by sepsis, the pathophysiologic process of which is reversible [4]. Research indicated that patients suffering from both sepsis and myocardial dysfunction are at a mortality risk of 70%–90%, superseding the risk faced by patients who have no myocardial damage (20%) [ 3, 4]. Effective therapies are still unavailable despite the exploration of multiple approaches to prevent sepsis-induced myocardial dysfunction [ 5, 6]. Therefore, there is a pressing need to identify new treatments to decrease the morbidity and mortality rate of septic patients.

MicroRNAs (miRNAs) are single-stranded noncoding RNAs containing ~22 nucleotides that are highly conserved in different species. miRNAs can target the 3′ untranslated region (3′UTR) of mRNAs to exert a negative regulatory effect on gene expression, thereby resulting in the repression or decay of mRNA targets [7]. Reportedly, miRNAs might participate in nearly all key cellular functions, such as growth, differentiation, proliferation, and apoptosis [8]. As previously reported, miRNAs are linked to multiple disorders, such as sepsis, heart disease, and diabetes [ 9– 11]. According to recent studies, miRNAs have a significant impact on the development of cardiac damage during sepsis [ 12, 13]. Therefore, investigating the specific function of miRNAs in myocardial dysfunction in sepsis and their underlying mechanisms may contribute to the development of novel, efficacious therapeutic approaches for individuals suffering from myocardial injury in sepsis.

Bioinformatics data mining through gene and noncoding RNA microarray data is useful for identifying novel important genes and noncoding RNAs related to disease pathogenesis [14]. Microarrays have been used to screen for differential miRNAs and mRNAs involved in diseases such as cancer [15], sepsis, and acute kidney injury [16]. Previous studies have also reported differentially expressed genes (DEGs) in patients with septic myocardial injury via microarray microarrays [17]. Therefore, it is feasible to investigate the molecular pathways involved in septic myocardial injury via the use of microarrays.

In this study, miR-29b-1-5p, a differentially expressed miRNA, was obtained through Gene Expression Omnibus (GEO) microarray and bioinformatics screening. In vivo and in vitro models revealed that inhibition of miR-29b-1-5p ameliorated septic myocardial injury-related cardiomyocyte dysfunction, and this effect was achieved by upregulation of telomeric repeat-binding factor 2 (TERF2).

Materials and Methods

Septic myocardial injury animal model

Male C57BL/6 mice weighing 23±2 g and 8 weeks old were procured from Hunan SJA Laboratory Animal Co. (Changsha, China), and housed in a specific pathogen-free (SPF) environment with a temperature range of 23‒25°C and a humidity level of 55%±5%. The mice were allowed free access to a standard chow diet and drinking water. The experimental procedures included in this study involving animals were approved by the Ethics Committee of Second Xiangya Hospital (approval No: 2021347).

An LPS-induced sepsis mouse model was established as previously reported [18]. Mice were anaesthetized by inhalation with 3% isoflurane and then intraperitoneally injected with 10 mg/kg LPS (from 055:B5, L8880; Solarbio, Beijing, China). An equal amount of saline was injected into the control group. The cecal ligation and puncture (CLP) sepsis models were established in mice as follows. Mice were anaesthetized with isoflurane. A 1‒2 cm abdominal midline incision was made to expose the cecum. After ligating the distal part of the cecum, the ligated segment was punctured once with a 22G needle. The appendix was repositioned and injected subcutaneously with 1 mL of sterile saline. The incision was closed with a 9-mm steel wound clip. miR-29b-1-5p was downregulated or overexpressed by tail vein injection of 80 mg/kg mmu-miR-29b-1-5p antagomir or 30 mg/kg agomir (General Biol, Chuzhou, China) dissolved in 100 μL of sterile saline daily for 3 days [ 19– 21] prior to LPS injection or CLP surgery. Echocardiographic testing was performed 24 h after LPS induction or CLP surgery. After echocardiographic testing, the mice were euthanized by intraperitoneal injection of pentobarbitone (200 mg/kg) immediately, after which heart tissue and blood sample were harvested. Six mice were used per group. The sequences of agomir and antagomir are listed in Table 1.

Table 1 The sequences of agomir and antagomir

Name	Sequence (5′→3′)
miR-29b-1-5p agomir	Sense	GCUGGUUUCAUAUGGUGGUUUA
Antisense	AACCACCAUAUGAAACCAGCUU
NC agomir	Sense	UUCUCCGAACGUGUCACGUTT
Antisense	ACGUGACACGUUCGGAGAATT
miR-29b-1-5p antagomir	UAAACCACCAUAUGAAACCAGC
NC antagomir	CAGUACUUUUGUGUAGUACAA

For survival analysis, 20 additional mice were taken from each group according to previous methods [22]. The mouse model of LPS-induced sepsis was induced using the aforementioned procedure, and the LPS dose was adjusted to 25 mg/kg [23] to achieve a lethal dose. The CLP model was generated using the same procedure as described above. Mice were observed for survival every 24 h for 96 h.

Echocardiography

Mice were anaesthesized via inhalation of isoflurane and a heating pad was used to maintain their core temperature at the same level 24 h after LPS induction or CLP surgery. A VisualSonics Vevo-3100 Ultrasound (FUJIFILM VisualSonics, Tokyo, Japan) was used for echocardiography measurements. The Vevo 3100 imaging program was used to analyze the M-mode images taken along the short axis of the left ventricle. Left ventricle end-systolic diameters (LVIDs) and left ventricle end-diastolic diameters (LVIDd) were used to calculate fractional shortening (FS): FS (%)=[(LVIDd‒LVIDs)/LVIDd]×100%; and both the end-diastolic and end-systolic volumes of the left ventricle (EDV and ESV, respectively) were assessed to calculate the ejection fraction (EF): EF (%)=[(EDV–ESV)/EDV]×100% [24].

Histological testing

After being fixed in 4% formaldehyde, the heart tissues were cut transversely into paraffin-embedded sections (4-μm sections). The tissue sections were dewaxed using xylene (Beyotime, Shanghai, China) and rehydrated using gradient alcohol. Histological staining was performed using a haematoxylin and eosin (H&E) staining kit and a Masson’s staining kit (Solarbio, Beijing, China), followed by dehydration and transparency [ 25, 26]. Neutral resin was used to seal the slices, which were observed under a light microscope (Tokyo, Japan). The cardiac injury score was measured based on HE staining as previously described [27]. Briefly, 0=no lesion, 1=myocardial damage <25%, 2=myocardial damage 25%–50%, 3=myocardial damage 50%–75%, and 4=myocardial damage >75%. The fibrotic area was measured based on Masson’s trichrome staining using ImageJ software (NIH, Bethesda, USA). The sections were assessed by pathologists through a double-blind analysis under an optical microscope (Olympus).

Immunohistochemical (IHC) staining

After being routinely dewaxed and rehydrated, the slices were heated thrice for 5 min each in pH 6.0 antigen repair solution and washed with PBS. Then, 3% hydrogen peroxide solution was added to the slices (Beyotime), which were incubated for 25 min, washed with PBS, and blocked with 3% bovine serum albumin (BSA; Servicebio, Wuhan, China) for 30 min at room temperature (RT). The slices were rinsed, followed by overnight incubation at 4°C with anti-α-SMA (1:50; ab5694; Abcam, Cambrige, UK) and then a 50-min incubation at room temperature with horseradish peroxidase (HRP)-coupled anti-IgG (1:50; ab270144; Abcam). A 3,3′-diaminobenzidine (DAB) color development solution (Servicebio) was used to develop slices for 3 min. Tap water was subsequently used to rinse the slices. The sections were restained with hematoxylin for an additional 3 min after being cleaned with tap water. Sections were dehydrated using gradient ethanol, sealed with xylene transparently, and finally observed under a light microscope [ 28, 29]. α-SMA protein expression is shown in brown. The optical density of the α-SMA signal was assessed by ImageJ software (NIH).

Cell processing and transfection

The HL-1 mouse cardiomyocyte cell line was procured from Procell (Wuhan, China). The cells were subsequently cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum (FBS) at 37°C in a 5% CO ₂ atmosphere. After 24 h, HL-1 cells were exposed to 1 μg/mL LPS [30]. HL-1 cells was transfected with the miR-29b-1-5p antagomir (General Biol) at a final concentration of 50 nM, or the NC antagomir (negative control; General Biol), the TERF2 shRNA vector (GenePharma, Shanghai, China) at a final concentration of 1 μg/mL, or the sh-NC vector (negative control; GenePharma) using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, USA). The transduction of cells was performed 24 h before LPS induction. The sequences for vector construction are listed in Table 2.

Table 2 The sequences of sh-NC vector and sh-TERF2

Name	Sequence (5′→3′)
sh-NC	Sense	GATCCGCAGATGAAGGCACGGTCACGCTCGAGCGTGACCGTGCCTTCATCTGCTTTTTG
Antisense	AATTCAAAAAGCAGATGAAGGCACGGTCACGCTCGAGCGTGACCGTGCCTTCATCTGCG
Sh-TERF2	Sense	GATCCGGCTTTCAAAGCTCTGTCTACTCTCGAGAGTAGACAGAGCTTTGAAAGCTTTTTG
Antisense	AATTCAAAAAGCTTTCAAAGCTCTGTCTACTCTCGAGAGTAGACAGAGCTTTGAAAGCG

Enzyme-linked immunosorbent assay (ELISA)

Mouse serum or HL-1 cell supernatant was collected. The levels of tumor necrosis factor α (TNF-α), interleukin (IL)-1β, IL-6, and cardiac troponin I (cTnI) were measured separately using the corresponding ELISA kits according to the manufacturer’s instructions. The kits included TNF-α (SEKM-0034; Solarbio), mouse IL-6 (SEKM-0007; Solarbio), IL-1β (SEKM-0002; Solarbio), and mouse cTnI (KS11280; Keshun Science and Technology, Shanghai, China).

qRT-PCR

TRIzol was used to extract total RNA from mouse left ventricle tissue and HL-1 cells. A spectrophotometer was used to measure the RNA concentration and quality. A TaqMan microRNA reverse transcription kit (Applied Biosystems, Waltham, USA) was used for miRNA reverse transcription. A reverse transcription kit (Genecopoeia, Guangzhou, China) was used for reverse transcription of the mRNA to cDNA. SYBR Premix Ex Taq (Takara, Dalian, China) was used on an ABI 7500HT system (Applied Biosystems) for quantitative real-time PCR. The 2 ^–ΔΔCt method [31] was used for data processing and analysis. U6 was used as the miRNA internal control, while GAPDH was used as the internal reference for mRNA expression. Table 3 lists the sequences of the primers.

Table 3 The sequences of the primers used in this study

Gene	Sequence (5′→3′)
miR-29b-1-5p	RT primer	GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTAAACC
Forward primer	GCGCTGGTTTCATATGGT
Reverse primer	CAGTGCGTGTCGTGGA
U6	Forward primer	CTCGCTTCGGCAGCACA
Reverse primer	AACGCTTCACGAATTTGCGT
TERF2	Forward primer	CTGTCTACTGCACAAGACTCAG
Reverse primer	TGCCAGATTAGCAAGTACCAGA
GAPDH	Forward primer	AGGTCGGTGTGAACGGATTTG
Reverse primer	TGTAGACCATGTAGTTGAGGTCA

RT: reverser transcription.

Western blot analysis

RIPA lysis buffer (Beyotime) was used to extract total protein from HL-1 cells or mouse left ventricle tissues, and the total protein concentration was determined using a BCA kit (Beyotime) as previously described [32]. After separation by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), 50 μg of total protein was transferred to PVDF membranes (Millipore, Billerica, USA), which were blocked with 5% skim milk in TBST solution for 2 h. Then the membranes were incubated overnight at 4°C with the following antibodies: anti-TERF2 (1:1000; 66893-1-Ig; Proteintech, Wuhan, China), anti-Bax (1:1000; ab32503; Abcam), anti-Bcl-2 (1:2000; ab182858; Abcam), anti-cleaved caspase-3 (1:5000; ab214430; Abcam), anti-Pro-caspase-3 (1:10,000; ab32499; Abcam), anti-cleaved PARP (1:1000; ab32064; Abcam), anti-TLR2 (1:1000; DF7002; Affinity Bioscience, Beijing, China), anti-TLR4 (1:1000; 19811-1-AP; Proteintech), anti-TFEB (1:1000; 13372-1-AP; Proteintech), anti-LAMP1(1:1000; 67300-1-Ig; Proteintech), anti-LC3II (1:1000; 14600-1-AP; Proteintech), anti-β-actin (1:1000; ab8227; Abcam), and anti-GAPDH (1:1000, AF7021; Affinity Bioscience), followed by incubation with HPR-conjugated goat anti-mouse or rabbit IgG secondary antibody (1:2000; SA00001-2 or SA00001-1; Proteintech) for 2 h at room temperature. Finally, protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Xinsamax, Suzhou, China). β-Actin or GAPDH was used as the internal control.

MTT assay

HL-1 cells from different groups were inoculated at a density of 5×10 ³ cells/well in 96-well plates and cultured for 0, 24, 48, or 72 h. At each time point, MTT solution (50 μL; Beyotime) was added to each well in each group and incubated for 4 h at 37°C. After the MTT and culture medium mixture were discarded, 150 μL dimethyl sulfoxide was added to each well to dissolve the crystals, and the absorbance was measured at 490 nm using a multifunctional microplate reader (PerkinElmer, Waltham, USA).

Flow cytometry analysis of cell apoptosis

As per the manufacturer’s instructions, an Annexin V-FITC/PI Apoptosis Detection kit (Keygene, Nanjing, China) was used to assess apoptosis. After treatment, the cells were collected and resuspended in 500 μL of binding buffer. The suspension was subsequently stained with PI staining solution and Annexin V-FITC staining solution, each in a volume of 5 μL, at room temperature for 5‒10 min in the dark. NovoCyte Flow cytometry (Agilent, Santa Clara, USA) analysis was conducted immediately after collection.

Bioinformatics analysis

The GSE72380, GSE29914, and GSE185754 datasets were downloaded from the GEO database ( https://www.ncbi.nlm.nih.gov/geo/) for analysis of differentially expressed miRNAs and mRNAs in dysfunctional septic cardiac tissues from mice. The mmu-miR-29b-1-5p-targeted genes were predicted by TargetScan ( https://www.targetscan.org/vert_72/) with a threshold of total context++score ≤‒0.3. The functional enrichment of the mmu-miR-29b-1-5p downstream target gene set was analyzed via Metascape ( https://metascape.org/gp/index.html#/main/step1).

Dual-luciferase reporter gene assay

The use of TargetScan allowed the prediction of potential binding sites between miR-29b-1-5p and TERF2. The miR-29b-1-5p binding site was introduced into the TERF2 3′UTR wild-type (WT) and TERF2 3′UTR mutant (MUT) sequences before being inserted into the psi-CHECK2 luciferase vector to create the psi-CHECK2-TERF2-WT and psi-CHECK2-TERF2-MUT vectors. HL-1 cells were cotransfected with the aforementioned vectors and miR-29b-1-5p agomir or NC agomir using Lipofectamine 2000. Forty-eight hours after transfection, the relative luciferase activity was measured using a dual luciferase reporter kit (Promega, Madison, USA) as directed by the manufacturer.

Statistical analysis

The results were analyzed using GraphPad Prism 8.0 (GraphPad Software, La Jolla, USA). Data are presented as the mean±the standard deviation (SD). One-way ANOVA with Tukey post hoc test was carried out to analyze the differences among more than two groups. Student’s t test was carried out to analyze the difference between two groups. Pearson’s correlation analysis was also conducted. A P value of less than 0.05 was considered statistically significant.

Results

GEO dataset screening for septic myocardial injury-associated miRNAs

Differentially expressed miRNAs in normal cardiac tissues and septic cardiac tissues from mice were analyzed from the GSE72380 and GSE29914 microarray datasets. Three significantly downregulated miRNAs and 8 significantly upregulated miRNAs ( Figure 1A,B; |log ₂FC|>0.4, P<0.05) were obtained from the GSE72380 microarray. Three differentially upregulated miRNAs and 1 differentially downregulated miRNA were obtained from the GSE29914 chip ( Figure 1C,D; |log ₂FC|>0.4, P<0.05). Two codifferentially expressed miRNAs, i. e., miR-29b-1-5p and miR-155, were obtained ( Figure 1E). The role of miR-155 in sepsis has been reported [ 33, 34]. Therefore, miR-29b-1-5p was chosen for further investigation. It was upregulated in both the GSE72380 and GSE29914 ( Figure 1F‒G).

Figure 1 .

Gene Expression Omnibus (GEO) dataset screening for septic myocardial injury-associated miRNAs

(A) Volcano plot and (B) heatmap of GSE72380. (C) Volcano plot and (D) heatmap of GSE29914. (E) Venn diagram of the differentially expressed genes identified in the GSE72380 and GSE29914 cohorts according to the intersection (|log2FC|>0.4, P<0.05). (F,G) Expression of miR-29b-1-5p in the GSE72380 and GSE29914 cohorts. *P<0.05.

Inhibition of miR-29b-1-5p ameliorates LPS-induced septic myocardial injury in mice

The function of miR-29b-1-5p was subsequently explored in a mouse sepsis model. A mouse model of septic myocardial injury was induced by LPS. The survival rate of the mice after LPS treatment was lower than that of the control group ( Figure 2A), and the EF and FS were significantly reduced ( Figure 2B). However, LVIDd (mm), LVIDs (mm), and heart rate were significantly greater in LPS-treated mice than in control mice ( Table 4). H&E and Masson’s trichrome staining revealed that mice in the control group had clear myocardial fibers and uniform and clear myocardial cell spacing without degeneration or necrosis, while the myocardial cells in the LPS-treated mice were significantly fractured and deformed and had lysed myocardial fibers with enhanced fibrosis ( Figure 2C,D). Correspondingly, the cardiomyocyte injury score and fibrotic area were increased in LPS-treated mice ( Figure 2F,G). IHC staining revealed that α-SMA level in the myocardial tissues of LPS-treated mice was significantly increased ( Figure 2E,H). ELISA results for inflammatory cytokines showed that TNF-α, IL-1β, and IL-6 levels in mouse serum were markedly increased ( Figure 2I‒K), and in addition, the expression level of cTnI in mouse serum was also significantly increased ( Figure 2L). qRT-PCR revealed that LPS promoted miR-29b-1-5p expression in the myocardial tissues of the mice ( Figure 2M). Accumulating evidence indicates that the autophagy-lysosomal pathway, which plays a fundamental role in cellular homeostasis and antimicrobial immunity, is commonly impaired in sepsis [35]. Therefore, changes in the expressions of autophagy-lysosomal pathway-related proteins were also determined. As shown in Figure 2N, the expressions of TLR2, TLR4, TFEB, LAMP1, and LC3II increased in LPS-treated mice, indicating that LPS treatment activated the lysosomal pathway in the cardiac tissues of model mice. miR-29b-1-5p expression in the myocardial tissue of mice was subsequently inhibited by miR-29b-1-5p antagomir injection ( Figure 2M). The inhibition of miR-29b-1-5p promoted survival; increased EF and FS; decreased LVIDd (mm), LVIDs (mm), and heart rate; alleviated the degree of myocardial tissue injury and fibrosis in mice; and significantly decreased the α-SMA, TNF-α, IL-1β, L-6 and cTnI levels ( Figure 2A‒L and Table 4). In contrast, the miR-29b-1-5p agomir further increased LPS-induced septic myocardial injury and inflammation ( Supplementary Figure S1). Interestingly, the miR-29b-1p antagomir inhibited LPS-induced activation of the lysosomal pathway by reducing the expressions of TLR2, TLR4, TFEB, LAMP1, and LC3II ( Figure 2N). These findings imply that miR-29b-1-5p silencing can mitigate LPS-induced septic myocardial damage in mice.

Figure 2 .

Inhibition of miR-29b-1-5p ameliorates lipopolysaccharide (LPS)-induced septic myocardial injury in mice

(A) Mice received a single intraperitoneal injection of 25 mg/kg LPS (lethal dose) or a tail vein injection of 80 mg/kg miR-29b-1-5p/NC antagomir for 3 consecutive days (24 h later receiving LPS injection), after which the survival conditions were assessed for 96 h, and survival rate curves were generated. An equal amount of saline was injected into the control group. n=20. Mice received a single intraperitoneal injection of 10 mg/kg LPS or a tail vein injection of 80 mg/kg miR-29b-1-5p/NC antagomir for 3 consecutive days (24 h later receiving LPS injection). (B) Twenty-four hours after LPS injection, echocardiography tests were performed. (C,D) Mice were euthanized, and histological analysis of myocardial tissue injury was performed via hematoxylin and eosin (HE) staining and Masson’s trichrome staining. Scale bar: 50 μm. (F,G) The cardiac injury score and fibrotic area were assessed via HE and Masson’s trichrome staining, respectively. (E,H) α-Smooth muscle actin (α-SMA) expression in mouse myocardial tissues was determined via immunohistochemistry (IHC) staining. Scale bar: 20 μm. (I‒L) Tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6 and cardiac troponin I (cTnI) levels in mouse serum were determined by enzyme-linked immunosorbent assay (ELISA). (M) The miR-29b-1-5p expression level in mouse myocardial tissue was determined by real-time quantitative reverse transcription PCR (qRT-PCR). n=6. (N) The protein levels of TLR2, TLR4, TFEB, LAMP1 and LC3II in mouse myocardial tissues were determined by western blot analysis. n=3. **P<0.01 vs the control group; #P<0.05 and ##P<0.01 vs. the LPS+NC antagomir group.

Table 4 Echocardiography data of LPS-induced sepsis model

Parameter	Control	LPS	LPS+NC antagomir	LPS+miR-29b-1-5p antagomir
Ejection fraction (%)	82.04±7.00	48.55±6.02**	49.13±8.10	68.49±9.80 ##
Fractional shortening (%)	61.64±9.70	19.42±3.99**	20.72±5.33	33.37±8.55 #
LVIDd (mm)	1.78±0.10	2.39±0.11**	2.45±0.11	1.81±0.20 ##
LVIDs (mm)	0.68±0.15	1.92±0.13**	1.94±0.10	1.16±0.25 ##
Heart rate (bpm)	471.67±56.83	541.83±49.22*	534.17±23.38	464.00±19.37 #

* P<0.05, ** P<0.01 vs control group; ^# P<0.05, ^## P<0.01 vs LPS+NC antagomir.

Inhibition of miR-29b-1-5p ameliorates CLP-induced septic myocardial injury in mice

The CLP model is currently the gold standard for sepsis studies [36]. Thus, to further validate the role of miR-29b-1-5p, a mouse model of CLP-induced septic myocardial injury was used. The results showed that mice in the CLP group had reduced survival rate, reduced EF and FS ( Figure 3A,B), increased LVIDd (mm), LVIDs (mm), and heart rate ( Table 5), apparent myocardial tissue injury and enhanced fibrosis, and elevated α-SMA expression in the myocardium compared with those in the control group ( Figure 3C‒H). The expressions of TNF-α, IL-1β, L-6, and cTnI in the serum were increased, and the expression of miR-29b-1-5p was upregulated in myocardial tissues ( Figure 3I‒M). Moreover, the expressions of TLR2, TLR4, TFEB, LAMP1, and LC3II were also increased in CLP mice ( Figure 3N). These CLP-induced changes could be reversed by the inhibition of miR-29b-1-5p ( Figure 3A‒N). Conversely, the miR-29b-1-5p agomir further increased CLP-induced septic myocardial injury and inflammation ( Supplementary Figure S2). The above findings suggest that miR-29b-1-5p suppression protects mice from CLP-induced septic myocardial injury.

Figure 3 .

Inhibition of miR-29b-1-5p ameliorates CLP-induced septic myocardial injury in mice

(A) Mice were subjected to CLP surgery or tail vein injection of 80 mg/kg miR-29b-1-5p/NC antagomir for 3 consecutive days (24 h later receiving CLP surgery), after which the survival conditions were assessed for 96 h, and survival rate curves were generated. n=20. A sham operation was performed on the control group. n=20. (B) Twenty-four hours after CLP surgery, echocardiography was performed. (C,D) Mice were euthanized, and histological analysis of myocardial tissue injury was performed via HE staining and Masson’s trichrome staining. Scale bar: 50 μm. (F,G) The cardiac injury score and fibrotic area were assessed via HE and Masson’s trichrome staining, respectively. (E,H) The protein levels and distribution of α-SMA in mouse myocardial tissues were examined using IHC staining. Scale bar: 20 μm. (I‒L) TNF-α, IL-1β, IL-6 and cTnI levels in mouse serum were determined by ELISA. (M) The miR-29b-1-5p expression level in mouse myocardial tissue was determined by qRT-PCR. n=6. (N) The protein levels of TLR2, TLR4, TFEB, LAMP1 and LC3II in mouse myocardial tissues were determined by western blot analysis. n=3. **P<0.01 vs the control group; #P<0.05 and ##P<0.01 vs the CLP+NC antagomir group.

Table 5 Echocardiography data of CLP-induced sepsis model

Parameter	Control	CLP	CLP+NC antagomir	CLP+miR-29b-1-5p antagomir
Ejection fraction (%)	81.53±5.13	36.35±8.93**	34.89±21.49	71.07±9.53 ##
Fractional shortening (%)	54.30±6.30	16.70±7.00**	15.98±11.67	33.95±9.56 #
LVIDd (mm)	1.79±0.09	2.49±0.25**	2.51±0.20	2.14±0.29 #
LVIDs (mm)	0.82±0.13	2.07±0.24**	2.11±0.32	1.42±0.14 ##
Heart rate (bpm)	457.67±29.80	534.00±23.15**	533.33±34.09	480.00±35.41 #

* P<0.05, ** P<0.01 vs control group; ^# P<0.05, ^## P<0.01 vs CLP+NC antagomir.

Inhibition of miR-29b-1-5p ameliorates LPS-induced cardiomyocyte dysfunction in vitro

The functional role of miR-29b-1-5p in cardiomyocyte dysfunction in mice was further explored in a cellular model. A septic myocardial injury cell model was induced by LPS in HL-1 cells. HL-1 cells were treated with the miR-29b-1-5p antagomir, and qRT‒PCR was subsequently used to analyze the extent of the inhibition. Compared to the control group, the LPS-induced HL-1 cells exhibited upregulation of miR-29b-1-5p. However, after transduction with the miR-29b-1-5p antagomir, this upregulation was considerably reduced ( Figure 4A). Moreover, LPS treatment inhibited HL-1 cell viability, which was significantly increased following the inhibition of miR-29b-1-5p ( Figure 4B). Flow cytometry assays showed that HL-1 cell apoptosis was induced by LPS, which was inhibited by miR-29b-1-5p antagomir transfection ( Figure 4C). According to the ELISA results, TNF-α, IL-1β, and IL-6 levels were considerably greater in the cells of the LPS group than in cells of the control group. However, these levels were lower after miR-29b-1-5p antagomir transduction ( Figure 4D‒F). Concerning apoptotic markers, LPS stimulation increased the levels of the proapoptotic proteins Bax and cleaved caspase-3 while decreasing the level of the antiapoptotic protein Bcl-2. Inhibition of miR-29b-1-5p increased Bcl-2 level while simultaneously decreasing Bax and cleaved caspase-3 levels ( Figure 4G‒H). Consistent with the in vivo results, LPS-induced upregulation of TLR2, TLR4, TFEB, LAMP1, and LC3II was also reduced by inhibition of miR-29b-1-5p ( Figure 4I). Therefore, miR-29b-1-5p inhibition can ameliorate LPS-induced cardiomyocyte dysfunction in mice in vitro.

Figure 4 .

Inhibition of miR-29b-1-5p ameliorates LPS-induced cardiomyocyte dysfunction in mice in vitro

(A) Twenty-four hours after transfecting HL-1 cells with the NC or miR-29b-1-5p antagomir, LPS (1 μg/mL) stimulation was applied for another 24 h, and miR-29b-1-5p expression was validated in each group by qRT-PCR. (B) After LPS treatment for 0, 24, 48, or 72 h, MTT assay was performed to examine the viability of the HL-1 cells. (C) Flow cytometry was used to evaluate apoptosis in HL-1 cells. (D‒F) TNF-α, IL-1β, and IL-6 levels in HL-1 cell supernatants were measured by enzyme-linked immunosorbent assay (ELISA). (G‒I) Western blot analysis was used to measure Bax, Bcl-2, cleaved caspase-3, pro-caspase-3, TLR2, TLR4, TFEB, LAMP1 and LC3II protein levels in HL-1 cells. n=3. **P<0.01 vs the control group; ##P<0.01 vs the LPS+NC antagomir group.

TERF2 is a downstream target of miR-29b-1-5p

Additional screening for downstream targets of miR-29b-1-5p was carried out, and the results showed that the TargetScan online database predicted 214 target genes. The target genes were then functionally enriched by Metascape and were found to be associated with the cell cycle pathway ( Figure 5A,B). The GSE185754 microarray analysis of target genes associated with cell cycle pathways revealed that EP300, TERF2, MLH3, and POLD4 expressions were significantly downregulated in patients with sepsis ( Figure 5C). Validation by qRT-PCR in LPS-treated HL-1 cells indicated that these 4 factors were downregulated in the LPS group of cells, with the most significant difference in TERF2 expression ( Supplementary Figure S3A‒D). Therefore, TERF2 was selected for subsequent analyses. Consistent with our prediction, miR-29b-1-5p was able to bind to the TERF2 3′UTR ( Figure 5D). LPS treatment downregulated TERF2 mRNA and protein expression, while the miR-29b-1-5p antagomir upregulated TERF2 mRNA and protein expression ( Figure 5E,F). The correlation between TERF2 mRNA and miR-29b-1-5p levels in mouse cardiac tissues was determined. The expressions of TERF2 and miR-29b-1-5p were negatively correlated in the cardiac tissue of mice in the LPS and CLP mouse models. ( Figure 5G).

Figure 5 .

TERF2 is a downstream target of miR-29b-1-5p, and miR-29b-1-5p can target and inhibit TERF2

(A) Schematic diagram of miR-29b-1-5p target gene screening. (B) Metascape analysis of miR-29b-1-5p target gene function. (C) GSE185754 microarray analysis of miR-29b-1-5p target gene expression. (D) The ability of the predicted miR-29b-1-5p to target TERF2 was verified by dual-luciferase reporter gene assay. (E) qRT-PCR and (F) western blot analysis showing TERF2 mRNA and protein expression levels in response to LPS and miR-29b-1-5p antagomir transfection in HL-1 cells. (G) Correlation analysis between miR-29b-1-5p and TERF2 in the myocardial tissues of the LPS-treated mice and CLP-treated mice. *P<0.05, **P<0.01, ***P<0.001 vs the control group; ##P<0.01 vs the LPS+NC antagomir group.

Silencing of TERF2 partially reverses the protective effect of miR-29b-1-5p inhibition on LPS-induced cardiomyocyte apoptosis and inflammation

The role of TERF2 in myocardial functional impairment in sepsis was further explored in vitro. In HL-1 cells, the introduction of the shTERF2 vector resulted in the inhibition of TERF2 expression, and the efficacy of the transfection was assessed by immunoblotting ( Figure 6A). After LPS treatment, silencing of TERF2 impacted HL-1 cell viability; promoted apoptosis; increased TNF-α, IL-1β and IL-6 levels; increased cleaved PARP, cleaved caspase-3, TLR2, TLR4, TFEB, LAMP1 and LC3II levels; and partially abolished the protective effect of the miR-29b-1-5p antagomir on HL-1 cell function ( Figure 6B‒I). The above results indicate that silencing of TERF2 can partially reverse the protective effects of miR-29b-1-5p inhibition on LPS-induced cardiomyocyte apoptosis and the inflammatory response.

Figure 6 .

Silencing of TERF2 partially reverses the ameliorative effect of miR-29b-1-5p inhibition on LPS-induced cardiomyocyte apoptosis and inflammation

(A) HL-1 cells were transfected with sh-TERF2 or sh-NC vector. Forty-eight hours later, HL-1 cells were collected to detect the protein expression of TERF2. (B‒I) HL-1 cells were transfected with sh-TERF2 or the miR-29b-1-5p antagomir for 24 h, followed by stimulation with LPS. MTT assay was performed to examine HL-1 cell viability (B). Flow cytometry was performed to evaluate HL-1 cell apoptosis (C). ELISA was also conducted to evaluate TNF-α, IL-1β, and IL-6 levels in HL-1 cells (D‒F). Western blot analysis was conducted to determine the protein levels of TERF2, cleaved PARP, cleaved caspase-3, pro-caspase-3, TLR2, TLR4, TFEB, LAMP1 and LC3II in HL-1 cells (G–I). **P<0.01 vs LPS+NC antagomir+sh-NC; #P<0.05, ##P<0.01 vs LPS+miR-29b-1-5p antagomir+sh-TERF2.

Discussion

Myocardial damage is one of the most serious consequences of sepsis and is the major cause of mortality in critical care units [37]. miRNAs have been reported to participate in sepsis-induced myocardial injury and serve as diagnostic markers and/or treatment targets [38]. Here, bioinformatics analysis of the sepsis-associated datasets GSE72380 and GSE29914 identified that miR-29b-1-5p is upregulated in both datasets. A previous study reported that miR-29b-1-5p caused apoptosis in ischaemia‒reperfusion–induced myocardial injury [39]; however, the role of miR-29b-1-5p has not been reported in sepsis-induced myocardial injury. Therefore, it is hypothesized that miR-29b-1-5p has a potential mechanism of action in septic myocardial injury.

Sepsis-induced cardiac dysfunction is usually associated with reduced EF and FS, increased cardiomyocyte apoptosis, and enhanced inflammatory response [40]. Previous studies have reported that sepsis-induced myocardial injury and inflammation usually exhibit increased expressions of factors such as α-SMA in myocardial tissue and cTnI, TNF-α, IL-1β, and IL-6 in serum [ 12, 41]. The LPS and CLP surgical models are general strategies for comprehending the process of sepsis-related myocardial dysfunction [42]. Numerous previous studies have shown that microRNAs play different roles in septic myocardial dysfunction. MiR-193-3p and miR-125b mitigate myocardial injury in septic mice by targeting the STAT3/HMGB1 axis [ 43, 44]. However, miR-377 increases inflammation and cardiomyocyte hypertrophy in septic mice [45]. Here, the effects of miR-29b-1-5p on septic myocardial dysfunction were explored for the first time by constructing LPS and CLP models. miR-29b-1-5p expression was elevated in cardiac tissues from the LPS and CLP models. miR-29b-1-5p antagonists significantly improved the symptoms of septic myocardial injury, including increasing mouse survival, increasing cardiac function, decreasing α-SMA expression in myocardial tissue, decreasing serum levels of cTnI, TNF-α, IL-1β, and IL-6, and alleviating myocardial tissue injury and fibrosis. Similar results were obtained when miR-29b-1-5p was inhibited in the LPS-induced cardiomyocyte model, which led to increased cardiomyocyte proliferation and inhibited apoptosis and inflammatory factor production. These data imply that the inhibition of miR-29b-1-5p protects against myocardial dysfunction induced by sepsis.

The downstream mechanisms of miR-29b-1-5p were further explored after confirming that elevated miR-29b-1-5p could contribute to the progression of myocardial injury in sepsis. miRNAs mostly regulate physiological effects in plants and animals by suppressing target mRNA expression [46], and miR-29b-1-5p is upregulated in septic myocardial disorder models. Therefore, the downstream target genes repressed by miR-29b-1-5p were further investigated via bioinformatics. Four downregulated target genes ( TERF2, Pold4, MLH3, and Ep300) were identified. Analysis of TERF2 expression in LPS-induced cardiomyocytes showed that TERF2 expression was most significantly altered. TERF2 is a widely expressed protein that can bind directly to double telomeric repeat sequences in tandem arrays and is involved in the protection of telomere structure and chromosome ends [47]. Inhibition of TERF2 was previously reported to induce growth arrest and apoptosis in melanoma [48], laryngeal cancer [ 48, 49], colorectal cancer [47], and other cancer cells. In addition, mutations in the TERF2 protein can cause persistent inflammation in vascular disease in atherosclerotic mice [50]. miRNAs mediate translation through partial base pairing to complementary sequences in the 3′UTR of target mRNAs [51]. Dual luciferase reporter gene assays verified that miR-29b-1-5p was able to bind to the 3′UTR of TERF2 and that miR-29b-1-5p negatively regulated TERF2 expression. Therefore, TERF2 was considered a downstream target gene of miR-29b-1-5p. The inhibition of TERF2 expression in LPS-induced cardiomyocytes via functional reversion experiments showed that silencing of TERF2 reversed the miR-29b-1-5p antagomir-induced upregulation of TERF2 expression, subsequently inhibited cell proliferation, promoted apoptosis and inflammatory cytokine expression, and partially abrogated the protective effect of the miR-29b-1-5p antagomir on septic cardiomyocyte injury. However, in addition to TERF2, several genes have also been reported to be regulated in a targeted manner by miR-29b-1-5p. In oral squamous cell carcinoma, miR-29b-1-5p targets cadherin 1 to promote EMT [52]. In gastric cancer, miR-29b-1-5p inhibits the expression of the PH domain and leucine-rich repeat protein phosphatase 1 (PHLPP1) to promote cell growth [53]. In septic mice, PHLPP1 could countermodulate the STAT1-mediated inflammatory pathway [54]. Cadherin 1 is reduced in a sepsis-induced acute kidney injury cell model [55]. However, further studies are needed to determine whether these genes are involved in the activity of miR-29b-1-5p in sepsis.

A number of studies have shown that sepsis can cause autophagy to occur in the heart and other organs and that autophagy changes dynamically throughout sepsis [56]. During autophagy, depletion of TERF2 promotes autophagy [57]. Lachettini et al. [58] reported that TERF2 knockdown induces autophagy by sequestering HMGB1 into the nucleus, where it exerts its pro-autophagic effect when it is shuttled from the nucleus to the cytosol [59]. Moreover, inhibition of TERF2 leads to autophagic death, and apoptosis has also been proven to occur in gastric cancer [60]. Most current studies suggested that the induction of autophagy in sepsis can ameliorate sepsis-induced myocardial damage [ 30, 61]. However, in the present study, we found that the miR-29b-1-5p antagomir had a cardioprotective effect on sepsis but inhibited LPS- or CLP-induced autophagy-lysosomal pathway activation. Similarly, Zhao et al. [62] confirmed that the reduction in the number of autophagosomes and the reduction in the expression of the lysosome marker LAMP1 are associated with the protective effect of ulinastatin in LPS-induced sepsis. The discrepancy in the role of cardiac autophagy in sepsis may be associated with the severity of sepsis, drug specificity, and difference in the timing of delivery [63].

In conclusion, this study demonstrated for the first time that inhibition of miR-29b-1-5p ameliorates septic myocardial injury. Mechanistically, inhibition of miR-29b-1-5p upregulates TERF2 expression, which in turn inhibits sepsis-induced myocardial tissue injury, inflammation, and cardiomyocyte apoptosis. Our findings indicate that miR-29b-1-5p may be a promising therapeutic target for septic myocardial injury.

Supplementary Data

Supplementary data is available at Acta Biochimica et Biphysica Sinica online.

COMPETING INTERESTS

The authors declare that they have no conflict of interest.

Funding Statement

This work was supported by the grants from the National Natural Science Foundation of China (No. 81971819 and No. 82204986) and the Scientific Research Plan Project of Hunan Provincial Health Commission (No. D202304117248).