Abstract
The Escherichia coli rhaSR operon encodes two AraC family transcription activators, RhaS and RhaR, and is activated by RhaR in the presence of l-rhamnose. β-Galactosidase assays of various rhaS-lacZ promoter fusions combined with mobility shift assays indicated that a cyclic AMP receptor protein (CRP) site located at −111.5 is also required for full activation of rhaSR expression. To address the mechanisms of activation by CRP and the RNA polymerase α-subunit C-terminal domain (α-CTD) at rhaSR, we tested the effects of alanine substitutions in CRP activating regions 1 and 2, overexpression of a truncated version of α (α-Δ235), and alanine substitutions throughout α-CTD. We found that DNA-contacting residues in α-CTD are required for full activation, and for simplicity, we discuss α-CTD as a third activator of rhaSR. CRP and RhaR could each partially activate transcription in the absence of the other two activators, and α-CTD was not capable of activation alone. In the case of CRP, this suggests that this activation involves neither an α-CTD interaction nor cooperative binding with RhaR, while in the case of RhaR, this suggests the likelihood of direct interactions with core RNA polymerase. We also found that CRP, RhaR, and α-CTD each have synergistic effects on activation by the others, suggesting direct or indirect interactions among all three. We have some evidence that the α-CTD–CRP and α-CTD–RhaR interactions might be direct. The magnitude of the synergistic effects was usually greater with just two activators than with all three, suggesting possible redundancies in the mechanisms of activation by CRP, α-CTD, and RhaR.
The cyclic AMP (cAMP) receptor protein (CRP) regulates the expression of more than 100 promoters in Escherichia coli (for a review, see reference 15). As a prerequisite to activating transcription, CRP must bind to a 22-bp twofold-symmetric recognition site on DNA (2, 9, 15). Once bound, the predominant method of activation by CRP appears to be through protein contacts with RNA polymerase (RNAP). Depending upon the architecture of the promoter, one or two activation regions on the surface of CRP (AR1 and AR2) are involved in positive contacts with the α subunit of RNAP.
CRP AR1 is necessary for activation at class I CRP-dependent promoters, where CRP binds upstream and not adjacent to RNAP, and interacts with a defined set of amino acids on the carboxyl-terminal domain of the RNAP α subunit (α-CTD) (33, 38, 39) (reviewed in reference 8). To activate class II promoters, where CRP binds immediately adjacent to RNAP, CRP AR2 is necessary for positive interactions with the amino-terminal domain of the α subunit (21, 27, 30) (reviewed in reference 5). At class II promoters, contacts are also made between CRP AR1 and α-CTD (36, 39). Finally, a third group of CRP-dependent promoters, called class III, is characterized by the involvement of CRP and a regulon-specific regulatory protein. The mechanism of CRP activation at class III promoters is somewhat less well defined than at class I or class II but in most cases seems to involve CRP contacts with the other activator protein (12), contacts with α-CTD (37), and/or structural changes in DNA (23, 25, 26, 28).
The l-rhamnose catabolic operon, rhaBAD, is a class III CRP-dependent promoter (9, 14). The rhaBAD operon is transcribed divergently from another rha operon, rhaSR, with approximately 240 bp of DNA separating their respective transcription start sites. The rhaSR operon encodes the two l-rhamnose-specific activators, RhaS and RhaR (9, 34, 35), which are both members of the AraC family of transcription activators (11). Each monomer of the dimeric RhaS and RhaR proteins contains two helix-turn-helix motifs and contacts two major grooves of DNA. RhaR regulates transcription of rhaSR by binding promoter DNA spanning −32 to −82 relative to the rhaSR transcription start site. RhaR is able to bind to its DNA recognition sequence in the absence of l-rhamnose, albeit with a lower affinity than in the presence of l-rhamnose (34, 35); however, it has been proposed that activation by RhaR does not occur until the addition of l-rhamnose (35). Upon l-rhamnose induction, RhaR was found to activate rhaSR transcription 5-fold in vitro (35); however, in vivo measurements indicate that overall rhaSR activation was approximately 440-fold (9). Subsequent to rhaSR expression, RhaS binds DNA upstream of rhaBAD at −32 to −81 relative to the transcription start site to increase rhaBAD expression by approximately 1,000-fold (to 10 Miller units in single copy). An additional 50-fold activation of rhaBAD expression occurs when CRP occupies its binding site centered at −92.5, which places CRP adjacent to RhaS (9).
This work grew out of studies of rhaBAD regulation in which we discovered that deletion of the crp gene had a 100-fold-greater effect on rhaBAD activation than did deletion of the CRP binding site. This result suggested that CRP might have both direct and indirect effects on rhaBAD expression. To explore the origin of the indirect effect, we tested whether CRP was involved in regulation of rhaSR expression. We identified additional putative CRP binding sites in the rhaSR-rhaBAD intergenic region and determined that a site at −111.5 relative to the rhaSR transcription start site has a direct effect on rhaSR expression and thus can account for at least part of the indirect effect of CRP on rhaBAD expression. We further report the results of investigations into the mechanisms of CRP activation.
MATERIALS AND METHODS
General methods.
Transformation of DNA, restriction endonuclease digestion, and ligations were done using standard methods. All PCRs done to generate DNA fragments for cloning were performed using the Expand High Fidelity PCR System from Roche (Indianapolis, Ind.). Most DNA sequences were verified by automated dideoxy sequencing on a LI-COR 4000L sequencer (LI-COR, Inc., Lincoln, Nebr.). Primers (Table 1) for the LI-COR 4000L were custom made and IRD-41 labeled by LI-COR, Inc. Sequencing reactions were done using the Thermo Sequenase fluorescence-labeled primer cycle sequencing kit from Amersham Pharmacia Biotech (Piscataway, N.J.). Other sequencing was done on an ABI Prism 310 (Perkin-Elmer, Branchburg, N.J.). ABI Prism sequencing primers were synthesized by Oligos, Etc. (Wilsonville, Oreg.), and the Thermo Sequenase dye terminator sequencing kit from Amersham Pharmacia Biotech was used for these sequencing reactions. The wild-type rpoA gene carried on pREIIα was a gift from R. Gourse. Construction of the carboxyl-terminal domain deletion mutant form of rpoA was described by Holcroft and Egan (14).
TABLE 1.
Strains, plasmids, and phages used in this study
| Strain, phage, or plasmid | Genotype | Source or reference |
|---|---|---|
| E. coli strains | ||
| ECL116 | F− ΔlacU169 endA hsdR thi | 1 |
| SME1074 | ECL116 λ Φ(rhaS-lacZ)Δ216 recA::cat | 9 |
| SME1076 | ECL116 λ Φ(rhaS-lacZ)Δ216 Δ(rhaSR)::Km recA::cat | 9 |
| SME1461 | ECL116 λ Φ(galP1Δ4-lacZ) | 14 |
| SME1834 | ECL116 λ Φ(galP1Δ4-lacZ)/pSE207/pREP4 | 14; this study |
| SME1849 | ECL116 λ Φ(rhaB-lacZ)Δ226 | 14 |
| SME1850 | ECL116 λ Φ(rhaB-lacZ)Δ110 | 14 |
| SME1851 | ECL116 λ Φ(rhaB-lacZ)Δ84 | 14 |
| SME1853 | ECL116 λ Φ(rhaB-lacZ)Δ226 Δcrp zhc-511::Tn10 | 14 |
| SME1854 | ECL116 λ Φ(rhaB-lacZ)Δ110 Δcrp zhc-511::Tn10 | 14 |
| SME1855 | ECL116 λ Φ(rhaB-lacZ)Δ84 Δcrp zhc-511::Tn10 | 14 |
| SME2503 | ECL116 λ Φ(rhaS-lacZ)Δ128 recA::cat | This study |
| SME2504 | ECL116 λ Φ(rhaS-lacZ)Δ216 Δcrp zhc-511::Tn10 recA::cat | This study |
| SME2505 | ECL116 λ Φ(rhaS-lacZ)Δ128 Δcrp zhc-511::Tn10 recA::cat | This study |
| SME2508 | ECL116 λ Φ(rhaS-lacZ)Δ90 recA::cat | This study |
| SME2509 | ECL116 λ Φ(rhaS-lacZ)Δ90 Δcrp zhc-511::Tn10 recA::cat | This study |
| SME2521 | ECL116 λ Φ(rhaS-lacZ)Δ216 Δ(rhaSR)::Km Δcrp zhc-511::Tn10 recA::cat | This study |
| SME2523 | ECL116 λ Φ(rhaS-lacZ)Δ216 ΔSR::kan recA::cat | This study |
| SME2524 | ECL116 λ Φ(rhaS-lacZ)Δ128 ΔrhaS-Tn10 recA::cat | This study |
| SME2525 | ECL116 λ Φ(rhaS-lacZ)Δ128 Δ(rhaSR)::Km recA::cat | This study |
| SME2526 | ECL116 λ Φ(rhaS-lacZ)Δ128 Δ(rhaSR)::Km Δcrp-Tn10 recA::cat | This study |
| SME2529 | ECL116 λ Φ(rhaS-lacZ)Δ90 Δ(rhaSR)::Km recA::cat | This study |
| SME2530 | ECL116 λ Φ(rhaS-lacZ)Δ90 Δ(rhaSR)::Km Δcrp-Tn10 recA::cat | This study |
| Phages | ||
| λ RS45 | bla′-lacsc att+ int+ imm21 | 31 |
| λ SME106 | λRS45Φ(rhaS-lacZ)Δ216 | 9 |
| λ SME112 | λRS45Φ(rhaS-lacZ)Δ128 | This study |
| λ SME114 | λRS45Φ(rhaS-lacZ)Δ90 | This study |
| Plasmids | ||
| pGEM-11Zf(+) | Promega Gene Editor kit | |
| pREIIα | Apr pREIIα rpoA | 4 |
| pHTf1α | Apr pHTf1α rpoA | 33 |
| pJTC114 | AprrhaR+ in pTAC12 | 34 |
| pQE30 | Apr | QIAGEN QIAexpress kit |
| pREP4 | KanrlacIq | QIAGEN QIAexpress kit |
| pRS414 | Apr ′lacZ lacY+ lacA+ | 31 |
| pSE101 | Apr, rhaB+ rhaSR+ in pTZ18R | 9 |
| pSE104 | Apr pRS414 Φ(rhaB-lacZ)Δ110 | 9 |
| pSE117 | Apr pSR414 Φ(rhaS-lacZ)Δ128 | This study |
| pSE186 | Apr pHG165crp | 14 |
| pSE187 | Apr pSE186 (Thr158Ala) | 14 |
| pSE188 | Apr pSE186 (Gly162Ala) | 14 |
| pSE189 | Apr pSE186 (His19Ala) | 14 |
| pSE190 | Apr pSE186 (His21Ala) | 14 |
| pSE191 | Apr pSE186 (Lys101Ala) | 14 |
| pSE192 | Apr pREIIα rpoA-Δ235 | 14 |
| pSE193 | Apr pRS414 Φ(rhaS-lacZ)Δ90 | This study |
| pSE207 | Apr pQE30 His6-crp | This study |
| pSE213 | Apr pGEM-11Zf(+) rhaSR-rhaBAD | This study |
| pSE214 | Apr pGEM-11Zf(+)rhaSR-rhaBAD CRP site2− | This study |
| pSE215 | Apr pGEM-11Zf(+)rhaSR-rhaBAD CRP site3− | This study |
| pSE216 | Apr pRS414 Φ(rhaS-lacZ)Δ309 CRP site2− | This study |
| pSE217 | Apr pRS414 Φ(rhaS-lacZ)Δ309 CRP site3− | This study |
| pSE218 | Apr pRS414 Φ(rhaS-lacZ)Δ309 | This study |
Culture media.
Cultures for the β-galactosidase assay were grown using 1× MOPS buffered medium (20), which consisted of 40 mM 3-(N-morpholino)propanesulfonic acid (MOPS), 4 mM Tricine, 0.01 mM FeSO4, 9.5 mM NH4Cl, 0.276 mM K2SO4, 0.5 μM CaCl2, 0.528 mM MgCl2, 50 mM NaCl, 3 × 10−9 M Na2MO4, 4 × 10−7 M H3BO3, 3 × 10−8 M CoCl2, 10−8 M CuSO4, 8 × 10−8 M MnCl2, 10−8 M ZnSO4, 1.32 mM K2HPO4, 10 mM NaHCO3, 0.2% Casamino Acids, and 0.002% thiamine. 1× MOPS medium containing either 0.04% glycerol or 0.04% fructose was used to grow overnight cultures. Growth medium consisted of 1× MOPS medium containing either 0.4% glycerol or 0.4% fructose. As indicated, cultures contained 125 μg of ampicillin/ml, 0.2% l-rhamnose, and 2 mM cAMP. For other experiments (cloning, strain construction, etc.), cells were grown in tryptone-yeast (TY) medium (17) with or without antibiotic.
Plasmids, phages, and strains.
Strains used in this study are listed in Table 1. Δcrp-3 linked to zhc-511::Tn10 (29) or ΔrhaS linked to zih-35::Tn10 (9) was moved into strains by P1 generalized transduction (18) with selection for the linked Tn10 on 20-μg/ml tetracycline plates. Δ(rhaSR)::Km (9) was moved into strains, also using P1 generalized transduction, with selection on 75-μg/ml kanamycin plates. Δcrp, ΔrhaS, and ΔrhaSR deletions were confirmed by streaking onto MacConkey agar plates with 1% l-rhamnose.
Construction of rhaS-lacZ fusions.
Oligonucleotides used in this study are listed in Table 2. Promoter fragments for fusions were generated by PCR using pSE101 as a template, primer 896 as the downstream oligonucleotide for all fusions, and upstream primers 1170 and 2153 for Φ(rhaS-lacZ)Δ128 and Φ(rhaS-lacZ)Δ90, respectively. Promoter fragments were then cloned between the EcoRI and BamHI sites of pRS414 (31) to generate translational fusions with lacZ. The DNA sequences were confirmed on both strands by automated [Φ(rhaS-lacZ)Δ90] and manual [Φ(rhaS-lacZ)Δ128] DNA sequencing. Fusions were transferred to λRS45 (λimm21) by in vivo recombination (31) to generate recombinant λ phages. ECL116 cells were infected with the recombinant λ phages to generate strains carrying promoter fusions with lacZ. Lysogens were identified as blue colonies on plates containing 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) and l-rhamnose, and single lysogens were identified by the β-galactosidase assay and the Ter test (13).
TABLE 2.
Oligonucleotides used in this study
| Oligonucleotide no. | Sequence, 5′–3′a | Use |
|---|---|---|
| 726 | TCACCCGGGATCACGAGGTCAGGTTCTTAC | Φ(rhaB-lacZ)Δ226 construction; upstream |
| 744 | CGCGGATCCCCACTGGATGCGCCGAGATCG | Φ(rhaS-lacZ)Δ309 construction; upstream |
| 896 | CGCGGATCCTCTATCGCCACGGACGCGTT | Φ(rhaS-lacZ)Δ309 construction; downstream |
| 900 | CGCCAGGGTTTTCCCAGTCACGA | lacZ fusion screening; downstream |
| 1170 | CCGGAATTCTTGTGGTGATGTGATGCTCAC | Φ(rhaS-lacZ)Δ128 construction; upstream |
| 2079 | CGCCAGGGTTTTCCCAGTCACGAa | Universal sequencing oligonucleotide |
| 2104 | GATGGATCCGTGCTTGGCAAACCGCAAAC | His6-crp fusion construction; upstream |
| 2105 | ATAGGTACCATCAGTCTGCGCCACATCGG | His6-crp fusion construction; downstream |
| 2153 | CCGGAATTCTTCACGCTGTATCTTG | Φ(rhaS-lacZ)Δ90 construction |
| 2165 | CCGGAATTCTTGTGGTGATGTGATGCTCAC | Amplification of CRP site 2 for mobility shift assays |
| 2170 | AGCGTGAATTTAGTGGAAATGCGGTGAb | CRP site 2 mutagenesis |
| 2172 | GTGAGCATACGATCACCACAATTCb | CRP site 3 mutagenesis |
This primer was IRD41 dye labeled for use in a LI-COR automated sequencer.
Regions of oligonucleotides not complimentary to wild-type crp (for site-directed mutagenesis) are underlined.
To construct Φ(rhaS-lacZ)Δ309, wild-type rhaSR-rhaBAD intergenic DNA was PCR amplified using primers 896 and 744. The product was first cloned into the BamHI site of plasmid vector pGEM-11Zf(+) (Promega Corp., Madison, Wis.) to yield plasmid pGEMrha and then subcloned into the BamHI site of pRS414. Putative clones were screened on nutrient agar plates with ampicillin (125 μg/ml), X-Gal (40 μg/ml), and isopropyl-β-d-thiogalactopyranoside (0.27 mg/ml). A clone in the proper orientation was confirmed by successful PCR amplification using primers 896 and 900, resulting in pSE213. The DNA sequence of the entire rhaSR-rhaBAD promoter region in pGEMrha and pSE213 was confirmed on both strands by automated sequencing. Mutations to knock out putative CRP sites 2 and 3 were introduced into pGEMrha by site-directed mutagenesis using the Gene Editor in vitro site-directed mutagenesis system from Promega (Madison, Wis.). Oligonucleotide primers for site-directed mutagenesis were synthesized by Oligos Etc.) (Table 1). Primer 2170 introduced a 3-bp mutation in putative CRP site 2, and primer 2172 introduced a 3-bp mutation in putative CRP site 3. The resultant plasmids were named pSE214 and pSE215, and the DNA sequence of the rhaSR-rhaBAD region of both pSE214 and pSE215 was confirmed by automated sequencing. Subsequently, primers 896 and 744 were used for high-fidelity PCR amplification of the rhaSR-rhaBAD intergenic region using templates pSE214 and pSE215. The resulting PCR products were cloned into the BamHI site of pRS414 to generate Φ(rhaS-lacZ)Δ309 CRP site 2− and Φ(rhaS-lacZ)Δ309 CRP site 3−. Clones in the proper orientation were identified by PCR screening with oligonucleotides 900 and 744. The resultant plasmids were named pSE216 and pSE217. Subsequently, the DNA sequences of the entire rhaSR-rhaBAD regions through both fusion junctions in pSE216 and pSE217 were verified by automated sequencing on both strands.
β-Galactosidase assay.
Strains to be assayed were grown as described by Bhende and Egan (3). Briefly, this procedure involved inoculation of a limiting-carbon-source overnight culture from a fresh TY broth culture. The overnight culture was then used to inoculate a MOPS-buffered minimal growth medium, and these cultures were allowed to grow to an A600 of approximately 0.4. The carbon source used for overnight and growth medium was glycerol, with the exception that fructose plus cAMP was used in medium for assays involving crp deletion strains with no added crp on the plasmid. β-Galactosidase activity was determined as described by Miller (18), except that incubation with substrate o-nitrophenyl-β-d-thiogalactopyranoside was at room temperature. Specific activities were averaged from three independent assays, with two replicates in each assay.
CRP overexpression and purification.
The His6-CRP fusion was constructed using the QIAexpress kit from QIAGEN (Valencia, Calif.). Wild-type crp was PCR amplified using primers 2104 and 2105, and the product was inserted between the KpnI and BamHI sites of pQE30 to create pSE207. Ligation reactions were transformed into SME1461 [a Δcrp strain background carrying Φ(rhaB-lacZ)Δ110], and putative pSE207 clones were identified by their blue colony color on nutrient agar plates with ampicillin (125 μg/ml), X-Gal (40 μg/ml), and l-rhamnose (0.2%). After the DNA sequence of the crp gene and fusion junctions on the His6-CRP fusion were verified on both strands, pSE207 was cotransformed with plasmid pREP4 (constitutively expressing lacIq) into competent SME1461 to generate strain SME1834. Selection for transformants was on enriched minimal glucose plates containing ampicillin (100 μg/ml) and kanamycin (25 μg/ml).
Five milliliters of TY broth (17) containing ampicillin (100 μg/ml) and kanamycin (25 μg/ml) was inoculated with a single colony of SME1834. Cultures were incubated at 37°C for approximately 16 h in a rotator. A 300-ml baffled flask containing 100 ml of TY with ampicillin (100 μg/ml) and kanamycin (25 μg/ml) was inoculated with 5 ml of overnight culture and incubated in a 37°C water bath with vigorous shaking for 30 min. A 100-μl aliquot of 0.1 M isopropyl-β-d-thiogalactopyranoside was then added, and the culture was grown for 4 additional hours at 37°C with vigorous shaking. The culture was split between two 50-ml tubes and centrifuged for 15 min at approximately 4,000 × g at 4°C. After storage overnight at −70°C, each pellet was resuspended in 750 μl of lysis buffer (50 mM NaH2PO4 [pH 8.0], 300 mM NaCl, 10 mM imidazole, 100 μM cAMP) and transferred to a microcentrifuge tube. Lysozyme (1 mg/ml) was added, and after a 30-min incubation on ice, the cells were sonicated on ice. After centrifugation at 4,000 × g for 20 min at 4°C, the supernatant was transferred to a fresh microcentrifuge tube, and 250 μl of nickel nitrilotriacetic acid agarose suspension (Qiagen) was added. Subsequently, the Qiagen QIAexpress protocol for batch purification under nondenaturing conditions was used to purify His6-CRP. The final purified protein was approximately 90% CRP.
Electrophoretic gel mobility shift assay.
Oligonucleotide primers were 5′ endlabeled with T4 polynucleotide kinase (New England Biolabs, Beverly, Mass.) using [γ-32P]ATP. Linear DNA fragments for gel mobility shift assays were generated using PCR amplification with one labeled and one unlabeled primer, using plasmid pSE101 as a template. PCR products were purified using the Qiagen PCR purification kit. Binding reactions were done in a total volume of 20 μl. 1× MSA buffer used for binding reactions contained 10 mM Tris-HCl (pH 7.4), 1 mM KEDTA, 50 mM KCl, 1 mM dithiothreitol, 5% (vol/vol) glycerol, 0.05% (vol/vol) Nonidet P-40, 100 μM cAMP, and 500 ng of salmon sperm DNA. Each binding reaction was incubated for 5 min at 37°C before CRP was added. After protein was added, reaction mixtures were further incubated for 10 min at 37°C before being loaded into the gel. DNA loading dye was added only to the free DNA lane. Free DNA was separated from protein-bound DNA by electrophoresis at approximately 8°C in a 6% polyacrylamide gel that had been prerun at ∼150 V for 60 min in MSA electrophoresis buffer (10 mM Tris-acetate, pH 7.4, and 1 mM KEDTA, pH 7.0). Bands were subsequently detected using Bio-Rad PhosphorImager FX (Hercules, Calif.).
RESULTS
CRP both directly and indirectly activates rhaBAD.
During the course of our studies on CRP activation of the rhaBAD operon, we compared expression from various rhaBAD promoter fusions (Fig. 1) in crp+ and Δcrp strain backgrounds. Similar to previous results (9), deletion of the CRP-binding site from the rhaBAD promoter resulted in an approximately 45-fold defect (Table 3). However, deletion of the crp gene resulted in an approximately 4,000-fold defect at each of the fusions that included the CRP-binding site [Φ(rhaB-lacZ)Δ226 and Φ(rhaB-lacZ)Δ110]. Further, at Φ(rhaB-lacZ)Δ84, which has a RhaS-binding site but lacks a CRP-binding site, we observed a 50-fold defect upon deletion of crp. This defect at Φ(rhaB-lacZ)Δ84 was eliminated by expression of rhaS from a heterologous promoter (unpublished results), suggesting that the defect was due to decreased expression of rhaS in the crp deletion strain. Thus, we hypothesized that CRP might be a direct activator of rhaSR expression.
FIG. 1.
rhaSR-rhaBAD intergenic region. (A) Schematic representation of the rhaSR-rhaBAD intergenic region. The relative positions of the two RNA polymerases and the activator proteins RhaS, CRP, and RhaR are shown, as are the locations of the three putative CRP binding sites identified in this work. The activators and sites shown above the line all are located on one face of the DNA, and the activators and sites shown below the line are located on the opposite face. (B) The DNA sequence between the rhaBAD and rhaSR transcription start sites. The positions of the RhaS and RhaR binding sites are shown by everted arrows, and the positions of the CRP binding sites are shown as inverted arrows. The −10 and −35 hexamers of the two promoters are marked. Deletion endpoints (marked Δ), binding sites, and distances relative to the rhaBAD promoter are shown above the line, and deletion endpoints, binding sites, and distances relative to the rhaSR promoter are shown below the line. (C) Comparison of the putative CRP binding sites within the rhaSR-rhaBAD intergenic region and the CRP consensus binding site sequence. Nucleotides highlighted in gray match the consensus sequence.
TABLE 3.
Effects of CRP deletion at rhaBAD
| Promoter fusion | β-Galactosidase sp acta
|
|
|---|---|---|
| crp+ | Δcrp | |
| Φ(rhaB-lacZ)Δ226 | 414 | 0.13 |
| Φ(rhaB-lacZ)Δ110 | 408 | 0.09 |
| Φ(rhaB-lacZ)Δ84 | 9.1 | 0.18 |
β-Galactosidase specific activity was measured from single-copy rhaB-lacZ fusions in a wild-type crp or crp deletion strain. Cultures were grown in MOPS media containing fructose, l-rhamnose, and 2 mM cAMP. Standard errors were less than 17% of the average units except for that for Φ(rhaB-lacZ)Δ110 Δcrp, which was 35%, and that for Φ(rhaB-lacZ)Δ226Δcrp, which was 43%.
Possible CRP site(s) at rhaSR.
To explore whether CRP is a direct activator of rhaSR expression, we first inspected the rhaSR promoter DNA sequence. The previously identified CRP site centered at −92.5 relative to the rhaBAD transcription start site (9) matches the CRP-binding-site consensus sequence (2) at 9 of 10 positions and appears to be the strongest CRP site in the rhaSR-rhaBAD intergenic region. We now refer to this as the CRP site 1 (Fig. 1). The next-best matches to the CRP consensus sequence are two overlapping sequences with eight and seven consensus base pairs centered at −111.5 and −116.5 relative to the rhaSR transcription start site, respectively (Fig. 1). The site at −111.5 is expected to lie on the same face of the DNA as the rhaSR promoter, and the site at −116.5 is expected to lie on the opposite face of the DNA, which is the same face as the rhaBAD promoter. A variety of weaker matches to the CRP consensus site can also be found in the rhaBAD-rhaSR intergenic region. Noteworthy due to its position relative to the rhaSR transcription start site is a site with 5 of 10 bp matches centered at −92.5. This site is located immediately upstream of the RhaR-binding site and in the same relative position as the functional CRP site at rhaBAD. We have named the putative site at −92.5 CRP site 2, the putative site at −111.5 CRP site 3, and the putative site at −116.5 CRP site 4 (Fig. 1). We hypothesize that CRP binding to some or all of these sites may influence transcription activation at rhaSR.
Evidence for functional CRP sites at rhaSR.
As an initial step toward determining whether any of the putative CRP-binding sites had a direct effect on rhaSR expression, we performed in vivo β-galactosidase assays at rhaS-lacZ fusions with different lengths of upstream DNA (Tables 4 and 5). Expression from Φ(rhaS-lacZ)Δ216 and that from Φ(rhaS-lacZ)Δ128 were very similar, indicating that the DNA region between −216 and −128 (which contains CRP site 1) is not required for full rhaSR activation. In contrast, the fusion with a truncation of all of the putative CRP sites [Φ(rhaS-lacZ)Δ90] had ∼100-fold-lower induced expression. These results suggest that the DNA region between −90 and −128 is important for activation at rhaSR and that putative CRP sites 2, 3, and/or 4 may be functional CRP sites. Deletion of crp (Table 5) resulted in a level of expression from each fusion that was similar to the expression from Φ(rhaS-lacZ)Δ90 in the crp+ strain background, supporting our hypothesis that full rhaSR activation requires CRP.
TABLE 4.
l-rhamnose induction of rhaS-lacZ fusions
| Promoter fusion | β-Galactosidase sp acta
|
|
|---|---|---|
| + rhamnose | − rhamnose | |
| Φ(rhaS-lacZ)Δ216 | 131 | 0.42 |
| Φ(rhaS-lacZ)Δ128 | 185 | 0.41 |
| Φ(rhaS-lacZ)Δ90 | 1.7 | 0.13 |
β-Galactosidase specific activity was measured from single-copy rhaS-lacZ fusions in the presence or absence of added l-rhamnose. Cultures were grown in MOPS media containing glycerol. Standard errors were less than 21% of the average units.
TABLE 5.
Effects of CRP deletion at rhaSR
| Promoter fusion | β-Galactosidase sp acta
|
|
|---|---|---|
| crp+ | Δcrp | |
| Φ(rhaS-lacZ)Δ216 | 90 | 0.9 |
| Φ(rhaS-lacZ)Δ128 | 136 | 1.7 |
| Φ(rhaS-lacZ)Δ90 | 1.2 | 1.0 |
β-Galactosidase specific activity was measured from single-copy rhaS-lacZ fusions in a wild-type crp or crp deletion strain. Cultures were grown in MOPS media containing fructose, l-rhamnose, and 2 mM cAMP. Standard errors were less than 24% of the average units.
We constructed a longer rhaS-lacZ fusion that included the entire rhaSR-rhaBAD intergenic region [Φ(rhaS-lacZ)Δ309] and used site-directed mutagenesis to change three consensus base pairs in each CRP site 2 and CRP site 3 to nonconsensus base pairs. We assayed the plasmid-borne lacZ fusions carrying these mutations to determine whether either of these two CRP sites was required for rhaSR activation. For the wild-type promoter fusion, the β-galactosidase specific activity was 272 ± 10. For the promoter fusion with mutant CRP site 2−, the β-galactosidase specific activity was 240 ± 14. And for the promoter fusion with mutant CRP site 3−, the β-galactosidase specific activity was 24 ± 3. Cultures were grown in MOPS growth media containing glycerol, l-rhamnose, and ampicillin. While mutations in site 2 had little to no effect on rhaS-lacZ expression, the mutations in CRP site 3 resulted in an approximately 10-fold defect in rhaS-lacZ expression. This suggests that CRP site 3 is responsible for at least part of the CRP activation of rhaSR expression.
In vitro binding of CRP to sites at rhaSR.
We constructed a fusion of His6 to CRP and purified the protein using nickel affinity chromatography. We then used mobility shift assays to determine whether CRP protein could bind to any of the putative CRP-binding sites upstream of rhaSR (Fig. 2). Similar to previous results (9), our purified His6-CRP protein shifted a DNA fragment containing CRP site 1. His6-CRP also shifted a DNA fragment that contained CRP sites 2, 3, and 4 but did not significantly shift a fragment that contained only CRP site 2. We have also tested CRP binding to DNA fragments that contained a 3-bp mutation in site 3, as described above, or a similar 3-bp mutation in CRP site 4. Although CRP was able to shift the DNA fragments with sites 3+4+ and 3+4−, no shift was detected with a site 3−4+ DNA fragment (unpublished data). Taken together, our results suggest that CRP site 3 is the major site required for CRP activation of rhaSR expression.
FIG. 2.
DNA mobility shift assays of CRP binding to sites 1, 2, 3, and 4. The fragment containing CRP site 1+ was PCR amplified using primers 742 and 744. The upstream primer 896 was used to generate fragments with sites 2+3+4+ and site 2+, with primers 1170 and 2165 used as downstream primers, respectively. Primers 742 and 896 were 32P labeled. The major band in the second lane in each set is at the position of the wells. Approximately 1 ng of 32P-labeled DNA fragment was added to each reaction mixture. The approximate CRP concentrations per reaction were the following: for the first lane in each set, F, none; for the second lane in each set, 8.4 μM CRP; for the third lane in each set, 2.1 μM CRP; and for the fourth lane in each set, 0.21 μM CRP.
AR1 and AR2 mutant CRP with changes at rhaSR.
Since we now had evidence that CRP was a direct activator of rhaSR expression, we wished to determine whether AR1 and/or AR2 of CRP were necessary for this activation. We chose alanine substitutions in AR1 and AR2 which had relatively large activation defects at class I and II promoters (21, 22, 38) and assayed their activation at both the Φ(rhaS-lacZ)Δ216 and the Φ(rhaS-lacZ)Δ128 fusions (Table 6). Surprisingly, the results at the two fusions were very different. None of the AR1 nor AR2 mutants were significantly defective for activation at Φ(rhaS-lacZ)Δ216 (Table 6), suggesting that the surface residues on CRP that are most important for activation at simple CRP-dependent promoters may not have a significant role in this context. However, at the shorter Φ(rhaS-lacZ)Δ128 fusion, one AR1 mutant (G162A) and two AR2 mutants (H19A and H21A) had small defects compared with wild-type CRP, raising the possibility that a CRP–α-CTD interaction may occur in this context. Interestingly, these same three CRP mutants had similar small activation defects at the divergent rhaBAD promoter (14). The differences in the effect of AR1 mutations at Φ(rhaS-lacZ)Δ216 versus Φ(rhaS-lacZ)Δ128 could indicate that AR1 has no role at Φ(rhaS-lacZ)Δ216 or, as discussed below, that redundancies in the activation at this promoter mask the effects of AR1.
TABLE 6.
Effects of alanine substitutions in CRP AR1 and AR2 at rhaS-lacZ fusions
| CRP derivative | Φ(rhaS-lacZ)Δ216
|
Φ(rhaS-lacZ)Δ128
|
||
|---|---|---|---|---|
| β-Gal sp acta | % Wt sp act | β-Gal sp acta | % Wt sp act | |
| Wt | 200 | 100 | 676 | 100 |
| T158A | 325 | 163 | 557 | 82 |
| G162A | 181 | 90 | 290 | 43 |
| H19A | 244 | 122 | 437 | 65 |
| H21A | 178 | 89 | 221 | 33 |
| K101A | 215 | 108 | 579 | 86 |
β-Galactosidase (β-Gal) specific activity was measured from a single-copy rhaS-lacZ fusion in a crp deletion strain transformed with plasmids encoding either a wild-type or mutant form of CRP. Cultures were grown in MOPS media containing glycerol, l-rhamnose, and ampicillin. Standard errors were less than 18% of the average units. Wt, wild type.
RNAP α-CTD truncation mutation at rhaSR.
To more directly test for a role of α-CTD in rhaSR activation, we assayed the effect of expressing a derivative of α with the entire C-terminal domain deleted, α-Δ235 (14), on expression from several rhaSR promoter fusions. We first tested expression of α-Δ235 at Φ(rhaS-lacZ)Δ90 in a Δ(rhaSR) strain background, which we propose to be a measure of the basal promoter expression (Table 7). In this strain, expression of α-Δ235 had no effect, which was somewhat surprising, since there are four phased A tracts immediately upstream of the rhaSR core promoter (see Fig. 1). In contrast, there was a 13-fold defect at Φ(rhaS-lacZ)Δ90 upon expression of α-Δ235 in a (rhaSR)+ background (Table 7). This result indicates that in the presence of RhaR, α-CTD can contribute to transcription activation at rhaSR, perhaps by interaction with DNA and/or RhaR. The defect upon expression of α-Δ235 fell to approximately two- to threefold at both Φ(rhaS-lacZ)Δ216 and Φ(rhaS-lacZ)Δ128. The smaller defect at the promoters that included CRP-binding sites was not expected based on the original hypothesis that α-CTD would activate transcription by interacting with CRP.
TABLE 7.
Effect of overexpressing α-Δ235 at rhaSR
| Promoter fusion | β-Galactosidase sp acta
|
|||
|---|---|---|---|---|
|
rhaSR+
|
ΔrhaSR
|
|||
| Wt α-CTD | α-Δ235 | Wt α-CTD | α-Δ235 | |
| Φ(rhaS-lacZ)Δ216 | 89 | 47 | 0.75 | 0.29 |
| Φ(rhaS-lacZ)Δ128 | 109 | 38 | 6.1 | 0.46 |
| Φ(rhaS-lacZ)Δ90 | 1.3 | 0.1 | 0.018 | 0.023 |
β-Galactosidase specific activity was measured from single-copy rhaS-lacZ fusions in either wild-type rhaSR or rhaSR deletion strain backgrounds transformed with plasmids encoding either wild-type α-CTD or α-Δ235. Cultures were grown in MOPS media containing glycerol, l-rhamnose, and ampicillin. Standard errors were less than 33% of the average units. Wt, wild type.
RNAP α-CTD alanine substitution library.
To identify specific residues in α-CTD that are involved in rhaSR activation, we assayed an α-CTD plasmid library with independent alanine substitutions at each residue in α-CTD (10, 30) at the Φ(rhaS-lacZ)Δ216 promoter fusion (Fig. 3). We found that substitutions at 19 residues exhibited significant defects, ranging from 20 to 80% of wild-type α-CTD activation (Fig. 4). Twelve of the defective residues lie in (R265, N268, C269, G296, K298, S299, E302) or very near (T263, K291, K297, L300, D305) the DNA-binding determinant for α-CTD (10, 33) (reviewed in reference 6). It has been shown that the DNA contacts made by α-CTD can vary depending on contacts with an activator or UP element (an A+T-rich DNA sequence recognized by α-CTD), so it is not surprising that we identified a few additional DNA-binding residues (24).
FIG. 3.
Effects of α-CTD alanine substitution mutants on rhaSR activation. Expression was measured from Φ(rhaS-lacZ)Δ216 (SME1074) cells carrying wild-type (w.t.) rpoA on a plasmid or a plasmid encoding α with a single alanine substitution at each position in α-CTD. Cells were grown in MOPS growth media containing glycerol, l-rhamnose, and 125 μg of ampicillin/ml. Values are the average of at least three independent assays and are shown as a percentage of the average expression from cells carrying wild-type rpoA on a plasmid. Analysis of variance was used to determine which alanine substitution mutants had significantly lower levels of expression compared to the wild type, which are indicated by an asterisk above the bar. β-Gal Act., β-galactosidase activity.
FIG. 4.
Space-filling model of the predicted α-CTD structure, with residues that were defective at rhaSR highlighted. The model is based on the atomic coordinates of Jeon et al. (15). Colored residues are those identified as important at the Φ(rhaS-lacZ)Δ216 promoter fusion. Pink residues are those that may be involved in interaction with DNA, and green residues are those that have some other role, possibly protein-protein interactions. Residue numbers for some of the important residues are shown. The two models are related to one another by a 90° rotation on the vertical axis.
Six of the remaining seven residues that were defective at Φ(rhaS-lacZ)Δ216 (G279, V282, Q283, R284, N320, P322) lie near but not coincident with the α-CTD 287 determinant that has been shown to interact with CRP (21, 27, 30) (reviewed in reference 6). Of these, residues G279 and V282 are quite buried in the α-CTD structure. In contrast, residues Q283 and R284 are located adjacent to one another and are very surface exposed, and residues N320 and P322 are also adjacent to one another and very surface exposed, making these residues candidates for protein-protein interactions. Two of these six residues (G279 and P322) were also found to be defective at the truncated rhaBAD promoter that included only the RhaS binding site (14).
The seventh residue that was defective at rhaSR was R255. Interestingly, R255 and three other residues that were hyperactive at rhaSR, D258, D259, and K271, form an elongated patch on the surface of α-CTD. The hyperactivity of D258, D259, and K271 may suggest a surface of α-CTD that is in very close proximity to another protein, while the defect with R255 may suggest a site of interaction. Perhaps in support of this region of α-CTD defining a protein-protein interaction, this patch includes two of the four residues of the 261 determinant of α-CTD (V257, D258, D259, E261) (reviewed in reference 6).
DISCUSSION
CRP activates rhaSR from at least one newly identified binding site.
We hypothesized that CRP might be a direct activator of rhaSR expression. Although there are many moderate to weak matches to the consensus CRP-binding site sequence in the rhaSR-rhaBAD intergenic region, three of these, sites 2 through 4, seemed most likely to directly influence rhaSR activation. While the position of CRP site 2 at rhaSR (−92.5) was identical to that of the CRP site at rhaBAD, our results provide no evidence that site 2 has a role in CRP activation of rhaSR. CRP site 3 is located on the same face of the DNA as the rhaSR promoter and is the strongest match to the CRP consensus (other than site 1). Both mobility shift assay and mutagenesis results suggest that site 3 has a direct role in CRP activation of rhaSR; thus we conclude that CRP bound at site 3 is required for full rhaSR activation. It is unlikely that CRP binding to site 4 contributes directly to an increase in rhaSR expression, since transcription activation by CRP requires that its binding site be on the same face of the DNA as the promoter (6). In addition, mobility shift assay results suggest that binding to site 4 is very weak compared with binding to site 3. It is possible, however, that CRP binding to site 4 or to other sites within the rhaSR-rhaBAD intergenic region may have subtle effects on rhaSR regulation.
Interdependence of activation by CRP, α-CTD, and RhaR.
We can think of α-CTD along with CRP and RhaR as a third activator of the rhaSR promoter. To determine whether the function of each of these activators was independent of or dependent on the others, we converted the results in Table 7 into fold activation values (Table 8). We define fold activation as the lacZ expression in the presence of one activator (for example, RhaR in Table 8) divided by the lacZ expression in the absence of that activator. This value was calculated for each combination of the other two activators. The synergistic effect was calculated by dividing the fold activation by a given activator in the presence of one or both of the other activators by the value for the given activator when alone. This value is a measure of whether any of the activators can improve the activation by the other activators. The concept of synergism has been recently discussed by Langdon and Hochschild (16). A synergistic effect of 1 indicates independence of the activators involved, while a value greater than 1 indicates synergism. To determine fold activation by CRP, we compared expression from Φ(rhaS-lacZ)Δ90 to that from fusions that included the CRP-binding sites. Since we assayed two different fusions that included CRP-binding sites [Φ(rhaS-lacZ)Δ128 and Φ(rhaS-lacZ)Δ216], and the results with these fusions were not identical, we performed the fold activation analysis separately for each.
TABLE 8.
Synergistic effects of CRP, α-CTD, and RhaR at rhaSR
| Activator and combinations | No. of activators | Results at promoter fusion:
|
|||
|---|---|---|---|---|---|
| Φ(rhaS-lacZ)Δ128
|
Φ(rhaS-lacZ)Δ216
|
||||
| Fold activationa | Synergistic effectb | Fold activationa | Synergistic effectb | ||
| RhaR | |||||
| −CRP − α-CTD | 1 | 4.3 | 4.3 | ||
| +CRP − α-CTD | 2 | 83 | 19 | 162 | 37 |
| −CRP + α-CTD | 2 | 72 | 17 | 72 | 17 |
| +CRP + α-CTD | 3 | 18 | 4.2 | 118 | 27 |
| α-CTD | |||||
| −CRP − RhaR | 1 | 0.78 | 0.78 | ||
| +CRP − RhaR | 2 | 13 | 17 | 2.6 | 3.3 |
| −CRP + RhaR | 2 | 13 | 17 | 13 | 17 |
| +CRP + RhaR | 3 | 2.9 | 3.7 | 1.9 | 2.4 |
| CRP | |||||
| − α-CTD − RhaR | 1 | 20 | 13 | ||
| + α-CTD − RhaR | 2 | 340 | 17 | 41 | 3.2 |
| − α-CTD + RhaR | 2 | 380 | 19 | 470 | 36 |
| + α-CTD + RhaR | 3 | 84 | 4.2 | 68 | 5.2 |
For each set, the fold activation by the activator on the first line of the set is defined as the fold increase in expression in the presence of that activator versus the absence of that activator. This fold activation was calculated for each combination of the other two activators.
Synergistic effect represents the fold activation by a given activator in the presence of one or both other activators divided by the fold activation by that activator when alone.
Each of the activators, RhaR, α-CTD, and CRP, had a synergistic effect on each of the other activators. In most cases, the magnitude of this synergistic effect was greatest when a total of two but not all three activators were present and ranged from 2.4- to 37-fold. Interestingly, at Φ(rhaS-lacZ)Δ128 the synergistic effects for all combinations of two activators were of nearly equivalent magnitudes, 17- to 19-fold. The finding of synergistic effects between all pairs of activators suggests the possibility of direct RhaR-CRP, RhaR–α-CTD, and CRP–α-CTD interactions, although other mechanisms could also account for the synergism.
In all cases, three activators together resulted in a synergistic effect that was smaller than the effect of two activators for one, if not both, of the combinations of two activators. The first possible explanation for this decreased synergism in the presence of a third activator is that the third activator has a true negative effect on the synergism between the first two activators. In this case the third activator could partially block an interaction between the other two or might have a less direct effect, such as altering the DNA bending to result in decreased synergism between the other two. The second possible explanation is that the apparent negative effect of the third activator is actually an indication of redundancy in rhaSR regulation. If, for example, activators A and B are each able to overcome the same rate-limiting step in transcription initiation, then the apparent activation by A would be reduced in the presence of B due to B having already performed this portion of A's potential function.
Although the overall level of expression from Φ(rhaS-lacZ)Δ216 was very similar to that from Φ(rhaS-lacZ)Δ128, the synergistic effects of the activators at this fusion were quite different. Relative to Φ(rhaS-lacZ)Δ128, the synergism between RhaR and CRP increased at Φ(rhaS-lacZ)Δ216 (to 36- or 37-fold), and the synergism between CRP and α-CTD decreased (to 3.2- or 3.3-fold). This suggests that CRP binding at site 3 may be destabilized at Φ(rhaS-lacZ)Δ216, and this destabilization may result in CRP activation from site 3 becoming more dependent upon RhaR. The ability of the promoter to attain nearly the same level of expression with such different magnitudes of synergism could again be explained by inherent redundancies among these activators. If the full potential synergism between CRP and RhaR were not realized at Φ(rhaS-lacZ)Δ128 due to redundancies, then at Φ(rhaS-lacZ)Δ216, where the CRP–α-CTD synergism is apparently weakened, more of the synergism between CRP and RhaR could be unmasked.
This analysis of our results suggests that both CRP and RhaR have a component to their activation that is unique to that activator and that can directly influence RNAP. This would represent the 4-fold activation by RhaR, and the 20-fold and 13-fold activation by CRP, in the absence of other activators. In the absence of both CRP and RhaR, α-CTD did not contribute any activation. Each of the activators, including α-CTD, could also enhance the activation by each other activator (the synergistic effects), leading to a further increase in rhaSR expression.
Mechanism of activation by CRP at rhaSR.
Clearly there is a component (13- to 20-fold) to the activation by CRP at rhaSR that is independent of both α-CTD and RhaR and hence does not function by the same mechanism used at simple class I CRP-dependent promoters, nor does it function through cooperative binding with RhaR. This is similar to the finding at several other class III CRP-dependent promoters that interactions with α-CTD and cooperative binding do not account for activation by CRP (23, 25, 26, 28). This component of CRP activation at rhaSR could account for the majority of the CRP activation in a wild-type context and may involve a mechanism, such as DNA bending, that can act from a distance. Alternatively, the five phased A tracts between CRP site 3 and the rhaSR −35 hexamer (Fig. 1) could provide sufficient bending for CRP at −111.5 to directly interact with RNAP. A recent model of the DNA path in an RNAP open complex (19) proposes that the DNA just upstream of the −35 hexamer may bend sharply around RNAP. Additional A-tract- and protein-induced DNA bending could potentially bring fairly distant DNA sequences into close association with RNAP.
There is also a second component to CRP activation of rhaSR that appears to function through synergism with RhaR and α-CTD. This second mechanism could involve direct interactions with RhaR and/or α-CTD. We have no evidence at this time to argue either for or against a direct interaction between CRP and RhaR; however, we do have some evidence to suggest that a direct α-CTD–CRP interaction could contribute to rhaSR activation. First, the CRP G162A substitution in AR1 resulted in 43% activation at Φ(rhaS-lacZ)Δ128 and 90% activation at Φ(rhaS-lacZ)Δ216. The decreased effect of this substitution at Φ(rhaS-lacZ)Δ216 is consistent with the reduced synergism between CRP and α-CTD at this promoter. Second, the alanine scanning analysis of α-CTD identified five residues, 255, 283, 284, 320, and 322, that are possible candidates for protein-protein interactions. Four of these residues (283, 284, 320, and 322) are very near the 287 determinant of α-CTD (reviewed in reference 6) and therefore might define an interaction with CRP. If an interaction between CRP and α-CTD does occur at rhaSR, it appears to make a relatively small contribution to activation in the wild-type context.
Role of α-CTD in rhaSR activation.
Maximal levels of rhaSR expression clearly require α-CTD. In addition to the possible interaction between α-CTD and CRP, the alanine scan results indicate that DNA contacts by α-CTD are important for its activation. Further, the synergism between α-CTD and RhaR suggests the possibility that these two proteins could directly interact. Our alanine scanning analysis of α-CTD identified three residues (255, 320, and 322) that might be candidates for an interaction with RhaR. Residue 255 may define an alternative 261 determinant and therefore a site of α-CTD–protein interaction. Since there is no evidence for an interaction between the 261 determinant and CRP, we propose that residue 255 might interact with RhaR. Alternatively, α-CTD residues 321, 322, and 323 were defective at a rhaBAD promoter fusion that was activated only by the RhaS protein. Given the sequence similarity between RhaS and RhaR, residues 320 and 322 might define a protein interaction with RhaR. Residues within this region of α-CTD have been implicated in interactions with MerR (residues 311 and 323) (7) and OmpR (residues 322 and 323) (32), suggesting that this may be a common region for α-CTD contacts with activators.
ACKNOWLEDGMENTS
We thank Richard Gourse for the generous gift of the α-CTD alanine substitution library, Prasanna Bhende for critical discussions and for comments on the manuscript, Jason Jeffers and Vydehi Rao for assistance with β-galactosidase assays and strain constructions, and the University of Kansas Biochemical Research Service Laboratory for help with automated DNA sequencing.
This work was supported by Public Health Service grant GM55099 from the National Institute of General Medical Sciences, the National Science Foundation under grant no. EPS-9550487 with matching support from the state of Kansas, a General Research Fund award from the University of Kansas, and the Franklin Murphy Molecular Biology Endowment, all to S.M.E.
REFERENCES
- 1.Backman K, Chen Y-M, Magasanik B. Physical and genetic characterization of the glnA-glnG region of the Escherichia coli chromosome. Proc Natl Acad Sci USA. 1981;78:3743–3747. doi: 10.1073/pnas.78.6.3743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Berg O G, von Hippel P H. Selection of DNA binding sites by regulatory proteins. II. The binding specificity of cyclic AMP receptor protein to recognition sites. J Mol Biol. 1988;200:709–723. doi: 10.1016/0022-2836(88)90482-2. [DOI] [PubMed] [Google Scholar]
- 3.Bhende P M, Egan S M. Amino acid-DNA contacts by RhaS: an AraC family transcription activator. J Bacteriol. 1999;181:5185–5192. doi: 10.1128/jb.181.17.5185-5192.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Blatter E E, Ross W, Tang H, Gourse R L, Ebright R H. Domain organization of RNA polymerase α subunit: C-terminal 85 amino acids constitute a domain capable of dimerization and DNA binding. Cell. 1994;78:889–896. doi: 10.1016/s0092-8674(94)90682-3. [DOI] [PubMed] [Google Scholar]
- 5.Busby S, Ebright R H. Transcription activation at class II CAP-dependent promoters. Mol Microbiol. 1997;23:853–859. doi: 10.1046/j.1365-2958.1997.2771641.x. [DOI] [PubMed] [Google Scholar]
- 6.Busby S, Ebright R H. Transcription activation by catabolite activator protein (CAP) J Mol Biol. 1999;293:199–213. doi: 10.1006/jmbi.1999.3161. [DOI] [PubMed] [Google Scholar]
- 7.Caslake L F, Ashraf S I, Summers A O. Mutations in the alpha and sigma-70 subunits of RNA polymerase affect expression of the mer operon. J Bacteriol. 1997;179:1787–1795. doi: 10.1128/jb.179.5.1787-1795.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ebright R H. Transcription activation at Class I CAP-dependent promoters. Mol Microbiol. 1993;8:797–802. doi: 10.1111/j.1365-2958.1993.tb01626.x. [DOI] [PubMed] [Google Scholar]
- 9.Egan S M, Schleif R F. A regulatory cascade in the induction of rhaBAD. J Mol Biol. 1993;234:87–98. doi: 10.1006/jmbi.1993.1565. [DOI] [PubMed] [Google Scholar]
- 10.Gaal T, Ross W, Blatter E E, Tang H, Jia X, Krishnan V V, Assa-Munt N, Ebright R H, Gourse R L. DNA-binding determinants of the α subunit of RNA polymerase: novel DNA-binding domain architecture. Genes Dev. 1996;10:16–26. doi: 10.1101/gad.10.1.16. [DOI] [PubMed] [Google Scholar]
- 11.Gallegos M-T, Schleif R, Bairoch A, Hofmann K, Ramos J L. AraC/XylS family of transcriptional regulators. Microbiol Mol Biol Rev. 1997;61:393–410. doi: 10.1128/mmbr.61.4.393-410.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gavigan S A, Nguyen T, Nguyen N, Senear D F. Role of multiple CytR binding sites on cooperativity, competition, and induction at the Escherichia coli udp promoter. J Biol Chem. 1999;274:16010–16019. doi: 10.1074/jbc.274.23.16010. [DOI] [PubMed] [Google Scholar]
- 13.Gottesman M E, Yarmolinsky M B. The integration and excision of the bacteriophage lambda genome. Cold Spring Harbor Symp Quant Biol. 1968;33:735–747. doi: 10.1101/sqb.1968.033.01.084. [DOI] [PubMed] [Google Scholar]
- 14.Holcroft C C, Egan S M. Roles of cyclic AMP receptor protein and the carboxyl-terminal domain of the α subunit in transcription activation of the Escherichia coli rhaBAD operon. J Bacteriol. 2000;182:3529–3535. doi: 10.1128/jb.182.12.3529-3535.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Jeon Y H, Negishi T, Shirakawa M, Yamazaki T, Fujita N, Ishihama A, Kyogoku Y. Solution structure of the activator contact domain of the RNA polymerase α subunit. Science. 1995;270:1495–1497. doi: 10.1126/science.270.5241.1495. [DOI] [PubMed] [Google Scholar]
- 16.Langdon R C, Hochschild A. A genetic method for dissecting the mechanism of transcriptional activator synergy by identical activators. Proc Natl Acad Sci USA. 1999;96:12673–12678. doi: 10.1073/pnas.96.22.12673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Maloy S R, Stewart V J, Taylor R K. Genetic analysis of pathogenic bacteria. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1996. [Google Scholar]
- 18.Miller J H. Experiments in molecular genetics. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1972. [Google Scholar]
- 19.Naryshkin N, Revyakin A, Kim Y, Mekler V, Ebright R H. Structural organization of the RNA polymerase-promoter open complex. Cell. 2000;101:601–611. doi: 10.1016/s0092-8674(00)80872-7. [DOI] [PubMed] [Google Scholar]
- 20.Neidhardt F C, Bloch P L, Smith D F. Culture medium for enterobacteria. J Bacteriol. 1974;119:736–747. doi: 10.1128/jb.119.3.736-747.1974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Niu W, Kim Y, Tau G, Heyduk T, Ebright R H. Transcription activation at class II CAP-dependent promoters: two interactions between CAP and RNA polymerase. Cell. 1996;87:1123–1134. doi: 10.1016/s0092-8674(00)81806-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Niu W, Zhou Y, Dong Q, Ebright Y W, Ebright R H. Characterization of the activation region of Escherichia coli catabolite gene activator protein (CAP) I. Saturation and alanine-scanning mutagenesis. J Mol Biol. 1994;243:595–602. doi: 10.1016/0022-2836(94)90034-5. [DOI] [PubMed] [Google Scholar]
- 23.Olekhnovich I N, Dahl J L, Kadner R J. Separate contributions of UhpA and CAP to activation of transcription of the uhpT promoter of Escherichia coli. J Mol Biol. 1999;292:973–986. doi: 10.1006/jmbi.1999.3127. [DOI] [PubMed] [Google Scholar]
- 24.Ozoline O N, Fujita N, Ishihama A. Transcription activation mediated by the carboxyl-terminal domain of the RNA polymerase α-subunit. J Biol Chem. 2000;275:1119–1127. doi: 10.1074/jbc.275.2.1119. [DOI] [PubMed] [Google Scholar]
- 25.Plumbridge J. Induction of the nag regulon of Escherichia coli by N-acetylglucosamine and glucosamine: role of the cyclic AMP-catabolite activator protein complex in expression of the regulon. J Bacteriol. 1990;172:2728–2735. doi: 10.1128/jb.172.5.2728-2735.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Plumbridge J, Kolb A. DNA bending and expression of the divergent nagE-B operons. Nucleic Acids Res. 1998;26:1254–1260. doi: 10.1093/nar/26.5.1254. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Rhodius V A, West D M, Webster C L, Busby S J W, Savery N J. Transcription activation at class II CRP-dependent promoters: the role of different activating regions. Nucleic Acids Res. 1997;25:326–332. doi: 10.1093/nar/25.2.326. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Richet E, Sogaard-Andersen L. CRP induces the repositioning of MalT at the Escherichia coli malKp promoter primarily through DNA bending. EMBO J. 1994;13:4558–4567. doi: 10.1002/j.1460-2075.1994.tb06777.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Sabourin D, Beckwith J. Deletion of the Escherichia coli crp gene. J Bacteriol. 1975;122:338–340. doi: 10.1128/jb.122.1.338-340.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Savery N J, Lloyd G S, Kainz M, Gaal T, Ross W, Ebright R H, Gourse R L, Busby S J W. Transcription activation at class II CRP-dependent promoters: identification of determinants in the C-terminal domain of the RNA polymerase α-subunit. EMBO J. 1998;17:3439–3447. doi: 10.1093/emboj/17.12.3439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Simons R W, Houman F, Kleckner N. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene. 1987;53:85–96. doi: 10.1016/0378-1119(87)90095-3. [DOI] [PubMed] [Google Scholar]
- 32.Slauch J M, Russo F D, Silhavy T J. Suppressor mutations in rpoA suggest that OmpR controls transcription by direct interaction with the α subunit of RNA polymerase. J Bacteriol. 1991;173:7501–7510. doi: 10.1128/jb.173.23.7501-7510.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Tang H, Severinov K, Goldfarb A, Fenyo D, Chait B, Ebright R H. Location, structure, and function of the target of a transcription activator protein. Genes Dev. 1994;8:3058–3067. doi: 10.1101/gad.8.24.3058. [DOI] [PubMed] [Google Scholar]
- 34.Tobin J F, Schleif R F. Purification and properties of RhaR, the positive regulator of the l-rhamnose operons of Escherichia coli. J Mol Biol. 1990;211:75–89. doi: 10.1016/0022-2836(90)90012-B. [DOI] [PubMed] [Google Scholar]
- 35.Tobin J F, Schleif R F. Transcription from the rha operon psr promoter. J Mol Biol. 1990;211:1–4. doi: 10.1016/0022-2836(90)90003-5. [DOI] [PubMed] [Google Scholar]
- 36.West D, Williams R, Rhodius V, Bell A, Sharma N, Zou C, Fujita N, Ishihama A, Busby S. Interactions between the Escherichia coli cyclic AMP receptor protein and RNA polymerase at class II promoters. Mol Microbiol. 1993;10:789–797. doi: 10.1111/j.1365-2958.1993.tb00949.x. [DOI] [PubMed] [Google Scholar]
- 37.Zhang X, Schleif R. Catabolite gene activator protein mutations affecting activity of the araBAD promoter. J Bacteriol. 1998;180:195–200. doi: 10.1128/jb.180.2.195-200.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Zhou Y, Merkel T J, Ebright R H. Characterization of the activation region of Escherichia coli catabolite gene activator protein (CAP). II. Role at class I and class II CAP-dependent promoters. J Mol Biol. 1994;243:603–610. doi: 10.1016/0022-2836(94)90035-3. [DOI] [PubMed] [Google Scholar]
- 39.Zhou Y, Pendergrast P S, Bell A, Williams R, Busby S, Ebright R H. The functional subunit of a dimeric transcription activator protein depends on promoter architecture. EMBO J. 1994;13:4549–4557. doi: 10.1002/j.1460-2075.1994.tb06776.x. [DOI] [PMC free article] [PubMed] [Google Scholar]