Abstract
Background
Burkholderia pseudomallei, an environmental saprophyte bacterium, causes melioidosis in humans and animals. It was first discovered in Iran between 1967 and 1976 in small ruminants, equines, environments and humans. No subsequent studies have been conducted to determine the existence and prevalence of this pathogen in the country.
Objectives
The present study aims to monitor the presence of B. pseudomallei in the ruminant population of the Golestan province of Iran, which largely depends on pastures. The ruminants can serve as sentinels to indicate the presence of the bacteria in the environment and its potential impact on human health in the One Health triad.
Methods
Liver and lung abscesses from domestic sheep, cattle and goats in three industrial and three conventional slaughterhouses were sampled and analysed using 23S ribosomal DNA polymerase chain reaction (rDNA PCR) with primers CVMP 23‐1 and CVP‐23‐2 for B. pseudomallei, Burkholderia cepacia and Burkholderia vietnamiensis, as well as B. pseudomallei–specific TTS1 real‐time PCR, along with microbiological and biochemical assays.
Results
Out of the 97 animals sampled, only 14 (15%) tested positive for 23S rDNA PCR. However, the follow‐up evaluation using TTS1 real‐time PCR and microbiological and biochemical assays did not confirm the presence of B. pseudomallei in the samples.
Conclusions
Although B. pseudomallei was not detected in the current survey, conducting abattoir‐based surveillance of ruminants is a cost‐effective One Health approach to monitor pathogenic Burkholderia. Developing standards of clinical and laboratory good practices for Burkholderia infections is crucial for One Health surveillance.
Keywords: Burkholderia, melioidosis, real‐time PCR, ruminants, slaughterhouse
After years of neglecting melioidosis endemicity in Iran, this study investigated the presence of Burkholderia pseudomallei in ruminant lung and liver abscesses in six slaughterhouses in Golestan province. The results showed no confirmed pathogen presence, emphasizing the importance of abattoir surveys under the One Health surveillance system. Developing standards for good clinical and laboratory practices for Burkholderia infections is crucial.

1. INTRODUCTION
Burkholderia pseudomallei, the cause of melioidosis, is a saprophyte bacterium that primarily infects humans and animals through environmental and occupational exposures (Sprague & Neubauer, 2004). Tracking pathogens in the environment or animal populations can predict shared health risks for humans and is applied for One Health surveillance system (Baradaran‐Seyed, 2020). The prevalence of infection is significantly reduced by good practice standards in intensive breeding and confined settings. Nomadic pastoralist systems and pasture‐dependent species, such as free‐grazing sheep and goats, are at higher risk of B. pseudomallei infection, especially when biosecurity and biocontainment measures are not in place (Hambali et al., 2018; Kongkaew et al., 2017; Musa et al., 2012, 2015; Srikitjakarn et al., 2002).
Melioidosis has been neglected in Iran for around 50 years, and its endemicity is controversial (Baradaran‐Seyed, 2020). The pathogen was first diagnosed in a Saanen goat imported from Israel in 1967, which belonged to the Heydarabad Animal Husbandry Agency (Animal Science Research Institute of Iran, ASRI, founded in 1933) (Baharsefat & Amjadi, 1970; Baradaran‐Seyed, 2020; Hablolvarid, 2019). The infection was confirmed by microbiological and biochemical tests and the inoculation of the isolate into guinea pigs and native lambs (Baharsefat & Amjadi, 1970; Hablolvarid, 2019). Other goats from ASRI were also infected in the following months. Although Baharsefat and Amjadi (1970) mentioned that the pathogen was also isolated from native sheep by the nearby state institute (Razi Vaccine and Serum Research Institute, RVSRI, founded in 1924), no supporting information was provided in the institute's annual reports and during a survey of pneumonia in the small ruminants of Iran (Hablolvarid, 2019).
Dodin et al. (1976) reported that melioidosis and glanders were present in Iran's army equine in 1943. However, the first and only confirmed report of equine melioidosis in Iran dates back to 1969 in the equine population of RVSRI, which was kept to produce human therapeutic sera (Baharsefat & Amjadi, 1970; Baradaran‐Seyed, 2020; Hablolvarid, 2019). Follow‐up investigations were conducted on two dead horses and a mule, and B. pseudomallei was isolated and confirmed by the Walter Reed Army Institute and the University of California, Davis, USA (Baharsefat & Amjadi, 1970).
From 1974 to 1976, studies were conducted by the Institute Pasteur of Paris and Iran to confirm the presence of B. pseudomallei in the northern provinces of Gilan and Mazandaran. These areas were ecologically suitable habitats for saprophyte Burkholderia compared to other parts of the country (Galimand & Dodin, 1982; Pourtaghva et al., 1975, 1976, 1977). Thirty‐one isolates of B. pseudomallei were obtained from rice fields and the water supply of a village (Galimand & Dodin, 1982; Pourtaghva et al., 1975). In 1975, Pourtaghva et al. (1976) reported the historical rice field skin disease among rice farming societies of these provinces. Although schistosome‐induced cercarial dermatitis with similar manifestations had been prevalent in rice farmers for many years, Pourtaghva et al. (1976) believed that the disease was hypersensitivity to Whitmore's bacillus antigens as any schistosome cereals were not observed in the rice fields’ water. In early July 1976, the first case of melioidosis pneumonia was diagnosed in a human who had a history of bathing in a river where the rice fields’ water flowed (Pourtaghva et al., 1977). Following the previously mentioned instances, only one case of travel‐associated melioidosis was reported in 2011 in Iran (Baradaran‐Seyed, 2020).
The most extraordinary melioidosis outbreak in nonendemic regions occurred in France in the 1970s. It was first diagnosed in an equine imported from Iran (Dodin et al., 1976; Galimand & Dodin, 1982; Mollaret, 1988), but the initial source of infection was not confirmed (Galimand & Dodin, 1982; Mollaret, 1988). During the epidemic, several zoos and equestrian clubs throughout France were affected, and many animals were euthanized. At least two humans died. The pathogen was isolated from the soil for up to 6 years.
Using animals as sentinels to track B. pseudomallei infection in humans is an essential aspect of the One Health triad's approach to surveillance. Despite years of neglecting melioidosis endemicity in Iran, the current study investigates the presence of B. pseudomallei in ruminants in Golestan province. This province was formed in 1997 after being split off from Mazandaran. Unlike Gilan and Mazandaran, it has a large population of ruminants grazing extensively in the vast pastures that cover more than half of its area (Pourtaghva et al., 1975). Therefore, the interaction between livestock and the environment in this province is suitable for tracking the possible infection in the animal kingdom.
2. MATERIALS AND METHODS
2.1. Geographical and background information
Golestan is a north‐eastern Iran province bordered by Turkmenistan and the Caspian Sea (Figure 1). Golestan province covers an area of approximately 20,000 km2, which makes up 1.3% of the entire country's area. It ranks ninth in terms of arable soil and irrigated and rain‐fed crops, with 65,000 ha. However, when it comes to wheat, rice and rapeseed production, it is among the top five provinces in the country. This highlights the importance of Golestan province in agricultural production. The province of Golestan has mild weather and temperate climate throughout most of the year. The minimum daily temperature in Golestan is −1.4°C, and the maximum is 46.5°C. Its topography is divided into two distinct of the plains and the mountains of the Alborz range. The southern region experiences a typical mountainous climate, whereas the central and south‐western regions have a temperate Mediterranean climate. The northern part of the province is characterized by a semi‐arid or arid climate. The favourable climate and adequate water supply have resulted in the availability of fertile lands, leading to an extension of agricultural activities in the region (Hafezi Moghaddas et al., 2013). Pastures account for 41% of the province's territory. The annual rainfall is three times the national average but lower than that of two north‐western provinces, Gilan and Mazandaran. The Golestan flood in March 2019 posed a risk of the reappearance of B. pseudomallei if the pathogen existed previously. The ruminant population of the province is estimated to be around 2.5 million, 90% of which is sheep and the remaining cattle, whereas the population of goats is minimal and is not included in the official statistics.
FIGURE 1.

Geographical distribution of the investigated slaughterhouses in Golestan province, Iran. The map shows the distribution of the industrial abattoirs in Aqqala and Gonbad‐e Kavus and the conventional ones in Aliabad‐e Katul, Azadshahr and Ramian.
2.2. Sampling protocol and samples
The study focused on domestic nomadic and native ruminants slaughtered at six out of nine slaughterhouses in the provinces. The selected slaughterhouses included three industrial abattoirs, two located in Aqqala, one in Gonbad‐e Kavus and three conventional ones in Aliabad‐e Katul, Azadshahr and Ramian Counties. Most ruminants in the province were referred for slaughtering in industrial abattoirs (Figure 1).
Three conventional abattoirs that were not included in this study were located in Maraveh‐tappeh, Kalaleh and Galikash, which have semi‐arid or arid climates. These excluded abattoirs had a minimal number of slaughtered ruminants, reducing the chances of obtaining B. pseudomallei‐like lesions. Study period was at the end of the migration season of nomadic herders in May 2022. Three weeks of unexpected massive rainfall during the sampling period delayed the migration process.
Purposeful sampling was conducted to detect infection from lesions resembling ruminant melioidosis (Dance & Limmathurotsakul, 2018; Sprague & Neubauer, 2004). Technical officials at each slaughterhouse sampled multiple greenish‐yellow or off‐white abscesses and nodules in visceral organs and regional lymph nodes. Incised abscesses with surrounded tissues were immediately transferred to tubes of broth media. The transferred media included 25 mL tryptic soy broth with penicillin G procaine (800,000 IU/L) and gentamicin (4 mg/L) or Ashdown broth with solution 0.1% of crystal violet that was incubated for 2 weeks at 37°C to ensure optimal coloration, and gentamicin (4 mg/L) in 50 mL clear polypropylene centrifuge tubes (Limmathurotsakul et al., 2013).
The broth media was prepared, aliquoted, sterilized and transported to Golestan close to ice packs. Each animal's samples were allocated one medium, stored at 4°C and returned to the laboratory for further investigation.
2.3. Polymerase chain reaction (PCR) and TTS1 real‐time PCR assays
Overnight cultures of the control strains, including Burkholderia cepacia (ATCC 25416), B. pseudomallei strain 326 and Burkholderia mallei strain 325 (Razi RTCC 2375) and supernatants of broth cultures of tissue samples incubating at 37°C for 2 days, were pipetted into microtubes by a skilled specialist under a Class II biosafety cabinet and sterile conditions, then deactivated at 95°C for 10 min. DNA extraction was performed using the phenol–chloroform–isoamyl protocol for polymerase chain reaction (PCR) assays and the high pure PCR Template Preparation Kit (Roche Diagnostics) for real‐time processes. The Roche kit's procedure was modified, extending the incubation time of the proteinase K to 90 min to ensure the complete digestion of the tissue samples. DNA concentrations were determined by a spectrophotometer (Thermo Fisher Scientific).
The 23S ribosomal DNA (rDNA) PCR test was conducted using sense primer CVMP 23‐1 (5′‐AAA‐CCG‐ACA‐CAG‐GTG‐G‐3′) targets 5b/8ab and antisense oligonucleotide primer CVP‐23‐2 (5′‐CAC CGA AAC TAG CG‐3′), targets position 78ab to identify B. pseudomallei, B. cepacia and Burkholderia vietnamiensis (Bauernfeind et al., 1998). The final product was 526 bp. The PCR programme included denaturation at 95°C for 5 min, 30 cycles of denaturation at 95°C for 30 s, annealing at 52°C for 30 s and DNA extension at 72°C for 45 s, followed by a secondary extension cycle at 72°C for 10 min.
Primer pairs of VMP 23‐1 (5′‐CTT‐TTG‐GGT‐CAT‐CCT‐ RGA‐3′) containing target position 9ab/10a and MP 23‐2 (5′‐TCC‐TAC‐CAT‐GCG‐AGA‐CT‐3′) having target position 45ab/36b were also used with the final PCR product 1051 bp to assay the presence of the B. vietnamiensis, B. pseudomallei and B. mallei (Bauernfeind et al., 1998). The PCR programme was the same except for the annealing temperature at 56°C based on gradient PCR. PCR products were evaluated by 1.5% agarose gel electrophoresis, and the ladder (100 bp plus DNA, BIORON) determined the size of double‐stranded DNA from 100 to 1500 base pairs.
The real‐time PCR assay was also conducted using primers BpTT4176F (5′‐CGTCTCTATACTGTCGAGCAATCG‐3′), BpTT4290R (5′‐CGTGCACACCGGTCAGTATC‐3′) and the fluorogenic probe BpTT4208P (5′‐6‐FAM‐CCGGAATCTGGATCACCACCACTTTCC‐BHQ1‐3′) targets the type III secretion system at the position orf2 gene cluster with the 115‐bp product to distinguish B. pseudomallei from other microbial species (Noparatvarakorn et al., 2023; Novak et al., 2006). The amplification and detection were done by ABI StepOne real‐time PCR system (Applied Biosystems), with the initial activation at 95°C for 3 min, followed by 50 cycles of denaturation at 95°C for 15 s and annealing and extension at 60°C for 1 min.
2.4. Microbiological and biochemical investigation
The supernatants of broth media, which were positive by CVMP‐23‐1 and CVP‐23‐2 primers, were subsequently subcultured onto agar plates to isolate the possible Burkholderia. The agars included Ashdown's medium containing crystal violet (solution 0.1% for 2 weeks incubated at 37°C) and gentamicin (4 mg/L) in addition to blood agar, MacConkey agar and B. cepacia selective agar, each containing penicillin G procaine (800,000 IU/L) and gentamicin (4 mg/L). The media were incubated at 37°C and inspected daily for 1 week (Limmathurotsakul et al., 2013; Wuthiekanun & Dance, 2012). B. pseudomallei colonies on Ashdown agar are pinpoint in size and have a clear to pale pink colour. After 2 days of incubation, they become darker pink to purple, flat, with a definite metallic sheen. On blood agar, they appear creamy with a slight metallic sheen and are non‐haemolytic, resembling a coliform. Meanwhile, on MacConkey agar, they are colourless and resemble a non‐lactose‐fermenting coliform. B. pseudomallei colonies tend to dry and wrinkle after 2 days of incubation.
3. RESULTS
The abscesses in the lungs, livers and regional lymph nodes of 97 animals (90 sheep, 6 cattle and 1 goat) were sampled. Only six cattle and one goat with characteristic lesions were sampled due to their limited population. Table 1 shows the frequency of samples taken from each abattoir.
TABLE 1.
The distribution of samples and frequency of results obtained from animals during the study.
| Slaughterhouses | 23S rDNA PCR assay using primers CVMP 23‐1 and CVP‐23‐2 | 23S rDNA PCR assay using primers VMP 23‐1 and MP 23‐2 | TTS1 real‐time PCR | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Ovine | Caprine | Bovine | Total | Ovine | Caprine | Bovine | Total | Ovine | Caprine | Bovine | Total | ||
| Industrial | Aqqala‐1 | 4/24 | – | – | 11/72 | 0/24 | – | – | 0/72 | 0/24 | – | – | 0/72 |
| Aqqala‐2 | 5/23 | 0/1 | – | 0/23 | 0/1 | – | 0/23 | 0/1 | – | ||||
| Gonbad‐e Kavus | 2/18 | – | 0/6 | 0/18 | – | 0/6 | 0/18 | – | 0/6 | ||||
| Conventional | Azadshahr | 3/10 | – | – | 3/25 | 0/10 | – | – | 0/25 | 0/10 | – | – | 0/25 |
| Aliabad‐e Katul | 0/9 | – | – | 0/9 | – | – | 0/9 | – | – | ||||
| Ramian | 0/6 | – | – | 0/6 | – | – | 0/6 | – | – | ||||
| 14/90 | 0/1 | 0/6 | 14/97 | 0/90 | 0/1 | 0/6 | 0/97 | 0/90 | 0/1 | 0/6 | 0/97 | ||
Abbreviations: PCR, polymerase chain reaction; rDNA, ribosomal DNA.
Extracted DNA of 14 Ashdown's broth cultures showed 526 bp bands using primers CVMP‐23‐1 and CVP‐23‐2. Positive samples were taken from four sheep of Aqqala‐1, five of Aqqala‐2, two of Gonbad‐e Kavus and three from the conventional slaughterhouse of Azadshahr (Table 1). PCR conducted with primers VMP 23‐1 and MP 23‐2 did not show a band of 1051 bp. As a result, positive samples diagnosed using primers CVMP‐23‐1 and CVP‐23‐2 did not originate from B. vietnamiensis, B. pseudomallei and B. mallei.
DNA extracted from 97 broth media cultures, B. cepacia (ATCC 25416) and B. mallei strain 325 (Razi RTCC 2375) did not amplify with TTS1 real‐time PCR primers and probes (Figure 2). Therefore, it is confirmed that DNA extracts resulted positive by primers CVMP‐23‐1 and CVP‐23‐2 did not belong to B. pseudomallei.
FIGURE 2.

The TTS1 real‐time polymerase chain reaction (PCR) specific to Burkholderia pseudomallei only amplified the positive control; DNA extracted from 97 broth media cultures, Burkholderia cepacia (ATCC 25416) and Burkholderia mallei strain 325 (Razi RTCC 2375) did not amplify with the probe.
After subculturing broth media onto agar plates, only one sample's colonies were positive for the 526 bp PCR product using primers CVMP‐23‐1 and CVP‐23‐2, whereas B. pseudomallei was not confirmed with primers VMP 23‐1 and MP 23‐2.
4. DISCUSSION
The study comprehensively inspected the main abattoirs that slaughter ruminants in the province. Contrary to previous reports of B. pseudomallei from the two northern provinces of Gilan and Mazandaran in the 1970s, our study did not detect B. pseudomallei in abattoir samples from Golestan (Pourtaghva et al., 1975, 1976, 1977). However, it cannot be concluded that melioidosis no longer exists, and further research is necessary to investigate the epidemiology of melioidosis in the country.
Although indirect haemagglutination, enzyme‐linked immunosorbent assay, complement fixation test and several biochemical and PCR assays have been developed for diagnosing melioidosis in susceptible species, they are not reliable enough due to their lack of sensitivity and specificity (Desoutter et al., 2024; Gasque et al., 2024). The most reliable diagnostic test is culture, even though there exists a possibility of false‐negative results (Wiersinga et al., 2018; Novak et al., 2006).
The TTS1 real‐time PCR is a test that can discriminate and rapidly identify B. pseudomallei isolates from other microbial species. It targets orf2 of the B. pseudomallei type III secretion system and can distinguish a large number of diverse B. pseudomallei isolates from non‐B. pseudomallei isolates. This test is not inhibited by blood products or DNA and has high sensitivity, specificity and a low detection limit. As a result, it is a good candidate for diagnostic evaluations in clinical laboratories (Novak et al., 2006).
Using B. pseudomallei–specific TTS1 real‐time PCR has improved our laboratory's ability to detect the possible pathogen in samples. The results obtained from 23SrDNA PCR with primers VMP 23‐1 and MP 23‐2 were also consistent with TTS1 real‐time PCR (Noparatvarakorn et al., 2023; Novak et al., 2006). Fourteen positive animals by 23SrDNA PCR using CVMP‐23‐1 and CVP‐23‐2 likely indicated the presence of other saprophytic and opportunistic Burkholderia, such as a B. cepacia complex, in our samples (Bauernfeind et al., 1998). However, determining the species of Burkholderia and the pathogenicity requires additional studies. Until now, except for one mastitis outbreak in a sheep flock, no global report or abattoir‐based study of other saprophytic and opportunistic Burkholderia in small ruminants has been published (Berriatua et al., 2001).
Melioidosis has various symptoms; none are pathognomonic. Regardless of the dermatological manifestation of melioidosis, animal diagnosis is mainly limited to post‐mortem examination. Therefore, awareness and attitude towards tracking the disease in a One Health setting are the bases of improving laboratory infrastructure on the animal side (Sprague & Neubauer, 2004). However, many problems are caused by abscess lesions, including melioidosis, removed locally without any diagnosis or differentiation. Heavy parasitic and bacterial involvement in tropical regions may reduce the chance of specific sampling. Good clinical and laboratory practice standards should be developed for diagnosing Burkholderia infections in the One Health surveillance system setting (Damrongsukij et al., 2021; Mariappan et al., 2022). Although there are standard operating procedures (SOPs) and consensus guidelines for diagnosing B. pseudomallei in the environment and in human patients (Mahidol‐Oxford Tropical Medicine Research Unit, 2011; Mahidol‐Oxford Tropical Medicine Research Unit, 2015; Wuthiekanun & Dance, 2012), there is no parallel for the animal kingdom. A slaughterhouse survey and purposive sampling of abscesses are cost‐efficient and can dramatically increase the chance of detection, especially when there is no previous epidemiological information. Abattoir studies resolve the challenge of extensive random sampling from animals with non‐specific clinical manifestations and the problem of invalid serological methods, which are critical limitations regarding melioidosis diagnosis.
SOPs for isolating B. pseudomallei from the environment and human clinical samples recommended latex agglutination, a susceptibility test to co‐amoxiclav disc and resistance to gentamicin and colistin discs for screening the possible suspect colonies of B. pseudomallei (Wuthiekanun & Dance, 2012; Mahidol‐Oxford Tropical Medicine Research Unit, 2015). The most specific diagnosis can be conducted by 16S rDNA or automated and validated systems, such as matrix‐assisted laser desorption/ionization‐time of flight, mass spectrometry, multilocus sequence typing and whole genome sequencing of extracted DNA (Mahidol‐Oxford Tropical Medicine Research Unit, 2011, 2015; Wiersinga et al., 2018; Wuthiekanun & Dance, 2012).
According to microbiological surveillance of the Agri‐Food and Veterinary Authority of Singapore, 341 out of 1696 (20%) samples taken from condemned carcasses of imported livestock from 2008 to 2016 were positive for B. pseudomallei (Sim et al., 2018). A slaughterhouse‐based survey in pigs of Niamey, Niger, reported 100 isolates of B. pseudomallei from swine lesions in the 1970s (Ferry et al., 1973). The other published abattoir‐based study was conducted in two provinces of Thailand from November 2016 to April 2017 (Sakdinun et al., 2018). During purposive sampling of slaughtered animals, including pigs (392), beef cattle (Srikitjakarn et al., 2002) and a goat, 93 isolates of B. pseudomallei were obtained from 92 pigs and 1 goat. In the present study, purposive sampling of lesions was conducted to increase the chance of isolation. Unlike the above‐mentioned abattoir studies, we utilized the TTS1 real‐time PCR assay proposed for B. pseudomallei–specific identification to increase the likelihood of specific detection of infection (Kwanhian et al., 2020; Mahidol‐Oxford Tropical Medicine Research Unit, 2015; Wuthiekanun & Dance, 2012).
If it is supposed to have an integrated approach to pathogenic Burkholderia surveillance, planning for universal diagnosis methods with high sensitivity in the local zones and high specificity in the centre is crucial.
Standard‐formulated media can improve the chance of isolating the pathogens in the equipped microbial laboratory. However, general diagnostic laboratories are not recommended to isolate B. pseudomallei due to the risk imposed on personnel under limited laboratory facilities (Gilad et al., 2007). Melioidosis can be chronic, and the chance of the disease getting neglected in livestock is much higher than in humans because livestock do not survive long or die unnoticed of suspected melioidosis. Moreover, Burkholderiaceae are resistant to common antibiotics, and as keeping low‐performing livestock is not reasonable, they would be culled without a diagnosis. Therefore, the disease's burden is unclear (Dance & Limmathurotsakul, 2018; Limmathurotsakul et al., 2012; Sprague & Neubauer, 2004).
Although the first report of melioidosis in Iran in the 1960s pointed out the infection of Israeli Saanen goats (Baradaran‐Seyed, 2020; Baharsefat & Amjadi, 1970), those animals were likely infected in the ASRI due to mixing with other non‐native animals imported for interbreeding. As for the French epidemic, the horse attributed to Iran was recommended to be the first case identified, not the source of the disease (Mollaret, 1988). In general, all these cases do not justify the isolation of the agent from the paddy fields and environments of northern provinces (Pourtaghva et al., 1975, 1976, 1977). According to the authors’ follow‐ups, none of those isolates exist in microbial collections.
The present study is a positive step towards global mapping of B. pseudomallei distribution in Iran after 50 years. The consequences of behaviour risks, such as smuggling, cross‐border transfer of animals and extensive migration of nomads, should be considered in the context of the recent floods and dust storms that have affected many provinces of Iran (Baradaran‐Seyed, 2020). The ecological niche for pathogen survival is conducive to foreign and native ecotourism throughout the year. Deliberate release and bioterrorism are discussed with high‐consequence pathogens such as B. mallei and B. pseudomallei; therefore, biodefence logistics and the ability to track and diagnose disease are a matter of global and national health security (Gilad et al., 2007).
5. CONCLUSION
After years of neglecting melioidosis endemicity in Iran, this study investigated the presence of B. pseudomallei in ruminant lung and liver abscesses in six slaughterhouses in Golestan province. B. pseudomallei was not detected in the abattoir samples collected during our study. Further investigation is necessary to comprehend the occurrence and epidemiology of melioidosis in Iran. It is crucial to develop standards for good clinical and laboratory practices for Burkholderia infections. Iran has been reported to have pathogenic Burkholderia species; therefore, it is essential to equip a specialized high containment biological safety laboratory according to world‐class standards responsible for Burkholderia detection, isolation and differential diagnosis.
AUTHOR CONTRIBUTIONS
Nader Mosavari: Conceptualization (supporting); supervision (supporting); validation (supporting); writing–review and editing (equal). Mohsen Bashashati: Project administration (supporting); validation (supporting); writing–review and editing (equal). Mahdi Dehghanpour; Shojaat Dashtipour and Reza Najafpour: Methodology (lead); writing–review and editing (equal). Mohsen Abdolvand: Project administration (supporting); Investigation (supporting); writing–review and editing (equal). Faezeh Heshmatinia; Fereshteh Sabouri and Saeid Mohammad Hosseini: Methodology (supporting); writing–review and editing (equal). Zahra Baradaran‐Seyed: Conceptualization (lead); supervision (lead); project administration (lead); writing–original draft (lead); writing–review and editing (lead).
CONFLICT OF INTEREST STATEMENT
The authors declare that financial and non‐financial relationships, construed as potential conflicts of interest, interfered with the study.
ETHICS STATEMENT
The authors confirm adherence to the ethical policies of the journal, as noted on the journal's author guidelines page. No ethical approval was required as no live animals were involved in this study. The veterinary director general supervised abattoir inspections.
PEER REVIEW
The peer review history for this article is available at https://www.webofscience.com/api/gateway/wos/peer‐review/10.1002/vms3.1503.
ACKNOWLEDGMENTS
The study was conducted based on the approved research projects (codes 97017‐97017‐057‐18‐18‐970790 and 010474‐025‐18‐18‐7) at Razi Vaccine and Serum Research Institute. The authors would like to highly appreciate the collaboration of Dr. Mehrabi, all owners, and the technical staff of slaughterhouses. We also thank Professors David Dance, Bart Currie and Direk Limmathurotsakul for providing advice on melioidosis and B. pseudomallei.
Mosavari, N. , Bashashati, M. , Dehghanpour, M. , Abdolvand, M. , Heshmatinia, F. , Sabouri, F. , Dashtipour, S. , Hosseini, S. M. , Najafpour, R. , & Baradaran‐Seyed, Z. (2024). Tracking melioidosis in Iran: Utilizing abattoir‐based surveillance as a One Health approach. Veterinary Medicine and Science, 10, e1503. 10.1002/vms3.1503
DATA AVAILABILITY STATEMENT
All data generated or analysed during this study are included in this published article.
REFERENCES
- Baharsefat, M. , & Amjadi, A. (1970). Equine melioidosis in Iran. Archives of Razi Institute, 22(1), 209–213. [Google Scholar]
- Baradaran‐Seyed, Z. (2020). Is melioidosis a one health‐neglected disease in Iran? International Journal of Travel Medicine and Global Health, 8(3), 93–95. [Google Scholar]
- Bauernfeind, A. , Roller, C. , Meyer, D. , Jungwirth, R. , & Schneider, I. (1998). Molecular procedure for rapid detection of Burkholderia mallei and Burkholderia pseudomallei . Journal of Clinical Microbiology, 36(9), 2737–2741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Berriatua, E. , Ziluaga, I. , Miguel‐Virto, C. , Uribarren, P. , Juste, R. , Laevens, S. , Vandamme, P. , & Govan, J. R. W. (2001). Outbreak of subclinical mastitis in a flock of dairy sheep associated with Burkholderia cepacia complex infection. Journal of Clinical Microbiology, 39(3), 990–994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Damrongsukij, P. , Doemlim, P. , Kusolsongkhrokul, R. , Tanee, T. , Petcharat, P. , Siriporn, B. , Piratae, S. , & Pumipuntu, N. (2021). One health approach of melioidosis and gastrointestinal parasitic infections from Macaca fascicularis to human at Kosumpee Forest Park, Maha Sarakham, Thailand. Infection and Drug Resistance, 14, 2213–2223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dance, D. , & Limmathurotsakul, D. (2018). Global burden and challenges of melioidosis. Tropical Medicine and Infectious Disease, 3(1), 1–258. https://mdpi‐res.com/bookfiles/book/1183/Global_Burden_and_Challenges_of_Melioidosis.pdf?v=1718154055 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desoutter, A. , Deshayes, T. , Vorimore, F. , Klotoe, B. , Durand, B. , Colot, J. , Wagner‐Lichtenegger, G. , Steinmetz, I. , Tuanyok, A. , & Laroucau, K. (2024). Isolation of Burkholderia pseudomallei from a goat in New Caledonia: Implications for animal and human health monitoring and serological tool comparison. BMC Veterinary Research, 20(1), 114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dodin, A. , Galimand, M. , Chove, M. A. , & Sanson, R. (1976). Le bacille de Whitmore. Germe d'actualité. Médecine et Maladies Infectieuses, 6(10), 395–398. [Google Scholar]
- Ferry, R. , Poutrel, B. , & Bruneau, F. (1973). Isolement du bacille de Whitmore a partir de lesions rencontrees chez le porc a l'abattoir de. Niamey au Niger Bull Soc Pathol Exot, 66(1), 42–45. [PubMed] [Google Scholar]
- Galimand, M. , & Dodin, A. (1982). Répartition de Pseudomonas pseudomallei en France et dans le monde. Bulletin Mensuel de la Société Vétérinaire Pratique de France, 66, 3–14. [Google Scholar]
- Gasque, M. , Guernier‐Cambert, V. , Manuel, G. , Aaziz, R. , Terret, J. , Deshayes, T. , Baudrimont, X. , Breurec, S. , Rochelle‐Newall, E. , & Laroucau, K. , (2024). Serological screening in animals combined with environmental surveys provides definite proof of the local establishment of Burkholderia pseudomallei in Guadeloupe. bioRix, 2024‐02. 10.1101/2024.02.09.579440 [DOI]
- Gilad, J. , Schwartz, D. , & Amsalem, Y. (2007). Clinical features and laboratory diagnosis of infection with the potential bioterrorism agents Burkholderia mallei and Burkholderia pseudomallei . International Journal of Biomedical Science: IJBS, 3(3), 144. [PMC free article] [PubMed] [Google Scholar]
- Hablolvarid, M. (2019). History of animal disease diagnosis in Razi Vaccine and Serum Research Institutes from foundation to the present (in Persian). RVSRI. [Google Scholar]
- Hafezi Moghaddas, N. , Hajizadeh Namaghi, H. , Ghorbani, H. , & Dahrazma, B. (2013). The effects of agricultural practice and land‐use on the distribution and origin of some potentially toxic metals in the soils of Golestan province, Iran. Environmental Earth Sciences, 68, 487–497. [Google Scholar]
- Hambali, I. U. , Abba, Y. , Bitrus, A. A. , Peter, I. D. , Jesse, F. F. A. , Balakrishnan, T. , Lila, M. A. M. , Haron, A. W. , Omar, A. R. , Ahmad, N. , & Shuhaimy, F. (2018). Seroprevalence of melioidosis in sheep and goats from selected small ruminant farms in Selangor, Malaysia. Advances in Animal and Veterinary Sciences, 6(2), 88–94. [Google Scholar]
- Kongkaew, W. , Thiptara, A. , Wichaidit, C. , Ninprom, T. , Khrongsee, P. , & Saechan, V. (2017). Seroprevalence of melioidosis in goats in southern Thailand and incidence rates of melioidosis sero‐positivity in confined and semi‐confined goats. Thai‐NIAH eJournal, 12(1), 48–61. [Google Scholar]
- Kwanhian, W. , Jiranantasak, T. , Kessler, A. T. , Tolchinsky, B. E. , Parker, S. , Songsri, J. , Wisessombat, S. , Pukanha, K. , Testamenti, V. A. , Khrongsee, P. , Sretrirutchai, S. , Kaewrakmuk, J. , Tangpong, J. , & Tuanyok, A. (2020). Investigation of melioidosis outbreak in pig farms in Southern Thailand. Veterinary Sciences, 7(1), 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Limmathurotsakul, D. , Dance, D. A. B. , Wuthiekanun, V. , Kaestli, M. , Mayo, M. , Warner, J. , Wagner, D. M. , Tuanyok, A. , Wertheim, H. , Yoke Cheng, T. , Mukhopadhyay, C. , Puthucheary, S. , Day, N. P. J. , Steinmetz, I. , Currie, B. J. , & Peacock, S. J. (2013). Systematic review and consensus guidelines for environmental sampling of Burkholderia pseudomallei . PLoS Neglected Tropical Diseases, 7(3), e2105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Limmathurotsakul, D. , Thammasart, S. , Warrasuth, N. , Thapanagulsak, P. , Jatapai, A. , Pengreungrojanachai, V. , Anun, S. , Joraka, W. , Thongkamkoon, P. , Saiyen, P. , Wongratanacheewin, S. , Day, N. P. J. , & Peacock, S. J. (2012). Melioidosis in animals, Thailand, 2006–2010. Emerging Infectious Diseases, 18(2), 325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mahidol‐Oxford Tropical Medicine Research Unit . (2011). Standard operating procedure (SOP) of indirect haemagglutination assay (IHA) for melioidosis. Faculty of Tropical Medicine, Mahidol University. Accessed 12 June, 2024. https://www.melioidosis.info/download/MICRO_SOP_IHA_ENG_v1%203_8Dec11_SDB.pdf [Google Scholar]
- Mahidol‐Oxford Tropical Medicine Research Unit . (2015). Standard Operating Procedure (SOP) for isolation of Burkholderia pseudomallei from clinical samples . Mahidol‐Oxford Tropical Medicine Research Unit. Accessed 12 June, 2024. https://www.melioidosis.info/download/20151112_141243%20mbl3-8%200m%20isolation%20of%20burkholderia%20pseudomallei%20from%20clinical%20samples_version%201_5.pdf [Google Scholar]
- Mariappan, V. , Vellasamy, K. M. , Anpalagar, R. R. , Lim, Y.‐M. , Zainal Abidin, N. , Subramaniam, S. , & Nathan, S. (2022). One Health surveillance approaches for melioidosis and glanders: The Malaysian perspective. Frontiers in Veterinary Science, 9, 1056723. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mollaret, H. H. (1988). L'affaire du jardin des plantesou comment la mélioïdose fit son apparition en France. Medecine et Maladies Infectieuses, 18, 643–654. [Google Scholar]
- Musa, H. , Hassan, L. , Rachmat, R. , Chandrawathani, P. , Zunita, Z. , & Saleha, A. (2012). Seroprevalence of melioidosis among livestock in Malaysia 2000–2009. Malaysian Journal of Veterinary Research (Malaysia), 3(2), 42–46. [Google Scholar]
- Musa, H. I. , Hassan, L. , Shamsuddin, Z. H. , Panchadcharam, C. , Zakaria, Z. , Abdul Aziz, S. , & Rachmat, R. F. N. (2015). Case–control investigation on the risk factors of melioidosis in small ruminant farms in Peninsular Malaysia. Journal of Applied Microbiology, 119(2), 331–341. [DOI] [PubMed] [Google Scholar]
- Noparatvarakorn, C. , Sengyee, S. , Yarasai, A. , Phunpang, R. , Dulsuk, A. , Ottiwet, O. , Janon, R. , Morakot, C. , Burtnick, M. N. , Brett, P. J. , West, T. E. , & Chantratita, N. (2023). Prospective analysis of antibody diagnostic tests and TTS1 real‐time PCR for diagnosis of melioidosis in areas where it is endemic. Journal of Clinical Microbiology, 61(3), e0160522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Novak, R. T. , Glass, M. B. , Gee, J. E. , Gal, D. , Mayo, M. J. , Currie, B. J. , & Wilkins, P. P. (2006). Development and evaluation of a real‐time PCR assay targeting the type III secretion system of Burkholderia pseudomallei . Journal of Clinical Microbiology, 44(1), 85–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pourtaghva, M. , Dodin, A. , Machoun, A. , Galimand, M. , Mostashri‐Fatouretchi, N. , Daiar, D. , & Sanson, R. (1976). Étude d'une dermite d'allure allergique survenant au contact d'eau contaminée par Pseudomonas pseudomallei chez les riziculteurs du sud de la Mer Caspienne. Médecine et Maladies Infectieuses, 6(10), 405–408. [Google Scholar]
- Pourtaghva, M. , Dodin, A. , Portovi, M. , Teherani, M. , & Galimand, M. (1977). 1st case of human pulmonary melioidosis in Iran. Bulletin de la Societe de Pathologie Exotique et de ses Filiales, 70(2), 107–109. [PubMed] [Google Scholar]
- Pourtaghva, M. , Machoun, A. , & Dodin, A. (1975). Demonstration of Pseudomonas pseudomallei (Whitmore's Bacillus) in the mud of Iranian ricefields (author's transl). Bulletin de la Societe de Pathologie Exotique et de ses Filiales, 68(4), 367–370. [PubMed] [Google Scholar]
- Sakdinun, P. , Paethaisong, T. , Naksuwan, R. , & Sriwongsa, N. (2018). Monitoring of Burkholderia pseudomallei in animals from slaughterhouses in Nakhon Pathom and Ratchaburi provinces. KKU Veterinary Journal, 28(2), 35–43. https://he01.tci‐thaijo.org/index.php/kkuvetj/article/view/143795/111048 [Google Scholar]
- Sim, S. , Ong, C. , Gan, Y. , Wang, D. , Koh, V. , Tan, Y. , Wong, M. , Chew, J. , Ling, S. , Tan, B. , Ye, A. , Bay, P. , Wong, W. , Fernandez, C. , Xie, S. , Jayarajah, P. , Tahar, T. , Oh, P. , Luz, S. , … Tan, G. (2018). Melioidosis in Singapore: Clinical, veterinary, and environmental perspectives. Tropical Medicine and Infectious Disease, 3(1), 31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sprague, L. D. , & Neubauer, H. (2004). Melioidosis in animals: A review on epizootiology, diagnosis and clinical presentation. Journal of Veterinary Medicine, Series B, 51(7), 305–320. [DOI] [PubMed] [Google Scholar]
- Srikitjakarn, L. , Sirimalaisuwan, A. , Khattiya, R. , Krueasukhon, K. , & Mekaprateep, M. (2002). Seroprevalence of melioidosis in dairy cattle in Chiang Mai Province, northern Thailand. Southeast Asian Journal of Tropical Medicine and Public Health, 33(4), 739–741. [PubMed] [Google Scholar]
- Wiersinga, W. J. , Virk, H. S. , Torres, A. G. , Currie, B. J. , Peacock, S. J. , Dance, D. A. B. , & Limmathurotsakul, D. (2018). Melioidosis. Nature Reviews Disease Primers, 4(1), 1–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wuthiekanun, V. , & Dance, D. (2012). Standard Operating Procedure (SOP), simplified method for the isolation of Burkholderia pseudomallei from soil. Detection of environmental Burkholderia pseudomallei working party (version 1.12). Accessed 12 June, 2024. https://www.melioidosis.info/download/20130313_092646%20debworp_soil_sampling_sop_1_12.pdf
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analysed during this study are included in this published article.
