﻿Three novel woody litter inhabiting fungi in Didymosphaeriaceae, Phaeoseptaceae and Synnemasporellaceae from Zhujiangyuan Nature Reserve, Yunnan Province, P.R. China

Gui-Qing Zhang; Nalin N Wijayawardene; Li-Hong Han; Jaturong Kumla; Nakarin Suwannarach; Qiang Li; Abdallah M Elgorban; Ihab M Moussa; Claudia Coleine; Dong-Qin Dai

doi:10.3897/mycokeys.106.123105

. 2024 Jun 21;106:173–200. doi: 10.3897/mycokeys.106.123105

Three novel woody litter inhabiting fungi in Didymosphaeriaceae, Phaeoseptaceae and Synnemasporellaceae from Zhujiangyuan Nature Reserve, Yunnan Province, P.R. China

Gui-Qing Zhang ¹, Nalin N Wijayawardene ^1,^2,^✉, Li-Hong Han ¹, Jaturong Kumla ³, Nakarin Suwannarach ³, Qiang Li ¹, Abdallah M Elgorban ⁴, Ihab M Moussa ⁴, Claudia Coleine ⁵, Dong-Qin Dai ^1,^✉

PMCID: PMC11214014 PMID: 38948915

Abstract

Zhujiangyuan Nature Reserve, located in Qujing City, Yunnan Province, China, is reported with high fauna and floral diversity, while the fungal diversity of the region is poorly documented. During the summer season in 2023, decaying wood-inhabiting microfungi were collected from different microhabitats. The novel species were identified based on morphological characteristics and phylogenetic analyses (based on combined datasets of ITS, LSU, SSU, tef1-α, and rpb2 regions). Two species belong to Dothideomycetes (viz., Spegazziniazhujiangyuanensissp. nov. and Phaeoseptumzhujiangyuanensesp. nov. in Pleosporales) while the other one resides in Sordariomycetes (Synnemasporellafaniisp. nov. in Diaporthales). The results are in conformity with the earlier studies that predicted higher fungal diversity in this region.

Key words: Morpho-molecular, new fungal species, phylogeny, taxonomy, woody fungi

Introduction

Fungi have a worldwide distribution and underpin nearly all life on the Earth (Mueller and Schmit 2007). They can grow in a wide range of habitats, including extreme environments like deserts or high salt concentrations (Raghukumar and Raghukumar 1998; Dadachova et al. 2007). Fungi exist in various lifestyles, including pathogenic, saprophytic, endophytic, and symbiotic (Naranjo-Ortiz and Gabaldón 2019). They occur as decomposers to degrade organic materials, contribute to carbon and nutrient cycling directly in ecosystems (Richards et al. 2017), and play a role in facilitating mineral cycling, accelerating rock weathering, and promoting plant growth. Currently, the estimates of fungal diversity range from 2 to 3 million. Species Fungorum (2024) (accession date: 31 May 2024) lists all accepted species of fungi, currently 161,104 species; therefore, over 90% of fungal species is still unknown (Hawksworth and Lücking 2017; Niskanen et al 2023). It is predicted that a number of novel taxa could be harboured in tropical regions where the environmental factors are favourable for higher diversity and continued living (Hawksworth and Lücking 2017). Wijayawardene et al. (2021) reported that Yunnan and Guizhou Provinces in China would be an important locality to explore novel taxa although it showcases subtropical climate.

The Zhujiangyuan Nature Reserve harbours abundant plant resources, with forest coverage of more than 95% and exceeding 1,000 species of plants (Wang et al. 2015). The warm climate and sufficient moisture guarantee a rich fungal diversity in Zhujiangyuan Nature Reserve. However, few studies have been carried out in the Zhujiangyuan Nature Reserve, especially on the floristic diversity of fungi.

Zhujiang is the third longest river in China, which covers about 450,000 km², and flows through most cities in Southern China and a wide range of areas in Northern Vietnam (Guo et al. 2023). It originates from Maxiong Mountain in Zhanyi District, Qujing City, Yunnan Province (Wang 2014). The fungal diversity of this region (i.e. Qujing City and Zhujiangyuan Nature Reserve) is not well documented. Nevertheless, recently, Doilom et al. (2021) introduced Praeclarispora Doilom, W. Dong, K.D. Hyde & C.F. Liao, a novel genus, with Praeclarisporaartemisiae Doilom, W. Dong, K.D. Hyde & C.F. Liao as the type species. At the same time, Doilom et al. (2021) reported Plenodomusartemisiae A. Karun., Phookamsak & K.D. Hyde as a new collection from Artemisiaargyi in Qujing City, Yunnan Province. Wijayawardene et al. (2021) introduced two new species of Phragmocamarosporium Wijayaw., Yong Wang bis & K.D. Hyde (viz., P.magnoliae and P.qujingensis) and one new species of Lonicericola Phookamsak, Jayasiri & K.D. Hyde (viz., L.qujingensis), collected from Magnoliagrandiflora from Qujing Normal University garden, Qujing. Furthermore, five new host/geographical records of different taxa on Magnoliagrandiflora collected from Qujing City, were also reported by Wijayawardene et al. (2021), Botryosphaeriadothidea (Moug.) Ces. & De Not. and Sheariaformosa (Ellis & Everh.) Petr. were reported as new geographical records from China; Diplodiamutila (Fr.) Fr. and D.seriata De Not. were identified as new host records from M.grandiflora in China; while Angustimassarinapopuli Thambug. & K.D. Hyde was comfirmed as a new host and geographical record by Wijayawardene et al. (2021), which mentioned it is the first report of A.populi from China and on M.grandiflora.

During the summer of 2023 (July–September), we collected samples of microfungi associated with decaying wood litter in the North-east gate of Zhujiangyuan Nature Reserve. From the collected samples, we introduce three novel species belonging to Spegazzinia Sacc. (i.e. S.zhujiangyuanensis in Didymosphaeriaceae Munk, Pleosporales, Dothideomycetes O.E. Erikss. & Winka), Phaeoseptum Ying Zhang, J. Fourn. & K.D. Hyde (i.e. P.zhujiangyuanense in Phaeoseptaceae Boonmee, Thambugala & K.D. Hyde, Pleosporales, Dothideomycetes) and Synnemasporella X.L. Fan & J.D.P. Bezerra (i.e. S.fanii in Synnemasporellaceae X.L. Fan & J.D.P. Bezerra, Diaporthales Nannf., Sordariomycetes O.E. Erikss. & Winka) based on morpho-molecular analyses. The new taxa are provided with illustrations and morphological descriptions.

Materials and methodology

Sample collection

With prior permission of the management of Zhujiangyuan Nature Reserve, located in Qujing City, Yunnan Province, China, decaying wood litter samples were collected in the terrestrial habitats. The samples were stored in separate zip-lock plastic bags and transported to the microbiology laboratory of Qujing Normal University. Geographical information and sample information were recorded. Collections were maintained at room temperature (25 °C) and the samples were examined within 3–5 days.

Morphology, isolation and preservation

Fruiting bodies were examined using a Leica S8AP0 stereomicroscope with an HDMI 200C camera (Leica Corporation, Germany). Micro-morphological characters were photographed using an Olympus BX53 compound microscope (Olympus Corporation, Japan) with differential interference contrast (Olympus BX53 DIC compound microscope with an Olympus DP74 camera, Japan). Ascomata and conidiomata were sectioned by hand using a razor blade to obtain thin sections (Dai et al. 2022). All microscopic measurements were made using Tarosoft (R) Image FrameWork software (http://www.tarosoft.in.th/), and the measurements were provided as minimum–maximum values and average values. The photographic plates were edited and provided by using Adobe Photoshop CC 2018 (Adobe Systems, USA) software.

Single spore isolation was performed to obtain pure cultures following the methods described in Senanayake et al. (2020). Germinating spores were photographed, transferred to potato dextrose agar (PDA), and then incubated under the dark at 27 °C to obtain a pure culture, which were photographed to record the different characters. After a week, hyphal tips were transferred into PDA plates and grown at 27 °C in the dark.

Dried herbarium specimens and living cultures were preserved at the Mycological Herbarium of Zhongkai University of Agriculture and Engineering (MHZU) and Zhongkai University of Agriculture and Engineering (ZHKUCC), China. Duplicates of holotypes and type cultures were deposited at the Herbarium of Guizhou Medical University, Guiyang, China (GMB) and Guizhou Medical University Culture Collection (GMBCC) in Guiyang, China. Index Fungorum identifiers (2023) were obtained for the newly introduced taxa.

In the text, the following abbreviations are used: n = a number of ascospores/asci/conidiogenous cells/conidiophores/conidia measured from a given number of specimens, x̄¯ = arithmetical average of sizes of all ascospores/asci/conidiogenous cells/conidia.

DNA extraction, PCR amplification and sequencing

Fresh cultures were grown on PDA in the dark at 27 °C for 15–30 days. The genomic DNA of the fungus was extracted from fresh cultures according to the specifications of the Biospin Fungal Genomic DNA Extraction Kit (bioflux ®). Both forward and reverse primers were used for the amplification of internal transcribed spacers (ITS), large subunit rDNA (LSU), small subunit rDNA (SSU), translation elongation factor 1-α (tef1-α) and RNA polymerase II second largest subunit (rpb2) regions are listed in Table 1. A final volume of polymerase chain reaction (PCR) was prepared, including 1 μl of DNA template, 1 μl of each forward and reverse primer, 12.5 μl of 2 × taq PCR Master Mix and 9.5 μl of double-distilled water (ddH₂O) as described by Dai et al. (2022). The PCR thermal cycling procedure for amplifying ITS, LSU, SSU, tef1-α and rpb2 regions was run under the conditions presented in Table 2. The PCR products were sent to Shanghai Sangon Biological Engineering Technology & Services Co. (Shanghai, People’s Republic of China) for sequencing. All newly generated sequences were deposited in GenBank and accession numbers were obtained.

Table 1.

Forward and reverse primers information of ITS, LSU, SSU, tef1-α and rpb2 regions.

Locus	Primers	Reference
ITS	Forward: ITS5 TCCTCCGCTTATTGATATGC	White et al. (1990)
ITS	Reverse: ITS4 GGAAGTAAAAGTCGTAACAAGG	White et al. (1990)
LSU	Forward: LROR GTACCCGCTGAACTTAAGC	Vilgalys and Hester (1990)
LSU	Reverse: LR5 ATCCTGAGGGAAACTTC	Vilgalys and Hester (1990)
SSU	Forward: NS1 GTAGTCATATGCTTGTCTC	White et al. (1990)
SSU	Reverse: NS4 CTTCCGTCAATTCCTTTAAG	White et al. (1990)
tef1-α	Forward: EF1-983F	Rehner and Buckley (2005)
	GCYCCYGGHCAYCGTGAYTTYAT
	Reverse: EF1-2218R
	ATGACACCRACRGCRACRGTYTG
rpb2	Forward: fRPB2-5f GAYGAYMGWGATCAYTTYGG	Liu et al. (1999)
rpb2	Reverse: fRPB2-7cr CCCATRGCTTGTYYRCCCAT	Liu et al. (1999)

Open in a new tab

Table 2.

The PCR thermal cycling procedure for amplifying ITS, LSU, SSU, tef1-α, and rpb2 regions.

ITS, LSU, SSU and tef1-α	Initial denaturation 95 °C for 5 min. Followed by 35 cycles, denaturation at 95 °C for 30 s, annealing at 55 °C for 50 s, elongation at 72 °C for 90 s. Final extension at 72 °C for 10 min	Dai et al. (2022)
rpb2	Initial denaturation 95 °C for 3 min. Follow by 35 cycles, elongation at 94 °C for 1 min, annealing at 52 °C for 50 s, elongation at 72 °C for 1 min. Final extension at 72 °C for 10 min	Ma et al. (2022)

Open in a new tab

Phylogenetic analyses

Based on blast similarity and related publications, closely related sequences were downloaded from GenBank (Table 3). Single gene sequence alignment was performed by mafft v.7.215 (http://mafft.cbrc.jp/alignment/server/index.html) (Katoh and Standley 2013), and final improvements were done using BioEdit v.7.0.5.2 (Hall 2004). Alignment of ITS, LSU, SSU, tef1-α and rpb2 regions was combined with MEGA6 version 6.0 (Tamura et al. 2013). The alignment of combined datasets in FASTA format was converted to PHYLIP and NEXUS formats by using ALTER (Alignment Transformation Environment online, http://sing.ei.uvigo.es/ALTER/) (Glez-Peña et al. 2010). The online tool Findmodel (http://www.hiv.lanl.gov/content/sequence/findmodel/findmodel.html) was used to determine the best nucleotide substitution model for each partition data (Dai et al. 2022).

Table 3.

Names, strain numbers, and corresponding GenBank accession numbers of taxa were used in this study.

Taxon	Strain Number	GenBank Accession Numbers
Taxon	Strain Number	ITS	LSU	SSU	tef1-α
*Didymosphaeriaceae*
Alloconiothyriumaptrootii	CBS 980.95^T	JX496121	JX496234	N/A	N/A
A.aptrootii	CBS 981.95	JX496122	JX496235	N/A	N/A
A.encephalarti	CPC: 35980	MN562102	MN567610	N/A	N/A
Austropleosporaarchidendri	MFLUCC 17-2429	MK347757	MK347974	MK347863	MK360044
A.archidendri	MFLU 22-0042	OP058964	OP059055	OP059006	OP135941
Bambusistromadidymosporum	MFLU 15-0057^T	KP761733	KP761730	KP761737	KP761727
B.didymosporum	MFLU 15-0058	KP761734	KP761731	KP761738	KP761728
Bimurianovae-zelandiae	CBS 107.79^T	MH861181	AY016356	AY016338	DQ471087
Chromolaenicolananensis	MFLUCC 17-1473^T	MN325015	MN325003	MN325009	MN335648
C.nanensis	MFLUCC 17-1477	MN325014	MN325002	MN325008	MN335647
C.sapindi	KUMCC 21-0564^T	OP058967	OP059058	OP059009	OP135943
Cylindroaseptosporaleucaenae	MFLUCC 17-2424^T	NR_163333	NG_066310	MK347856	MK360047
C.siamensis	MFLUCC 17-2527^T	MK347760	MK347976	MK347866	MK360048
Deniquelatabarringtoniae	MFLUCC 11-0422^T	NR_111779	NG_042696	JX254656	N/A
Dictyoarthriniumvittalii	NFCCI4249^T	MF406218	MF182395	MF622059	MF182398
D.hydei	SQUCC 13296 ^T	MW077145	N/A	MW077161	MW075771
D.musae	MFLUCC 20-0105^T	MT482323	MT482320	MT482326	MT495602
D.musae	MFLUCC 20-0106	MT482324	MT482321	MT482327	MT495603
D.sacchari	MFLUCC 20-0107	MT482325	MT482322	MT482328	N/A
D.sacchari	CBS 529.73	N/A	MH872479	N/A	N/A
D.thailandicum	KUMCC 21-0664^T	OP058965	OP059056	OP059007	N/A
D.thailandicum	KUMCC 21-0665	OP058966	OP059057	OP059008	OP135942
Didymocreasadasivanii	CBS 438.65^T	MH858658	DQ384103	N/A	N/A
Didymosphaeriarubi-ulmifolii	MFLUCC 14-0023^T	N/A	KJ436586	NG_063557	N/A
D.rubi-ulmifolii	MFLUCC 14-0024	N/A	KJ436585	KJ436587	N/A
Kalmusiaitalica	MFLUCC 14-0560^T	KP325440	KP325441	KP325442	N/A
K.variispora	CBS 121517^T	MH863113	MH874668	N/A	N/A
K.ebuli	CBS 123120^T	KF796674	JN644073	JN851818	N/A
Kalmusibambusatriseptata	MFLUCC 13-0232^T	KY682697	KY682695	KY682696	N/A
Karstenulalancangensis	KUMCC 21-0670^T	OP058969	OP059060	OP059011	N/A
K.lancangensis	KUMCC 21-0677	OP058970	OP059061	OP059012	N/A
Laburnicolahawksworthii	MFLUCC 13-0602^T	KU743194	KU743195	KU743196	N/A
L.muriformis	MFLUCC 14-0921^T	KU743200	KU743201	KU743202	N/A
Letendraeacordylinicola	MFLUCC 11-0150	KM213996	KM213999	KM214002	N/A
L.cordylinicola	MFLUCC 11-0148^T	NR_154118	NG_059530	KM214001	N/A
Montagnuladonacina	KUMCC 21-0653	OP058961	OP059052	OP059003	OP135938
M.thailandica	MFLUCC 17-1508^T	MT214352	NG070949	NG070158	MT235774
Neokalmusiabrevispora	KT 1466^T	LC014573	AB524600	AB524459	AB539112
N.scabrispora	KT 1023	LC014575	AB524593	AB524452	AB539106
Neptunomycesaureus	CMG12^T	MK912121	N/A	N/A	MK948000
Paracamarosporiumfagi	CPC 24890	KR611886	KR611904	N/A	N/A
P.fagi	CPC 24892^T	KR611887	KR611905	N/A	N/A
P.anthostomoides	MFLU 16-0172^T	KU743206	KU743207	KU743208	N/A
Paraphaeosphaeriarosae	MFLUCC 17-2547	MG828935	MG829044	MG829150	MG829222
P.rosae	MFLUCC 17-2549^T	MG828937	MG829046	MG829152	MG829223
Phaeodothiswinteri	CBS 182.58	N/A	GU301857	GU296183	N/A
Pseudocamarosporiumpropinquum	MFLUCC 13-0544	KJ747049	KJ813280	KJ819949	N/A
P.pteleae	MFLUCC 17-0724^T	NR_157536	MG829061	MG829166	MG829233
Pseudopithomycesentadae	MFLUCC 17-0917^T	N/A	NG_066305	MK347835	MK360083
P.rosae	MFLUCC 15-0035^T	MG828953	MG829064	MG829168	N/A
Septofusisporathailandica	KUMCC 21-0647^T	OP058971	OP059062	OP059013	OP135945
S.thailandica	KUMCC 21-0652	OP058972	OP059063	OP059014	N/A
Spegazziniabromeliacearum	URM 8084^T	MK804501	MK809513	N/A	N/A
S.camelliae	WNA03	MZ538526	MZ538560	N/A	MZ567102
S.camelliae	CMU328^T	MH734522	MH734521	MH734523	MH734524
S.deightonii	MFLUCC 20-0002^T	MN956768	MN956772	MN956770	MN927133
S.intermedia	CBS 249.89^T	MH862171	MH873861	N/A	N/A
S.jinghaensis	KUMCC 21-0495^T	OP058973	OP059064	OP059015	OP135946
S.jinghaensis	KUMCC 21-0496	OP058974	OP059065	OP059016	OP135947
S.lobulata	CBS 361.58^T	MH857812	MH869344	N/A	N/A
S.musae	MFLUCC 20-0001^T	MN930512	MN930514	MN930513	MN927132
S.neosundara	MFLUCC 15-0456^T	KX965728	KX954397	KX986341	N/A
S.radermacherae	MFLUCC 17-2285^T	MK347740	MK347957	MK347848	MK360088
S.tessarthra	SH 287	JQ673429	AB807584	AB797294	AB808560
*S.zhujiangyuanensis*	ZHKUCC 23-1020^T	PP060498	PP060512	PP060504	PP035539
*S.zhujiangyuanensis*	GMBCC1002	PP067151	PP067156	PP066043	PP068812
Tremateiaarundicola	MFLU 16-1275^T	KX274241	KX274248	KX274254	KX284706
T.guiyangensis	GZAAS01^T	KX274240	KX274247	KX274253	KX284705
T.murispora	GZCC 18-2787^T	NR_165916	MK972751	MK972750	MK986482
Verrucoconiothyriumnitidae	CBS 119209	EU552112	EU552112	N/A	N/A
Xenocamarosporiumacaciae	CBS 139895^T	NR_137982	NG_058163	N/A	N/A
X.acaciae	MFLUCC 17-2432	MK347766	MK347983	MK347873	MK360093
*Phaeoseptaceae*
Alfoldiavorosii	CBS 145501^T	JN859336	MK589354	MK589346	MK599320
Amorocoelophomacassiae	MFLUCC 17-2283^T	NR_163330	NG_066307	NG_065775	MK360041
Angustimassarinaacerina	MFLUCC 14-0505^T	NR_138406	KP888637	NG_063573	KR075168
A.populi	MFLUCC 13-0034^T	KP899137	KP888642	NG_061204	KR075164
A.quercicola	MFLUCC 14-0506^T	KP899133	KP888638	NG_063574	KR075169
Crassiclypeusaquaticus	CBS 143643^T	LC312501	LC312530	LC312472	LC312559
Decaisnellaformosa	BCC 25616	N/A	GQ925846	GQ925833	GU479851
D.formosa	BCC 25617	N/A	GQ925847	GQ925834	GU479850
Forliomycesuniseptata	MFLUCC 15-0765^T	NR_154006	NG_059659	NG_061234	KU727897
Gloniopsispraelonga	CBS 112415	N/A	FJ161173	FJ161134	FJ161090
Guttulisporacrataegi	MFLUCC 13-0442^T	KP899134	KP888639	KP899125	KR075161
Halotthiaposidoniae	BBH 22481	N/A	GU479786	GU479752	N/A
Hysteriumangustatum	MFLUCC 16-0623	N/A	FJ161180	GU397359	FJ161096
Lignosphaeriafusispora	MFLUCC 11-0377^T	NR_164233	KP888646	N/A	N/A
Mauritianarhizophorae	BCC 28866	N/A	GU371824	GU371832	GU371817
Misturatosphaeriaaurantiacinotata	GKM 1238^T	N/A	NG_059927	N/A	GU327761
Phaeoseptumaquaticum	CBS 123113^T	KY940803	JN644072	N/A	N/A
P.carolshearerianum	NFCCI-4221^T	MK307810	MK307813	MK307816	MK309874
P.carolshearerianum	NFCCI-4384	MK307812	MK307815	MK307818	MK309876
P.hydei	MFLUCC 17-0801^T	MT240622	MT240623	MT240624	MT241506
P.mali	MFLUCC 17-2108^T	MK659580	MK625197	N/A	MK647990
P.manglicola	NFCCI-4666^T	MK307811	MK307814	MK307817	MK309875
P.terricola	MFLUCC 10-0102^T	MH105778	MH105779	MH105780	MH105781
P.thailandicum	MFLU 19-2136	OM293749	OR211590	OM293755	OM305059
P.thailandicum	HKAS 106993	OM293750	OM293745	OM293756	OM305060
*P.zhujiangyuanense*	ZHKUCC 23-1022^T	PP060500	PP060514	PP060506	PP035541
*P.zhujiangyuanense*	GMBCC1003	PP067152	PP067157	PP066044	PP068813
Platystomumcrataegi	MFLUCC 14-0925^T	KT026117	KT026109	KT026113	KT026121
Pleopunctumellipsoideum	MFLUCC 19-0390^T	MK804512	MK804517	MK804514	MK828510
P.pseudoellipsoideum	MFLUCC 19-0391^T	MK804513	MK804518	N/A	MK828511
Pseudoaurantiascomakenyense	GKM 1195^T	N/A	NG_059928	N/A	GU327767
P.cornisporum	CBS 143654^T	LC312515	LC312544	LC312486	LC312573
Ramusculicolathailandica	MFLUCC 13-0284^T	KP899141	KP888647	KP899131	KR075167
Sporormurisporaatraphaxidis	MFLUCC 17-0742^T	NR_157546	NG_059880	NG_061296	N/A
Sulcosporiumthailandicum	MFLUCC 12-0004^T	MG520958	KT426563	KT426564	N/A
Teichosporamelanommoides	CBS 140733^T	NR_154632	KU601585	N/A	KU601610
T.pusilla	CBS 140731^T	NR_154633	KU601586	N/A	KU601605
T.rubriostiolata	CBS 140734^T	NR_154634	KU601590	N/A	KU601609
Thyridariamacrostomoides	GKM 1033	N/A	GU385190	N/A	GU327776
T.macrostomoides	GKM 1159	N/A	GU385185	N/A	GU327778
T.macrostomoides	GKM 224N	N/A	GU385191	N/A	GU327777
Vaginatisporaappendiculata	MFLUCC 16-0314^T	KU743217	KU743218	KU743219	KU743220
Westerdykellaornata	CBS 379.55	AY943045	GU301880	GU296208	GU349021
*Synnemasporellaceae*
Apiosporopsiscarpinea	CBS 771.79	N/A	AF277130	N/A	N/A
Apiosporopsis sp.	Masuya 11Af2-1	N/A	AB669034	N/A	N/A
Apoharknessiainsueta	CBS 111377^T	JQ706083	AY720814	N/A	N/A
A.insueta	CBS 114575	N/A	AY720813	N/A	N/A
A.asterospermum	CBS 112404	N/A	AB553745	N/A	N/A
A.asterospermum	KT2138	N/A	AB553744	N/A	N/A
Auratiopycnidiellatristaniopsidis	CBS 132180	JQ685516	JQ685522	N/A	N/A
Cainiellajohansonii	Kruys 731	N/A	JF701920	N/A	N/A
Chapeckianigrospora	AR 3809	JF681957	EU683068	N/A	N/A
Chiangraiomycesbauhiniae	MFLUCC 17-1669^T	MF190118	MF190064	N/A	MF377604
C.bauhiniae	MFLUCC 17-1670	MF190119	MF190065	N/A	MF377603
Chrysocryptacorymbiae	CBS 132528	JX069867	JX069851	N/A	N/A
C.koreana	CBS 143.97	KX833584	AF408378	KX833684	KX833490
C.straminea	CBS 149.22	AY339348	AF362569	KX833704	KX833506
C.wangiensis	CBS 132530	JX069873	JX069857	KX833705	KX833509
Coryneumumbonatum	AR 3541	N/A	EU683072	N/A	N/A
C.umbonatum	MFLUCC 15-1110	MF190121	MF190067	N/A	MF377610
C.umbonatum	MFLUCC 13-0658^T	MF190120	MF190066	N/A	MF377609
Cryphonectriamacrospora	CBS 109764	EU199182	AF408340	N/A	EU220029
C.parasitica	ATCC 38755	AY141856	EU199123	EU222014	DQ862017
Cryptodiaportheaesculi	CBS 109765	DQ323530	AF408342	GU354004	EU199138.2
C.aesculi	CBS 121905	EU254994	EU255164	DQ313558	EU219269
C.betulae	CBS 109763	EU199180	AF408375	EU221884	EU199139
C.hypodermia	AR 3552	EU199181	AF408346	N/A	EU199140
C.suffusa	CBS 109750	EU199207	AF408376	EU221945	EU199163
Cytosporaelaeagni	CFCC 89633	KF765677	KF765693	KU710919	KU710956
C.leucostoma	CFCC 50468	KT732949	KT732968	N/A	N/A
Dendrostomamali	CFCC 52102^T	MG682072	MG682012	MG682052	MG682032
D.osmanthi	CFCC 52106^T	MG682073	MG682013	MG682053	MG682033
D.quercinum	CFCC 52103^T	MG682077	MG682017	MG682057	MG682037
Diaporthedecedens	CBS 109772	KC343059	AF408348	N/A	N/A
D.detrusa	CBS 109770	KC343061	AF408349	KC343787	N/A
D.eres	CBS 109767	KC343075	AF408350	KC343801	N/A
Diaporthellacorylina	CBS 121124	KC343004	N/A	N/A	N/A
Diaporthella sp.	CN 5	KP205483	N/A	N/A	N/A
Diaporthella sp.	CN13	KP205484	N/A	N/A	N/A
Diaporthosporellacercidicola	CFCC 51994^T	KY852492	KY852515	N/A	N/A
D.cercidicola	CFCC 51995	KY852493	KY852516	N/A	N/A
Diaporthostomamachili	CFCC 52100^T	MG682080	MG682020	MG682060	MG682040
D.machili	CFCC 52101	MG682081	MG682021	MG682061	MG682041
Disculoideseucalypti	CPC 17650	JQ685517	JQ685523	N/A	N/A
D.eucalyptorum	CBS 132184	NR_120090	JQ685524	N/A	N/A
Ditopelladitopa	CBS 109748	EU199187	EU199126	N/A	EU199145
Erythrogloeumhymenaeae	CPC 18819	JQ685519	JQ685525	N/A	N/A
G.gnomon	CBS 199.53	AY818956	AF408361	EU221885	EU219295
Harknessiaeucalypti	CBS 342.97	AY720745	AF408363	N/A	N/A
Hercosporatiliae	AR 3526	N/A	AF408365	N/A	N/A
Hyaliappendisporagalii	MFLUCC 16-1208	MF190149	MF190095	N/A	N/A
Juglanconisappendiculata	D96	KY427139	KY427139	KY427208	KY427189
J.juglandina	ME23	KY427150	KY427150	KY427219	KY427200
J.oblonga	ME14	KY427151	KY427151	KY427220	KY427201
J.pterocaryae	ME20	KY427155	KY427155	KY427224	KY427205
Lamproconiumdesmazieri	MFLUCC 14-1047	KX430132	KX430133	MF377592	N/A
L.desmazieri	MFLUCC 15-0870	KX430134	KX430135	MF377591	MF377605
Lasmenia sp.	CBS 124123	GU797406	JF838338	N/A	N/A
Lasmenia sp.	CBS 124124	JF838336	JF838341	N/A	N/A
Luteocirrhusshearii	CBS 130776	NR_120254	NG_042770	N/A	N/A
Macrohilumeucalypti	CPC 19421^T	KR873244	KR873275	N/A	N/A
Melanconiellaellisii	BPI 878343	JQ926271	JQ926271	JQ926406	JQ926339
M.spodiaea	MSH	JQ926298	JQ926298	JQ926431	JQ926364
Melanconisbetulae	CFCC 50471	KT732952	KT732971	KT733001	KT732986
M.itoana	CFCC 50474	KT732955	KT732974	KT733004	KT732987
M.marginalis	CBS 109744	EU199197	AF408373	EU221991	EU219301
M.stilbostoma	CFCC 50475	KT732956	KT732975	KT733005	KT732988
Nakataeaoryzae	CBS 243.76	KM484861	DQ341498	N/A	N/A
Ophiodiaporthecyatheae	YMJ1364	JX570889	JX570891	N/A	JX570893
Pachytrypeprinceps	Rogers S	N/A	FJ532382	N/A	N/A
P.rimosa	FF1066	N/A	FJ532381	N/A	N/A
Paradiaportheartemisiae	MFLUCC 14-0850	MF190155	MF190100	N/A	N/A
P.artemisiae	MFLUCC 17-1663	MF190156	MF190101	N/A	N/A
Phaeoappendisporathailandensis	MFLUCC 13-0161	MF190157	MF190102	N/A	MF377613
Phaeodiaportheappendiculata	CBS 123821	KF570156	KF570156	N/A	N/A
Phragmoportheconformis	CBS 109783	DQ323527	AF408377	N/A	N/A
Plagiostomaeuphorbiae	CBS 340.78	EU199198	AF408382	N/A	DQ368643
P.salicellum	CBS 109775	DQ323529	AF408345	EU221916	EU199141
Prosopidicolamexicana	CBS 113530	AY720710	N/A	N/A	N/A
P.mexicana	CBS 113529^T	AY720709	KX228354	N/A	N/A
Pseudomelanconiscaryae	CFCC 52110^T	MG682082	MG682022	MG682062	MG682042
P.caryae	CFCC 52111	MG682083	MG682023	MG682063	MG682043
Pseudoplagiostomaeucalypti	CBS 124807	GU973512	GU973606	N/A	N/A
P.eucalypti	CBS 116382	GU973514	GU973608	N/A	N/A
Pyriculariagrisea	Ina168	AB026819	AB026819	N/A	N/A
Rossmaniaukurunduensis	AR 3484	N/A	EU683075	N/A	N/A
Silliaferruginea	CBS 126567	JF681959	EU683076	N/A	N/A
Stegonsporiumpyriforme	CBS 124487	KF570160	KF570160	N/A	KF570190
Stilbosporamacrosperma	CBS 121883	JX517290	JX517299	N/A	KF570196
Sydowiellafenestrans	CBS 125530	JF681956	EU683078	N/A	N/A
Synnemasporellaaculeans	CFCC 52094	MG682086	MG682026	MG682066	MG682046
S.aculeans	CFCC 52095	MG682087	MG682027	MG682067	MG682047
*S.fanii*	ZHKUCC 23-1018^T	PP060496	PP060510	PP035537	PP035545
*S.fanii*	GMBCC1001	PP067150	PP067155	PP068811	PP084097
S.toxicodendri	CFCC 52097^T	MG682089	MG682029	MG682069	MG682049
S.toxicodendri	CFCC 52098	MG682090	MG682030	MG682070	MG682050

Open in a new tab

Note: “T” denotes ex-type. Newly generated sequences are indicated in bold. “N/A”: no data available in GenBank.

Maximum-likelihood (ML) analysis was carried out via the online portal CIPRES Science Gateway v. 3.3 (Miller et al. 2010), using RAxML-HPC v.8 on XSEDE (8.2.12) tool, with the default settings but adapted: the GAMMA nucleotide substitution model and 1000 rapid bootstrap replicates.

Bayesian analysis was performed by MrBayes v. 3.0b4 (Ronquist and Huelsenbeck 2003), and the model of evolution was estimated with MrModeltest v. 2.2 (Nylander 2004). The posterior probabilities (PP) (Rannala and Yang 1996; Zhaxybayeva and Gogarten 2002) were determined by the following Markov chain Monte Carlo sampling (MCMC) in MrBayes v.3.0b4 (Huelsenbeck and Ronquist 2001). Six simultaneous Markov chains were run for 1,000,000 generations, with trees sampled every 100^th generation. The preburn was set to 5 and the run was automatically stopped when the mean standard deviation of the split frequency reached below 0.01 (Maharachchikumbura et al. 2015).

Figtree v. 1.4.0 (http://tree.bio.ed.ac.uksoftware/figtree/) (Rambaut 2006) was used to view tree. Microsoft Office PowerPoint 2016 (Microsoft Inc., Redmond, WA, USA) was used to edit the phylogram, and then convert it to jpg. file by using the Adobe PhotoShop CC 2018 software (Jiang et al. 2021).

Results

Phylogenetic analyses

Phylogenetic analyses of Spegazzinia

The concatenated dataset (ITS, LSU, SSU, and tef1-α regions) contained 74 strains in the sequence analysis, which comprise 2988 characters with gaps. Single gene analysis was carried out and compared with each species, to compare the topology of the tree and clade stability. Two strains of Bambusistromadidymosporum D.Q. Dai & K.D. Hyde (MFLU 15-0057 and MFLU 15-0058) are set as the outgroup taxon. The best-scoring RAxML tree with a final likelihood value of -16559.564563 is presented. The matrix had 838 distinct alignment patterns, with 23.64% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.238369, C = 0.251538, G = 0.273530, T = 0.236562; substitution rates AC = 1.319072, AG = 2.377467, AT = 1.425866, CG = 0.960524, CT = 6.538802, GT = 1.000000; gamma distribution shape parameter alpha = 0.188509 (Fig. 1). GTR+I+G model was selected as the best model based on MrModeltest and was used for the Bayesian analysis. Overall tree topologies based on ML and BI analyses were similar and not significantly different. In the phylogenetic analysis (Fig. 1), our new strains (ZHKUCC 23-1020 (ex-type) and GMBCC1002) belonged to the genus Spegazzinia (Fig. 1). Both strains grouped as the sister clade to Spegazziniajinghaensis G.C. Ren & K.D. Hyde (KUMCC 21-0495 (ex-type) and KMUCC 21-0496), and phylogenetically well-distinct with high statistical values (95% ML and 1 PP; Fig. 1).

Figure 1. — The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, SSU and *tef*1-α) is rooted to *Bambusistromadidymosporum* (MFLU 15-0057 and MFLU 15-0058). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95 are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are noted with “T”.

Phylogenetic analyses of Phaeoseptum

The concatenated dataset (ITS, LSU, SSU, and tef1-α regions) contained 45 strains in the sequence analysis, which comprise 3532 characters with gaps. Single gene analysis was carried out and compared with each species, to contrast the topology of the tree and clade stability. Hysteriumangustatum Pers. (MFLUCC 16-0623) and Gloniopsispraelonga (Schwein.) Underw. & Earle (CBS 112415) were selected as the outgroup taxa. The best-scoring RAxML tree with a final likelihood value of -23164.186742 is presented. The matrix had 1334 distinct alignment patterns, with 25.07% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.241078, C = 0.255689, G = 0.276841, T = 0.226392; substitution rates AC = 1.125548, AG = 2.311485, AT = 1.305084, CG = 1.147813, CT = 6.370520, GT = 1.000000; gamma distribution shape parameter alpha = 0.281773 (Fig. 2). GTR+I+G model was selected as the best model based on MrModeltest and was used for the Bayesian analysis. Overall tree topologies based on ML and BI analyses were similar and not significantly different. In the phylogenetic analysis (Fig. 2), two strains of Phaeoseptumzhujiangyuanense (ZHKUCC 23-1022 (ex-type) and GMBCC1003) formed a monophyletic clade (100% ML, 1.00 PP). This clade formed a sister taxon to Phaeoseptummali Phukhams. & K.D. Hyde (MFLUCC-2108) with 95% ML and 1.00 PP support values.

Figure 2. — The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, SSU and *tef*1-α) is rooted to *Hysteriumangustatum* (MFLUCC 16-0623) and *Gloniopsispraelonga* (CBS 112415). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95 are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are indicated with “T”.

Phylogenetic analyses of Synnemasporella

The concatenated dataset (ITS, LSU, tef1-α and rpb2 regions) contained 97 strains in the sequence analysis, which comprise 2575 characters with gaps. Single gene analysis was carried out and compared with each species, to compare the topology of the tree and clade stability. Nakataeaoryzae (Catt.) J. Luo & N. Zhang (CBS 243.76) and Pyriculariagrisea Cooke ex Sacc. (Ina168) are set as the outgroup taxa. The best-scoring RAxML tree with a final likelihood value of -30093.037277 is presented. The matrix had 1256 distinct alignment patterns, with 32.60% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.248601, C = 0.250906, G = 0.280824, T = 0.219669; substitution rates AC = 1.521472, AG = 3.435591, AT = 1.966143, CG = 1.205529, CT = 7.891750, GT = 1.000000; gamma distribution shape parameter alpha = 0.244582 (Fig. 3). GTR+I+G model was selected as the best model based on MrModeltest and was used for the Bayesian analysis. Overall tree topologies based on ML and BI analyses were similar and not significantly different. In the phylogenetic analysis (Fig. 3), our collection of Synnemasporellafanii (ZHKUCC 23-1018 (ex-type) and GMBCC1001) resided in the genus Synnemasporella and formed a sister clade to S.toxicodendri (CFCC 52097 (ex-type) and CFCC 52098) with moderate support (ML 68% and 0.95 PP).

Figure 3. — The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, *tef*1-α and *rpb*2) is rooted to *Nakataeaoryzae* (CBS 243.76) and *Pyriculariagrisea* (Ina168). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95, are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are indicated with “T”.

Taxonomy

Class Dothideomycetes O.E. Erikss. & Winka

Subclass Dothideomycetidae P.M. Kirk, P.F. Cannon, J.C. David & Stalpers ex C.L. Schoch, Spatafora, Crous & Shoemaker

Pleosporales Luttrell ex M.E. Barr

Didymosphaeriaceae Munk

. Spegazzinia

Sacc.

531AFDB6-2E37-54EE-8588-2A8F48DEF67B

Index Fungorum: IF9963

Notes.

The genus Spegazzinia was introduced by Saccardo (1880) with S.ornata (current name: S.tessarthra (Berk. & M.A. Curtis) Sacc. 1886 fideSaccardo 1886) as the type species. Initially, based on morphological characters with basauxic conidiogenesis, Spegazzinia was accommodated in Apiosporaceae, Sordariomycetes (Hyde et al. 1998). However, Tanaka et al. (2015) transferred Spegazzinia to Didymosphaeriaceae (Dothideomycetes) based on molecular data. Morphologically, species of Spegazzinia have a distinctive conidiophore ontogeny, as well as two types of conidia: α conidia are composed of 4–8 subglobose, dark cells with long spines, while β conidia are generally subspherical or broadly ellipsoid, flattened in one plane, cruciately septate or muriform, pale brown and smooth-walled (Samarakoon et al. 2020). Currently, 17 epithets are listed in Species Fungorum 2024 (accession date: 31 May 2024). Our new collection morphologically resembles Spegazzinias. str. and multi-locus phylogenetic analyses confirmed that it is a novel species.

. Spegazzinia zhujiangyuanensis

G.Q. Zhang, Wijayaw., & D.Q. Dai sp. nov.

3285B00B-2973-53D1-A45D-453E3AD9D6BA

Index Fungorum: IF901550

Fig. 4

Figure 4. — *Spegazziniazhujiangyuanensis* (MHCU 23-0273, holotype) **a, b** fungal colonies on the host surface **c–f** conidiophore of α conidia and α conidia **g, h** α conidia i germinated α conidium **j–m** β conidia **n, o** culture characters on pda (n above o below). Scale bars: 150 μm (b); 25 μm (c); 20 μm (**d–f**); 15 μm (**g–m**).

Etymology.

Named after the locality from where it was collected, Zhujiangyuan, Yunnan (China).

Holotype.

MHCU 23-0273.

Description.

Saprobic on twigs of an unknown woody plant. Sexual morph: undetermined. Asexual morph: Hyphomycetous. Conidiomata sporodochia, powdery, dark, dense, 0.2–2 mm in diam. Conidiogenous cells 7–12 µm high × 2.5–6 µm wide (x̄¯ = 9.5 × 3.5 µm; n = 10), basauxic, ampulate, subspherical, hyaline-to-light-brown, rough at surface. Conidiophores of α conidia up to 32.5–142.5 × 1.5–3.5 µm (x̄¯ = 82.5 × 2.5 µm, n = 20), erect or flexuous, unbranched, dark brown. Conidiophores of β conidia 14.5–19 × 2.0–2.3 µm (x̄¯ = 16.3 × 2.1 µm; n = 20), short, erect, unbranched, sub-hyaline or light brown. Conidia two types; α conidia 17.5–25 × 15.5–26 µm (x̄¯ = 20.5 × 19.7 µm; n = 20), 4-celled, stellate-shaped, brown to dark-brown, globose to subglobose, with dark brown warts on the surface of some cells, with conspicuous spines, constricted at septa, 3.6–8 × 1–2.8 µm (x̄¯ = 5.3 × 1.7 µm; n = 20); β conidia 12.2–16 × 12–17 µm (x̄¯ = 14.1 × 14.6 µm; n = 20), 4-celled, disc-shaped, quadrangular or subspherical, pale brown at immaturity, becoming brown to dark-brown at maturity, usually attached with conidiogenous cells when detached from the conidiophore, each cell cruciately septate, turbinate, sometimes verrucose around the edges, deeply constricted at septa, flat from side view.

Culture characteristics.

Conidia germinating on PDA within 24 h. Colonies growing on PDA, reaching reached 30–40 mm diam. After 14 days at 27 °C, superficial, circular, curled, producing concentric circles after 3 weeks, gradually turning brownish gray to white from middle to edge, entire white margin, periphery white at the immature stage, reverse yellowish-brown.

Material examined.

China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Dong-Qin Dai, QJNU 09 (MHCU 23-0273, holotype), ex-type ZHKUCC 23-1016; Ibid. (GMB 1002, isotype), ex-isotype GMBCC1002.

GenBank numbers.

Ex-type (ZHKUCC 23-1020): PP060498 (ITS); PP060512 (LSU); PP060504 (SSU); PP035539 (tef1-α), ex-isotype (GMBCC1002): PP067151 (ITS); PP067156 (LSU); PP066043 (SSU); PP068812 (tef1-α).

Notes.

Phylogenetic analyses based on ITS, LSU, SSU, and tef1-α gene regions showed that our new strains (ZHKUCC 23-1020 (ex-type) and GMBCC1002) belonged to the genus Spegazzinia (Fig. 1). Both strains grouped as the sister clade to S.jinghaensis (KUMCC 21-0495 (ex-type) and KMUCC 21-0496), but phylogenetically found distinct with high statistical values (95% ML bootstrap and 1.00 PP) (Fig. 1). Morphological differences between the new taxon and S.jinghaensis are listed in Table 4. Therefore, based on both morpho-molecular results, we herein introduce a new species in the genus, Spegazziniazhujiangyuanensis.

Table 4.

Diagnostic characters of Spegazziniajinghaensis and S.zhujiangyuanensis.

Morphological character	Species name and reference
Morphological character	Spegazziniajinghaensis (Ren et al. 2022)	S.zhujiangyuanensis (This study)
Conidiomata	Sporodochial, velvety, 2–3 mm in diam.	Sporodochial, 0.2–2 mm in diam
Conidiogenous cells	5–6 µm long × 4–5 µm wide	7–12 µm long × 2.5–6 µm wide, rough surface
Conidiophores of α conidia	80–120 × 1.4–2 µm, unbranched, dark brown	32.5–142.5 × 1.5–3.5 µm, unbranched, rough surface
Conidiophores of β conidia	3.5–8 × 2.5–3.5 µm short, erect, unbranched, sub-hyaline or light brown	14.5–19 × 2–2.3 µm, short, erect, unbranched, sub-hyaline or light brown
Culture characters	Rough surface, reverse black	With entire white margin, curled, reverse yellowish-brown

Open in a new tab

Phaeoseptaceae S. Boonmee, Thambug. & K.D. Hyde

. Phaeoseptum

Ying Zhang, J. Fourn. & K.D. Hyde

F275368B-9DF8-5CDA-A403-DE699BCA7ABC

Index Fungorum: IF561889

Notes.

Zhang et al. (2013) introduced Phaeoseptum with P.aquaticum Ying Zhang, J. Fourn. & K.D. Hyde as the type species. There are seven Phaeoseptum epithets listed in Species Fungorum (31 May 2024). Phaeoseptum is characterized by immersed ascomata, cellular pseudoparaphyses, bitunicate, fissitunicate clavate, 8-spored asci, and broadly fusiform, muriform, medium brown coloured, ascospores (Zhang et al. 2013; Phukhamsakda et al. 2019). Our new collection morphologically resembles Phaeoseptums. str. The phylogenetic study confirmed that the new collection represents a new species of Phaeoseptum (Fig. 2).

. Phaeoseptum zhujiangyuanense

G.Q. Zhang, Wijayaw., & D.Q. Dai sp. nov.

F260ABB0-3241-5D66-A120-C874361B1853

Index Fungorum: IF901551

Fig. 5

Figure 5. — *Phaeoseptumzhujiangyuanense* (MHCU 23-0275, holotype) **a–c** appearance of ascomata on host substrate **d, e** vertical section of ascoma f ostiole g peridium **h–k** asci l pseudoparaphyses m germinated ascospore **n–q** ascospores **r, s** colonies on PDA (r above s below). Scale bars: 300 μm (**a–c**); 200 μm (**d, e**); 50 μm (**f, g, p, q**); 20 μm (**h–o**).

Etymology.

named after the locality from where it was collected, Zhujiangyuan, Yunnan (China).

Holotype.

MHCU 23-0275.

Description.

Saprobic on dead wood branches in terrestrial habitats. Sexual morph: Ascomata 215–470 μm long × 150–320 μm wide (x̄¯ = 340 × 225 µm, n = 20), solitary, scattered, semi-immersed to immersed, globose to subglobose, irregular, clypeate, ostiolate, sometimes erumpent as dark brown to black area from the host tissue, or sometimes with a slit-like opening. Ostiole 33–60 μm high, 15–55 μm diam., short, pale brown. Peridium 25–60 μm (x̄¯ = 44 μm, n = 15) wide, comprising 4–6 layers of cells of textura angularis, with thick-walled and brown cells of outer layers, with thin-walled and hyaline cells of inner layers. Hamathecium composed of 1–1.5 μm (x̄¯ = 1.6 µm, n = 20) wide, numerous, branched, cellular, septate, narrow pseudoparaphyses, anastomosing above the asci, and embedded in a gelatinous matrix. Asci 105–165 × 22–35 μm (x̄¯ = 140 × 30 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical-clavate to elongate-clavate, with a distinct pedicel, apically rounded and thinned, with a distinct ocular chamber at immature stage, with a minute ocular chamber when mature. Ascospores 35–42 × 9–15 μm (x̄¯ = 38 × 10 μm, n = 30), partly overlapping, uniseriate at base, 2–3-seriate above, pale to yellowish brown to medium brown from immaturity to maturity, oblong to broadly fusiform, with broadly rounded ends, slightly curved, with 7–13-transversally septa, and 5–21-vertical septa, rarely 2–5 longitudinal septa in each row, normally 1–2 longitudinal septa, but not all cells with a vertical septum in median, the septa partly pale brown, slightly constricted at septa, smooth-walled. Y-shaped septum present or absent in the end cells, with hyaline to pale brown end cells, Asexual morph: undetermined.

Culture characteristics.

Ascospores germinating on PDA, producing germ tubes from both ends of the ascospores within 24 hours. Colonies growing on PDA, reaching reached 30–40 mm diam. after 14 days at 27 °C, surface pale brown, irregular, curled, producing concentric circles after 3 weeks, reverse warm blackish brown with olive buff at margins.

Material examined.

China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Nalin N. Wijayawardene, RM16 (MHCU 23-0275, holotype), ex-type ZHKUCC 23-1022; Ibid. (GMB 1003, isotype), ex-isotype GMBCC1003.

GenBank numbers.

Ex-type (ZHKUCC 23-1022): PP060500 (ITS); PP060514 (LSU); PP060506 (SSU); PP035541 (tef1-α), ex-isotype (GMBCC1003): PP067152 (ITS); PP067157 (LSU); PP066044 (SSU); PP068813 (tef1-α).

Note.

The phylogenetic analyses based on a combined dataset of ITS, LSU, SSU and tef1-α gene regions (Fig. 2) showed that our isolates (ZHKUCC 23-1022 (ex-type) and GMBCC1003) placed in the genus Phaeoseptum in Didymosphaeriaceae (Fig. 2). Phaeoseptumzhujiangyuanense clusters with P.manglicola (NFCCI-4666) and P.mali (MFLUCC-2108) with significant support (ML 100% and 1.00 PP). Morphologically, P.zhujiangyuanense, P.manglicola Devadatha, V.V. Sarma & E.B.G. Jones and P.mali share similar characteristics in their ascomata, asci and ascospores, and in their overlapping dimensions. However, P.zhujiangyuanense is distinguishable from P.mali and P.manglicola in some characters, as shown in Table 5. Therefore, based on both morphological and phylogenetic evidences, we established this novel species in Phaeoseptum.

Table 5.

Diagnostic characters of Phaeoseptummali, P.manglicola and P.zhujiangyuanense.

Morphological character	Species name and reference
Morphological character	P.mali (Phukhamsakda et al. 2019)	P.manglicola (Dayarathne et al. 2020)	P.zhujiangyuanense (This study)
Ascomata	Globose ascomata	Globose to subglobose or irregular, aggregate to solitary, with ostiolate	Globose to subglobose, scattered, solitary, ostiolate, with slit-like opening
Ostiole	Opened pore, ostiolate with periphyses	28–94 μm high, 39–96 μm diam	33–60 μm high, 15–55 μm diam
Peridium	5–19 µm, composed of 8–11 layers	30– 85 µm, composed 4–6 layers	25–60 μm wide, composed 4–6 layers
Asci	85–190 × 19–32 μm, cylindrical-clavate to elongate-clavate; apically rounded, ocular chamber clearly visible when immature	102–212 × 17–27.5 μm, cylindrical to clavate; apically rounded and thickened; a refractive plate in the ectoascus and a refractive apical plate in the endoascus	105–165 × 22–35 μm, cylindrical-clavate to elongate-clavate; apically rounded and thinned, with a clearly ocular chamber at immature stage
Ascospores	27–38 × 8–13 μm, broad cylindrical, broadly cylindrical, yellowish to dark brown; 11–14 transverse septa, and 1–2 longitudinal septum in each cell	27–36 × 7.5–13 μm, oblong to broadly fusiform, straight, sometimes slightly curved, hyaline, becoming pale brown to yellowish brown; 9–13 transverse septa, 1–2 longitudinal septa in each row	35–42 × 9–15 μm, oblong to broadly fusiform, slightly curved, pale to yellowish brown to brownness; 7–13-transversally septate, 5–21-vertical septate, 1–5 longitudinal septa in each row

Open in a new tab

Sordariomycetes O.E. Erikss. & Winka

Diaporthomycetidae Senan., Maharachch. & K.D. Hyde

Diaporthales Nannf

Synnemasporellaceae X.L. Fan & J.D.P. Bezerra

Fan et al. (2018) introduced this family to accommodate the holomorphic genus, Synnemasporella (with type species S.toxicodendri X.L. Fan & J.D.P. Bezerra). Currently, the family comprises only one genus (Wijayawardene et al. 2022a).

. Synnemasporella

X.L. Fan & J.D.P. Bezerra

244B4403-562E-5341-9B10-9F48C9F1669A

Index Fungorum: IF823995

Notes.

The genus Synnemasporella is a pleomorphic taxon that exhibits both sexual and asexual morphs (Fan et al. 2018). Currently, the genus comprises two species. The asexual morphs of S.aculeans X.L. Fan & J.D.P. Bezerra were reported with both coelomycetous and hyphomycetous morphs (Fan et al. 2018). However, the second species S.toxicodendri was reported only with its hyphomycetous morph.

. Synnemasporella fanii

Wijayaw., G.Q. Zhang & D.Q. Dai sp. nov.

97291E48-5319-5A1A-859F-166DD5549A28

Index Fungorum: IF901552

Fig. 6

Figure 6. — *Synnemasporellafanii* (MHCU 23-0271, holotype) **a, b** habit of synnemata on branches **c, d** longitudinal section of synnemata **e–h** conidiophores and conidiogenous cells i conidiophores showing septa **j–m** conidiogenous cells. **n–p** conidia q germinating conidia **r, s** colony on PDA (r above s below). Scale bars: 2 mm (b); 300 μm (c); 400 μm (d); 10 μm (**e, h**); 20 μm (**f, g**); 15 μm (i); 25 μm (**j–m, q**); 30 μm (**n–p**).

Etymology.

Named after Dr. Xin-Lei Fan, the mycologist who introduced the genus, to recognize his outstanding contribution to mycology in China.

Holotype.

MHCU 23-0271.

Description.

Saprobic on twigs of an unknown woody plant. Sexual morph: undetermined. Asexual morph: hyphomycetous. Conidiomata synnematous. Synnemata 1000–1300 µm high, 110–360 µm diam., long and determinate, pale to brown, straight, occasionally curved, composed of parallelly and compactly arranged conidiophores. Conidiophores 30–70 µm long × 4.5–6.5 µm wide, hyaline to pale brown, aggregated, straight to curved. Conidiogenous cells 1.5–3.5 × 0.5–2.5 µm, enteroblastic, with a minute collarette at the tip, hyaline to pale brown, straight to curved, cylindrical, arranged adjacent to one another at the fertile end of the synnema, with each conidiogenous cells producing one conidium. Conidia 23–37 × 11–17 µm (x̄¯ = 30 × 15 µm, n = 20), cylindrical to oblong-cylindrical, 1–3 septate, slightly constricted at septa, straight to slightly curved, with a discrete hilum, smooth-walled, multiguttulate, pale brown to brown.

Culture characteristics.

Conidia germinating on PDA within 24 h. Colonies growing on PDA, reaching reached 30–40 mm diam. after 14 days at 27 °C, circular, initially white, becoming sepia on the bottom after 7 days, with an irregular edge, texture uniform.

Material examined.

China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Nalin N. Wijayawardene, RM17 (MHCU 23-0271, holotype), ex-type ZHKUCC 23-1018; Ibid. (GMB 1001, isotype), ex-isotype GMBCC1001.

GenBank numbers.

Еx-type (ZHKUCC 23-1018): PP060496 (ITS); PP060510 (LSU); PP035537 (tef1-α); PP035545 (rpb2), ex-isotype (GMBCC1001): PP067150 (ITS); PP067155 (LSU); PP068811 (tef1-α); PP084097 (rpb2).

Note.

The phylogenetic analyses of the combined dataset of ITS, LSU, rpb2 and tef1-α gene regions (Fig. 3) showed that our isolates (ZHKUCC 23-1018 (ex-type) and GMBCC1001) belonged to the genus Synnemasporella (Fig. 3). Synnemasporellafanii clustered with S.toxicodendri (CFCC 52097 (isotype) and CFCC 52098) with moderate statistical supports (ML 68% and 0.95 PP). Morphologically, Synnemasporellafanii shares similar characteristics in its synnemata with S.toxicodendri and S.aculeans. Furthermore, S.fanii can be distinguished from S.toxicodendri and S.aculeans by having 1–3-septate conidia. Besides, in both two species of this genus, the form of the conidiogenous cells cannot be discerned well from Fan et al. (2018); it is not certain whether the two species have enteroblastic conidiogenous cells similar to our strain. The other differences are provided in Table 6. Based on morphology and phylogeny, we established this new collection as a novel species of Synnemasporella.

Table 6.

Comparison of morphological characteristics of Synnemasporella species.

Morphological character	Species name and reference
Morphological character	Synnemasporellaaculeans (Fan et al. 2018)	S.fanii (This study)	S.toxicodendri (Fan et al. 2018)
Synnemata	1100–1500 µm high, 200–400 µm diam., pale to brown, straight to curved, parallel	1000–1300 µm high, 110–360 µm diam., long and determinate, pale to brown, straight, occasionally curved, parallel	1200–1800 µm high, 150–300 µm diam., pale to brown, straight to curved, parallel
Conidiophores	20–30 µm, aggregated, aseptate, straight to curved	30–70 µm long, 4.5–6.5 µm wide, aggregated, septate, straight to curved	20–30 µm, aggregated, aseptate, straight to curved
Conidiogenous cells	Cylindrical, hyaline	Cylindrical, hyaline, enteroblastic, straight to curved	Cylindrical, hyaline
Conidia	8–10(–11) × 3–3.5 µm, oblong-cylindrical, aseptate	23–37 × 11–17 µm, cylindrical to oblong-cylindrical, 1–3 septate, slightly curved	6–8 × 2.5–4 µm, cylindrical to oblong-cylindrical, aseptate
Culture characters	Regular edge; texture initially uniform, producing concentric circle on the margin after 3 days	Irregular edge, circular, initially white, becoming sepia on the bottom after one week	Irregular edge; texture initially uniform, producing concentric circles after 3 weeks

Open in a new tab

Discussion

Zhujiangyuan Nature Reserve in Yunnan Province, China, harbours a large number of native evergreen and deciduous plant species and we predict this region has higher fungal diversity, although many are yet to be discovered (Feng and Yang 2018; Luo et al. 2018; Dai et al. 2019, 2022; Wijayawardene et al. 2021, 2022c). Wijayawardene et al. (2022b) emphasized the importance of collecting materials from under-studied geographical locations as even, some extensively studied hosts could still harbour novel taxa. A few saprobic fungal taxa have been discovered on woody litter in the Zhujiangyuan Nature Reserve but leaf litter inhabiting fungi have been poorly studied in this region. Besides, less attention has been given to saprobic fungi on woody litter in riverine habitats. Thus, a comprehensive study of microfungi in this region is most warranted. Further, morphology-based taxonomic information and phylogenetic sequencing data are needed to clarify their correct taxonomy, phylogeny, and functional biodiversity.

Taxa of Didymosphaeriaceae are often reported as endophytic, pathogenic or saprobic on a wide range of plant hosts (Gonçalves et al. 2019; Hongsanan et al. 2020). Based on the morphology, and phylogenetic analyses, taxa of Didymosphaeriaceae were fairly well-studied and currently, 33 genera have been accepted in Didymosphaeriaceae (Wijayawardene et al. 2022a). However, more new taxa are waiting to be discovered from monotypic genera such as Barria Z.Q. Yuan, Cylindroaseptospora Jayasiri, E.B.G. Jones & K.D. Hyde, Kalmusibambusa Phook., Tennakoon, Thambug. & K.D. Hyde, Lineostroma H.J. Swart, Neptunomyces M. Gonçalves, T. Vicente & A. Alves, Vicosamyces Firmino, A.R. Machado & O.L. Pereira, and Xenocamarosporium Crous & M.J. Wingf. In this study, we introduced a novel species of Spegazzinia, viz., S.zhujiangyuanensis (ZHKUCC 23-1020 (ex-type) and GMBCC1002). Morphologically, our new collections show somewhat similar micro-morphological characters to S.jinghaensis (with indistinguishable conidiomata, conidiogenous cells and conidiophores of α conidia), but can be separated by its conidiophores of β conidia). Phylogenetically, our new strains S.zhujiangyuanensis (ZHKUCC 23-1020 (ex-type) and GMBCC1002) were grouped as the sister clade to S.jinghaensis (KUMCC 21-0495 (ex-type) and KMUCC 21-0496), with distinct, high statistical values (94% ML bootstrap and 1.00 PP) (Fig. 1). Therefore, based on morphological characteristics and phylogenetic evidence (Fig. 1; based on ITS, LSU, SSU, and tef1-α regions), we introduce Spegazziniazhujiangyuanensis as a new species.

Phaeoseptaceae was introduced by Hyde et al. (2018) to accommodate Phaeoseptum (type genus), Lignosphaeria Boonmee, Thambug. & K.D. Hyde, and Neolophiostoma Boonmee & K.D. Hyde. Currently, Phaeoseptaceae comprises only two genera, i.e. Phaeoseptum and Pleopunctum N.G. Liu, K.D. Hyde & J.K. Liu (Wijayawardene et al. 2022a). In this study, we introduce a novel species of Phaeoseptum (Phaeoseptaceae), viz., P.zhujiangyuanense, which shares similar characteristics with P.mali and P.manglicola in their ascomata, asci and ascospore, and their overlapping dimensions, which fit the characters of Phaeoseptum well. However, based on morphological differences (Table 5) and phylogenetic analyses (Fig. 2), our collection can be distinguished from the other known species. Thus, we introduced P.zhujiangyuanense as a novel species in Phaeoseptum.

Synnemasporellaceae was introduced by Fan et al. (2018) to accommodate the genus Synnemasporella. The genus was reported with its both asexual and sexual morphs. The asexual morphs of type species of Synnemasporella, S.toxicodendri was reported with both coelomycetous and hyphomycetous morphs on the same host material (Fan et al. 2018). However, the second species, S.aculeans was reported only with a hyphomycetous morph. However, both species of this genus were not mentioned with the form of conidiogenous cells. In this study, our new species, S.fanii is found with only a hyphomycetous morph, which fits well with the characteristics of Synnemasporella. Synnemasporellafanii shares similarities with S.toxicodendri and S.aculeans in their synnemata but it can be significantly distinguished by their large-sized, 1–3-septate conidia, and possible enteroblastic conidiogenous cells. Synnemasporella is abundant as a hyphomycetous morph but further collections are essential to confirm this assumption.

Supplementary Material

XML Treatment for Spegazzinia

mycokeys.106.123105-treatment1.xml^{(11.5KB, xml)}

XML Treatment for Spegazzinia zhujiangyuanensis

mycokeys.106.123105-treatment2.xml^{(17.1KB, xml)}

XML Treatment for Phaeoseptum

mycokeys.106.123105-treatment3.xml^{(9.3KB, xml)}

XML Treatment for Phaeoseptum zhujiangyuanense

mycokeys.106.123105-treatment4.xml^{(22.9KB, xml)}

XML Treatment for Synnemasporella

mycokeys.106.123105-treatment5.xml^{(4.7KB, xml)}

XML Treatment for Synnemasporella fanii

mycokeys.106.123105-treatment6.xml^{(20KB, xml)}

Acknowledgments

The authors would like to thank Dr. Shaun Pennycook and Prof. Jayarama D. Bhat for their advice on nomenclature and taxonomy respectively.

Citation

Zhang G-Q, Wijayawardene NN, Han L-H, Kumla J, Suwannarach N, Li Q, Elgorban AM, Moussa IM, Coleine C, Dai D-Q (2024) Three novel woody litter inhabiting fungi in Didymosphaeriaceae, Phaeoseptaceae and Synnemasporellaceae from Zhujiangyuan Nature Reserve, Yunnan Province, Republic of China. MycoKeys 106: 173–200. https://doi.org/10.3897/mycokeys.106.123105

Funding Statement

The authors are grateful to High-Level Talent Recruitment Plan of Yunnan Provinces (“Young Talents” Program and “High-End Foreign Experts” Program), Mee-mann Chang Academician Workstation in Yunnan Province, (Grant No. 202205AF150002), and Science and technology plan project of Science and Technology Department of Yunnan Province (Grant No. 202305AC350252, 20210BA070001-076) for support. This work was supported by the Key Laboratory of Yunnan Provincial Department of Education of the Deep-Time Evolution on Biodiversity from the Origion of the Pearl River. Jaturong and Nakarin thank Chiang Mai University for partially support. The authors extend their appreciation to the Researchers supporting Project Number (RSPD2024R741) King Saud University, Riyadh, Saudi Arabia.

Contributor Information

Nalin N. Wijayawardene, Email: nalinwijayawardene@yahoo.com.

Dong-Qin Dai, Email: cicidaidongqin@gmail.com.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

Author contributions

Data curation: LHH. Funding acquisition: AME. Project administration: IMM, QL. Writing – original draft: GQZ. Writing – review and editing: NNW, JK, NS, CC, DQD.

Author ORCIDs

Gui-Qing Zhang https://orcid.org/0000-0001-5354-0607

Nalin N. Wijayawardene https://orcid.org/0000-0003-0522-5498

Li-Hong Han https://orcid.org/0000-0002-6127-0915

Jaturong Kumla https://orcid.org/0000-0002-3673-6541

Nakarin Suwannarach https://orcid.org/0000-0002-2653-1913

Qiang Li https://orcid.org/0000-0002-9735-8214

Abdallah M. Elgorban https://orcid.org/0000-0003-3664-7853

Ihab M. Moussa https://orcid.org/0000-0001-9050-2079

Claudia Coleine https://orcid.org/0000-0002-9289-6179

Dong-Qin Dai https://orcid.org/0000-0001-8935-8807

Data availability

All of the data that support the findings of this study are available in the main text.

References

Dadachova E, Bryan RA, Huang X, Moadel T, Schweitzer AD, Aisen P, Nosanchuk JD, Casadevall A. (2007) Ionizing radiation changes the electronic properties of melanin and enhances the growth of melanized fungi. PLoS One 2(5): 457. 10.1371/journal.pone.0000457 [DOI] [PMC free article] [PubMed] [Google Scholar]
Dai DQ, Wijayawardene NN, Tang LZ, Liu C, Han LH, Chu HL, Wang HB, Liao CF, Yang EF, Xu RF, Li YM, Hyde KD, Bhat JD, Cannon PF. (2019) Rubroshiraia gennova second hypocrellin-producing genus in Shiraiaceae (Pleosporales). MycoKeys 58: 1–26. 10.3897/mycokeys.58.36723 [DOI] [PMC free article] [PubMed] [Google Scholar]
Dai DQ, Wijayawardene NN, Dayarathne MC, Kumla J, Han LS, Zhang GQ, Zhang X, Zhang TT, Chen HH. (2022) Taxonomic and Phylogenetic Characterizations Reveal Four New Species, Two New Asexual Morph Reports, and Six New Country Records of Bambusicolous Roussoella from China. Journal of Fungi (Basel, Switzerland) 8(5): 532. 10.3390/jof8050532 [DOI] [PMC free article] [PubMed] [Google Scholar]
Doilom M, Hyde KD, Dong W, Liao CF, Suwannarach N, Lumyong S. (2021) The plant family Asteraceae is a cache for novel fungal diversity: Novel species and genera with remarkable ascospores in Leptosphaeriaceae. Frontiers in Microbiology 12: 660261. 10.3389/fmicb.2021.660261 [DOI] [PMC free article] [PubMed]
Fan XL, Bezerra JD, Tian CM, Crous PW. (2018) Families and genera of diaporthalean fungi associated with canker and dieback of tree hosts. Persoonia 40(1): 119–134. 10.3767/persoonia.2018.40.05 [DOI] [PMC free article] [PubMed] [Google Scholar]
Feng B, Yang Z. (2018) Studies on diversity of higher fungi in Yunnan southwestern China: A review. Plant Diversity 40(4): 165–171. 10.1016/j.pld.2018.07.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
Glez-Peña D, Gómez-Blanco D, Reboiro-Jato M, Fdez-Riverola F, Posada D. (2010) ALTER: Program-oriented conversion of DNA and protein alignments. Nucleic Acids Research 38: 14–18. 10.1093/nar/gkq321 [DOI] [PMC free article] [PubMed] [Google Scholar]
Gonçalves MF, Vicente TF, Esteves AC, Alves A. (2019) Neptunomycesaureus gen. sp. nov. (Didymosphaeriaceae, Pleosporales) isolated from algae in Ria de Aveiro, Portugal. MycoKeys 60: 31–44. 10.3897/mycokeys.60.37931 [DOI] [PMC free article] [PubMed] [Google Scholar]
Guo T, Tang WJ, Luo Y, Sun Q. (2023) Impact Assessment of the Power Transmission and TransformationProject on the Biodiversity of the Provincial Nature Reserveof the Pearl River Source. Forest Investigation Design 52(3): 52–56+84.
Hall T. (2004) BioEdit. Ibis Therapeutics, Carlsbad, CA, 92008, USA. http://www.mbio.ncsu.edu/BioEdit/bioedit.html [18 Mar 2005]
Hawksworth DL, Lücking R. (2017) Fungal diversity revisited: 2.2 to 3.8 million species. Microbiology spectrum 5(4): 1–17. 10.1128/microbiolspec.FUNK-0052-2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Lücking R, Boonmee S, Bhat DJ, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang SH, Jones EBG, Phillips AJL, Manawasinghe IS, Tibpromma S, Jayasiri SC, Sandamali D, Jayawardena RS, Wijayawardene NN, Ekanayaka AH, Jeewon R, Lu YZ, Phukhamsakda C, Dissanayake AJ, Zeng XY, Luo ZL, Tian Q, Thambugala KM, Dai DQ, Samarakoon MC, Chethana KWT, Ertz D, Doilom M, Liu JK, Pérez-Ortega S, Suija A, Senwanna C, Wijesinghe SN, Konta S, Niranjan M, Zhang SN, Ariyawansa HA, Jiang HB, Zhang JF, Norphanphoun C, de Silva NI, Thiyagaraja V, Zhang H, Bezerra JDP, Miranda-González R, Aptroot A, Kashiwadani H, Harishchandra D, Sérusiaux E, Abeywickrama PD, Bao DF, Devadatha B, Wu HX, Moon KH, Gueidan C, Schumm F, Bundhun D, Mapook A, Monkai J, Chomnunti P, Suetrong S, Chaiwan N, Bhunjun CS, Dayarathne MC, Yang J, Rathnayaka AR, Xu J, Zheng J, Liu G, Feng Y, Xie N. (2020) Refned families of Dothideomycetes: Orders and families incertae. Fungal Diversity 105: 17–318. 10.1007/s13225-020-00462-6 [DOI] [Google Scholar]
Huelsenbeck JP, Ronquist F. (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics (Oxford, England) 17(8): 754–755. 10.1093/bioinformatics/17.8.754 [DOI] [PubMed] [Google Scholar]
Hyde KD, Fröhlich J, Taylor JE. (1998) Fungi from palms XXXVI Reflections on unitunicate ascomycetes with apiospores. Sydowia 50: 21–80. [Google Scholar]
Hyde KD, Chaiwan N, Norphanphoun C, Boonmee S, Camporesi E, Chethana KWT, Dayarathne MC, de Silva NI, Dissanayake AJ, Ekanayaka AH, Hongsanan S, Huang SK, Jayasiri SC, Jayawardena RS, Jiang HB, Karunarathna A, Lin CG, Liu JK, Liu NG, Lu YZ, Luo ZL, Maharachchimbura SSN, Manawasinghe IS, Pem D, Perera RH, Phukhamsakda C, Samarakoon MC, Senwanna C, Shang QJ, Tennakoon DS, Thambugala KM, Tibpromma S, Wanasinghe DN, Xiao YP, Yang J, Zeng XY, Zhang JF, Zhang SN, Bulgakov TS, Bhat DJ, Cheewangkoon R, Goh TK, Jones EBG, Kang JC, Jeewon R, Liu ZY, Lumyong S, Kuo CH, McKenzie EHC, Wen TC, Yan JY, Zhao Q. (2018) Mycosphere notes 169–224. Mycosphere: Journal of Fungal Biology 9(2): 271–430. 10.5943/mycosphere/9/2/8 [DOI] [Google Scholar]
Jiang HB, Phookamsak R, Hyde KD, Mortimer PE, Xu JC, Kakumyan P, Kumla J. (2021) A taxonomic appraisal of bambusicolous fungi in Occultibambusaceae (Pleosporales, Dothideomycetes) with new collections from Yunnan Province, China. Life (Basel, Switzerland) 11(9): 932. 10.3390/life11090932 [DOI] [PMC free article] [PubMed] [Google Scholar]
Katoh K, Standley DM. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
Liu Y, Whelen S, Hall B. (1999) Phylogenetic relationships among Ascomycetes: Evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 16(12): 1799–1808. 10.1093/oxfordjournals.molbev.a026092 [DOI] [PubMed] [Google Scholar]
Luo Z, Hyde KD, Bhat DJ, Jeewon R, Maharachchikumbura SSN, Bao DF, Li WL, Su XJ, Yang XY, Su HY. (2018) Morphological and molecular taxonomy of novel species Pleurotheciaceae from freshwater habitats in Yunnan China. Mycological Progress 17(5): 511–530. 10.1007/s11557-018-1377-6 [DOI] [Google Scholar]
Ma H, Song Z, Pan X, Li Y, Yang Z, Qu Z. (2022) Multi-Gene Phylogeny and Taxonomy of Hypoxylon (Hypoxylaceae, Ascomycota) from China. Diversity 14(1): 37. 10.3390/d14010037 [DOI] [Google Scholar]
Maharachchikumbura SS, Hyde KD, Jones EBG, McKenzie EHC, Huang SK, Abdel-Wahab MA, Daranagama DA, Dayarathne M, Dsouza MJ, Goonasekara ID, Hongsanan S, Jayawardena RS, Kirk PM, Konta S, Liu JK, Liu ZY, Norphanphoun C, Pang KL, Perera RH, Senanayake IC, Shang Q, Shenoy BD, Xiao YP, Bahkali AH, Kang JC, Somrothipol S, Suetrong S, Wen TC, Xu JC. (2015) Towards a natural classification and backbone tree for Sordariomycetes. Fungal Diversity 72(1): 199–301. 10.1007/s13225-015-0331-z [DOI] [Google Scholar]
Miller MA, Pfeiffer W, Schwartz T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop (GCE). New Orleans, LA, USA, 1–8. 10.1109/GCE.2010.5676129 [DOI]
Mueller GM, Schmit JP. (2007) Fungal biodiversity: What do we know? What can we predict? Biodiversity and Conservation 16(1): 1–5. 10.1007/s10531-006-9117-7 [DOI]
Naranjo-Ortiz MA, Gabaldón T. (2019) Fungal evolution: Major ecological adaptations and evolutionary transitions. Biological Reviews of the Cambridge Philosophical Society 94(4): 1443–1476. 10.1111/brv.12510 [DOI] [PMC free article] [PubMed] [Google Scholar]
Niskanen T, Lücking R, Dahlberg A, Gaya E, Suz LM, Mikryukov V, Liimatainen K, Druzhinina I, Westrip JR, Mueller GM, Martins-Cunha K, Kirk P, Tedersoo L, Antonelli A. (2023) Pushing the frontiers of biodiversity research: Unveiling the global diversity, distribution, and conservation of fungi. Annual Review of Environment and Resources 48(1): 149–176. 10.1146/annurev-environ-112621-090937 [DOI] [Google Scholar]
Nylander JAA. (2004) MrModeltest 2.0. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.
Phukhamsakda C, Jeewon R, McKenzie EHC, Xu JC. (2019) Morphology and phylogeny of Phaeoseptummali sp. nov. (Phaeoseptaceae, Pleosporales) on bark of Malushalliana. Asian Journal of Mycology 2(1): 118–128. 10.5943/ajom/2/1/6 [DOI]
Raghukumar C, Raghukumar S. (1998) Barotolerance of fungi isolated from deep-sea sediments of the Indian Ocean. Aquatic Microbial Ecology 15(2): 153–163. 10.3354/ame015153 [DOI] [Google Scholar]
Rambaut A. (2006) FigTree. Tree drawing tool version 1.4.0. University of Edinburgh: Institute of Evolutionary Biology. http://tree.bio.ed.ac.uk/software/figtree/
Rannala B, Yang Z. (1996) Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. Journal of molecular evolution 43: 304–311. 10.1007/BF02338839 [DOI] [PubMed] [Google Scholar]
Rehner SA, Buckley E. (2005) A Beauveria Phylogeny Inferred from Nuclear ITS and EF1-α Sequences: Evidence for Cryptic Diversification and Links to Cordyceps Teleomorphs. Mycologia 97(1): 84–98. 10.3852/mycologia.97.1.84 [DOI] [PubMed] [Google Scholar]
Richards TA, Leonard GU, Wideman JG. (2017) What defines the “kingdom” fungi? The Fungal Kingdom: 57–77. 10.1128/9781555819583.ch3 [DOI] [PMC free article] [PubMed]
Ronquist F, Huelsenbeck JP. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics (Oxford, England) 19(12): 1572–1574. 10.1093/bioinformatics/btg180 [DOI] [PubMed] [Google Scholar]
Saccardo PA. (1880) Fungi Dalmatici pauci ex herb. illustr. R. de Visiani addito uno alterove mycete ex Anglia et Pannonia. Michelia 2(6): 154–176. 10.1017/S0376892900001247 [DOI] [Google Scholar]
Saccardo PA. (1886) Sylloge Hyphomycetum. Sylloge Fungorum 4: 1–807. https://www.biodiversitylibrary.org/item/25421#page/9/mode/1up [Google Scholar]
Samarakoon BC, Phookamsak R, Wanasinghe DN, Chomnunti P, Hyde KD, McKenzie EHC, Promputtha I, Xu JC, Li YJ. (2020) Taxonomy and phylogenetic appraisal of Spegazziniamusae sp. nov and S.deightonii (DidymosphaeriaceaePleosporales) on Musaceae from Thailand. MycoKeys 70: 19–37. 10.3897/mycokeys.70.52043 [DOI] [PMC free article] [PubMed] [Google Scholar]
Senanayake IC, Rathnayaka AR, Marasinghe DS, Calabon MS, Gentekaki E, Wanasinghe DN, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS, Chomnunti P, Boonmee S, Jayawardena RS, Wijayawardene NN, Doilom M, Jeewon R, Bhat JD, Zhang HX, Xie N. (2020) Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere: Journal of Fungal Biology 11(1): 2678–2754. 10.5943/mycosphere/11/1/20 [DOI] [Google Scholar]
Species Fungorum (2024) Species Fungorum-Search Page.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
Tanaka K, Hirayama K, Yonezawa H, Sato G, Toriyabe A, Kudo H, Hashimoto A, Matsumura M, Harada Y, Kurihara Y, Shirouzu T, Hosoya T. (2015) Revision of the Massarineae (Pleosporales, Dothideomycetes). Studies in Mycology 82(1): 75–136. 10.1016/j.simyco.2015.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
Vilgalys R, Hester M. (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8): 4238–4246. 10.1128/jb.172.8.4238-4246.1990 [DOI] [PMC free article] [PubMed] [Google Scholar]
Wang JF. (2014) Research on the Development of Tourism Industry in the Area of Pearl River Sources. Journal of Qujing Normal University 33(02): 6–10. [Google Scholar]
Wang DL, Wu YM, Gao WJ. (2015) Study on the Evolution of Rural Habitat in the Zhujiangyuan Nature reserve. Journal of Anhui Agriculture 43(23): 207–210. [Google Scholar]
White TJ, Bruns T, Lee S, Taylor J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (Eds) PCR Protocols: A guide to methods and applications.Academic Press, San Diego, 315–322. 10.1016/B978-0-12-372180-8.50042-1 [DOI]
Wijayawardene NN, Dissanayake LS, Dai DQ, Xiao YP, Wen TC, Karunarathna SC, Wu HX, Zhang H, Tibpromma S, Kang JC, Wang Y, Shen XC, Tang LZ, Deng CY, Liu YX, Kang YQ. (2021) Yunnan–Guizhou Plateau: A mycological hotspot. Phytotaxa 523(1): 1–31. 10.11646/phytotaxa.523.1.1 [DOI] [Google Scholar]
Wijayawardene NN, Hyde KD, Dai DQ, Sánchez-García M, Goto BT, Saxena RK, Erdoğdu M, Selçuk F, Rajeshkumar KC, Aptroot A, Błaszkowski J, Boonyuen N, da Silva GA, de Souza FA, Dong W, Ertz D, Haelewaters D, Jones EBG, Karunarathna SC, Kirk PM, Kukwa M, Kumla J, Leontyev DV, Lumbsch HT, Maharachchikumbura SSN, Marguno F, Martínez-Rodríguez P, Mešić A, Monteiro JS, Oehl F, Pawłowska J, Pem D, Pfiegler WP, Phillips AJL, Pošta A, He MQ, Li JX, Raza M, Sruthi OP, Suetrong S, Suwannarach N, Tedersoo L, Thiyagaraja V, Tibpromma S, Tkalčec Z, Tokarev YS, Wanasinghe DN, Wijesundara DSA, Wimalaseana SDMK, Madrid H, Zhang GQ, Gao Y, Sánchez-Castro I, Tang LZ, Stadler M, Yurkov A, Thines M. (2022a) Outline of Fungi and fungus-like taxa–2021. Mycosphere: Journal of Fungal Biology 13(1): 53–453. 10.5943/mycosphere/13/1/2 [DOI] [Google Scholar]
Wijayawardene NN, Phillips AJL, Pereira DS, Dai DQ, Aptroot A, Monteiro JS, Druzhinina IS, Cai F, Fan XL, Selbmann L, Coleine C, Castañeda-Ruiz RF, Kukwa M, Flakus A, Fiuza PO, Kirk PM, Kumar KCR, Arachchi ISL, Suwannarach N, Tang LZ, Boekhout T, Tan CSH, Jayasinghe RPPK, Thines M. (2022b) Forecasting the number of species of asexually reproducing fungi (Ascomycota and Basidiomycota). Fungal Diversity 114(1): 463–490. 10.1007/s13225-022-00500-5 [DOI] [Google Scholar]
Wijayawardene NN, Dai DQ, Zhu ML, Wanasinghe DN, Kumla J, Zhang GQ, Zhang TT, Han LS, Tibpromma S, Chen HH. (2022c) Fungi associated with dead branches of Magnoliagrandiflora: A case study from Qujing, China. Frontiers in Microbiology 13: 954680. 10.3389/fmicb.2022.954680 [DOI] [PMC free article] [PubMed]
Zhang Y, Fournier J, Phookamsak R, Bahkali AH, Hyde KD. (2013) Halotthiaceae fam. nov. (Pleosporales) accommodates the new genus Phaeoseptum and several other aquatic genera. Mycologia 105(3): 603–609. 10.3852/11-286 [DOI] [PubMed] [Google Scholar]
Zhaxybayeva O, Gogarten JP. (2002) Bootstrap, Bayesian probability and maximum likelihood mapping: Exploring new tools for comparative genome analyses. BMC Genomics 3(1): 4. 10.1186/1471-2164-3-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Spegazzinia

mycokeys.106.123105-treatment1.xml^{(11.5KB, xml)}

XML Treatment for Spegazzinia zhujiangyuanensis

mycokeys.106.123105-treatment2.xml^{(17.1KB, xml)}

XML Treatment for Phaeoseptum

mycokeys.106.123105-treatment3.xml^{(9.3KB, xml)}

XML Treatment for Phaeoseptum zhujiangyuanense

mycokeys.106.123105-treatment4.xml^{(22.9KB, xml)}

XML Treatment for Synnemasporella

mycokeys.106.123105-treatment5.xml^{(4.7KB, xml)}

XML Treatment for Synnemasporella fanii

mycokeys.106.123105-treatment6.xml^{(20KB, xml)}

Data Availability Statement

All of the data that support the findings of this study are available in the main text.

[B1] Dadachova E, Bryan RA, Huang X, Moadel T, Schweitzer AD, Aisen P, Nosanchuk JD, Casadevall A. (2007) Ionizing radiation changes the electronic properties of melanin and enhances the growth of melanized fungi. PLoS One 2(5): 457. 10.1371/journal.pone.0000457 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] Dai DQ, Wijayawardene NN, Tang LZ, Liu C, Han LH, Chu HL, Wang HB, Liao CF, Yang EF, Xu RF, Li YM, Hyde KD, Bhat JD, Cannon PF. (2019) Rubroshiraia gennova second hypocrellin-producing genus in Shiraiaceae (Pleosporales). MycoKeys 58: 1–26. 10.3897/mycokeys.58.36723 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] Dai DQ, Wijayawardene NN, Dayarathne MC, Kumla J, Han LS, Zhang GQ, Zhang X, Zhang TT, Chen HH. (2022) Taxonomic and Phylogenetic Characterizations Reveal Four New Species, Two New Asexual Morph Reports, and Six New Country Records of Bambusicolous Roussoella from China. Journal of Fungi (Basel, Switzerland) 8(5): 532. 10.3390/jof8050532 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] Doilom M, Hyde KD, Dong W, Liao CF, Suwannarach N, Lumyong S. (2021) The plant family Asteraceae is a cache for novel fungal diversity: Novel species and genera with remarkable ascospores in Leptosphaeriaceae. Frontiers in Microbiology 12: 660261. 10.3389/fmicb.2021.660261 [DOI] [PMC free article] [PubMed]

[B5] Fan XL, Bezerra JD, Tian CM, Crous PW. (2018) Families and genera of diaporthalean fungi associated with canker and dieback of tree hosts. Persoonia 40(1): 119–134. 10.3767/persoonia.2018.40.05 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] Feng B, Yang Z. (2018) Studies on diversity of higher fungi in Yunnan southwestern China: A review. Plant Diversity 40(4): 165–171. 10.1016/j.pld.2018.07.001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] Glez-Peña D, Gómez-Blanco D, Reboiro-Jato M, Fdez-Riverola F, Posada D. (2010) ALTER: Program-oriented conversion of DNA and protein alignments. Nucleic Acids Research 38: 14–18. 10.1093/nar/gkq321 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] Gonçalves MF, Vicente TF, Esteves AC, Alves A. (2019) Neptunomycesaureus gen. sp. nov. (Didymosphaeriaceae, Pleosporales) isolated from algae in Ria de Aveiro, Portugal. MycoKeys 60: 31–44. 10.3897/mycokeys.60.37931 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] Guo T, Tang WJ, Luo Y, Sun Q. (2023) Impact Assessment of the Power Transmission and TransformationProject on the Biodiversity of the Provincial Nature Reserveof the Pearl River Source. Forest Investigation Design 52(3): 52–56+84.

[B10] Hall T. (2004) BioEdit. Ibis Therapeutics, Carlsbad, CA, 92008, USA. http://www.mbio.ncsu.edu/BioEdit/bioedit.html [18 Mar 2005]

[B11] Hawksworth DL, Lücking R. (2017) Fungal diversity revisited: 2.2 to 3.8 million species. Microbiology spectrum 5(4): 1–17. 10.1128/microbiolspec.FUNK-0052-2016 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Lücking R, Boonmee S, Bhat DJ, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang SH, Jones EBG, Phillips AJL, Manawasinghe IS, Tibpromma S, Jayasiri SC, Sandamali D, Jayawardena RS, Wijayawardene NN, Ekanayaka AH, Jeewon R, Lu YZ, Phukhamsakda C, Dissanayake AJ, Zeng XY, Luo ZL, Tian Q, Thambugala KM, Dai DQ, Samarakoon MC, Chethana KWT, Ertz D, Doilom M, Liu JK, Pérez-Ortega S, Suija A, Senwanna C, Wijesinghe SN, Konta S, Niranjan M, Zhang SN, Ariyawansa HA, Jiang HB, Zhang JF, Norphanphoun C, de Silva NI, Thiyagaraja V, Zhang H, Bezerra JDP, Miranda-González R, Aptroot A, Kashiwadani H, Harishchandra D, Sérusiaux E, Abeywickrama PD, Bao DF, Devadatha B, Wu HX, Moon KH, Gueidan C, Schumm F, Bundhun D, Mapook A, Monkai J, Chomnunti P, Suetrong S, Chaiwan N, Bhunjun CS, Dayarathne MC, Yang J, Rathnayaka AR, Xu J, Zheng J, Liu G, Feng Y, Xie N. (2020) Refned families of Dothideomycetes: Orders and families incertae. Fungal Diversity 105: 17–318. 10.1007/s13225-020-00462-6 [DOI] [Google Scholar]

[B13] Huelsenbeck JP, Ronquist F. (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics (Oxford, England) 17(8): 754–755. 10.1093/bioinformatics/17.8.754 [DOI] [PubMed] [Google Scholar]

[B14] Hyde KD, Fröhlich J, Taylor JE. (1998) Fungi from palms XXXVI Reflections on unitunicate ascomycetes with apiospores. Sydowia 50: 21–80. [Google Scholar]

[B15] Hyde KD, Chaiwan N, Norphanphoun C, Boonmee S, Camporesi E, Chethana KWT, Dayarathne MC, de Silva NI, Dissanayake AJ, Ekanayaka AH, Hongsanan S, Huang SK, Jayasiri SC, Jayawardena RS, Jiang HB, Karunarathna A, Lin CG, Liu JK, Liu NG, Lu YZ, Luo ZL, Maharachchimbura SSN, Manawasinghe IS, Pem D, Perera RH, Phukhamsakda C, Samarakoon MC, Senwanna C, Shang QJ, Tennakoon DS, Thambugala KM, Tibpromma S, Wanasinghe DN, Xiao YP, Yang J, Zeng XY, Zhang JF, Zhang SN, Bulgakov TS, Bhat DJ, Cheewangkoon R, Goh TK, Jones EBG, Kang JC, Jeewon R, Liu ZY, Lumyong S, Kuo CH, McKenzie EHC, Wen TC, Yan JY, Zhao Q. (2018) Mycosphere notes 169–224. Mycosphere: Journal of Fungal Biology 9(2): 271–430. 10.5943/mycosphere/9/2/8 [DOI] [Google Scholar]

[B16] Jiang HB, Phookamsak R, Hyde KD, Mortimer PE, Xu JC, Kakumyan P, Kumla J. (2021) A taxonomic appraisal of bambusicolous fungi in Occultibambusaceae (Pleosporales, Dothideomycetes) with new collections from Yunnan Province, China. Life (Basel, Switzerland) 11(9): 932. 10.3390/life11090932 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] Katoh K, Standley DM. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] Liu Y, Whelen S, Hall B. (1999) Phylogenetic relationships among Ascomycetes: Evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 16(12): 1799–1808. 10.1093/oxfordjournals.molbev.a026092 [DOI] [PubMed] [Google Scholar]

[B19] Luo Z, Hyde KD, Bhat DJ, Jeewon R, Maharachchikumbura SSN, Bao DF, Li WL, Su XJ, Yang XY, Su HY. (2018) Morphological and molecular taxonomy of novel species Pleurotheciaceae from freshwater habitats in Yunnan China. Mycological Progress 17(5): 511–530. 10.1007/s11557-018-1377-6 [DOI] [Google Scholar]

[B20] Ma H, Song Z, Pan X, Li Y, Yang Z, Qu Z. (2022) Multi-Gene Phylogeny and Taxonomy of Hypoxylon (Hypoxylaceae, Ascomycota) from China. Diversity 14(1): 37. 10.3390/d14010037 [DOI] [Google Scholar]

[B21] Maharachchikumbura SS, Hyde KD, Jones EBG, McKenzie EHC, Huang SK, Abdel-Wahab MA, Daranagama DA, Dayarathne M, Dsouza MJ, Goonasekara ID, Hongsanan S, Jayawardena RS, Kirk PM, Konta S, Liu JK, Liu ZY, Norphanphoun C, Pang KL, Perera RH, Senanayake IC, Shang Q, Shenoy BD, Xiao YP, Bahkali AH, Kang JC, Somrothipol S, Suetrong S, Wen TC, Xu JC. (2015) Towards a natural classification and backbone tree for Sordariomycetes. Fungal Diversity 72(1): 199–301. 10.1007/s13225-015-0331-z [DOI] [Google Scholar]

[B22] Miller MA, Pfeiffer W, Schwartz T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop (GCE). New Orleans, LA, USA, 1–8. 10.1109/GCE.2010.5676129 [DOI]

[B23] Mueller GM, Schmit JP. (2007) Fungal biodiversity: What do we know? What can we predict? Biodiversity and Conservation 16(1): 1–5. 10.1007/s10531-006-9117-7 [DOI]

[B24] Naranjo-Ortiz MA, Gabaldón T. (2019) Fungal evolution: Major ecological adaptations and evolutionary transitions. Biological Reviews of the Cambridge Philosophical Society 94(4): 1443–1476. 10.1111/brv.12510 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] Niskanen T, Lücking R, Dahlberg A, Gaya E, Suz LM, Mikryukov V, Liimatainen K, Druzhinina I, Westrip JR, Mueller GM, Martins-Cunha K, Kirk P, Tedersoo L, Antonelli A. (2023) Pushing the frontiers of biodiversity research: Unveiling the global diversity, distribution, and conservation of fungi. Annual Review of Environment and Resources 48(1): 149–176. 10.1146/annurev-environ-112621-090937 [DOI] [Google Scholar]

[B26] Nylander JAA. (2004) MrModeltest 2.0. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.

[B27] Phukhamsakda C, Jeewon R, McKenzie EHC, Xu JC. (2019) Morphology and phylogeny of Phaeoseptummali sp. nov. (Phaeoseptaceae, Pleosporales) on bark of Malushalliana. Asian Journal of Mycology 2(1): 118–128. 10.5943/ajom/2/1/6 [DOI]

[B28] Raghukumar C, Raghukumar S. (1998) Barotolerance of fungi isolated from deep-sea sediments of the Indian Ocean. Aquatic Microbial Ecology 15(2): 153–163. 10.3354/ame015153 [DOI] [Google Scholar]

[B29] Rambaut A. (2006) FigTree. Tree drawing tool version 1.4.0. University of Edinburgh: Institute of Evolutionary Biology. http://tree.bio.ed.ac.uk/software/figtree/

[B30] Rannala B, Yang Z. (1996) Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. Journal of molecular evolution 43: 304–311. 10.1007/BF02338839 [DOI] [PubMed] [Google Scholar]

[B31] Rehner SA, Buckley E. (2005) A Beauveria Phylogeny Inferred from Nuclear ITS and EF1-α Sequences: Evidence for Cryptic Diversification and Links to Cordyceps Teleomorphs. Mycologia 97(1): 84–98. 10.3852/mycologia.97.1.84 [DOI] [PubMed] [Google Scholar]

[B32] Richards TA, Leonard GU, Wideman JG. (2017) What defines the “kingdom” fungi? The Fungal Kingdom: 57–77. 10.1128/9781555819583.ch3 [DOI] [PMC free article] [PubMed]

[B33] Ronquist F, Huelsenbeck JP. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics (Oxford, England) 19(12): 1572–1574. 10.1093/bioinformatics/btg180 [DOI] [PubMed] [Google Scholar]

[B34] Saccardo PA. (1880) Fungi Dalmatici pauci ex herb. illustr. R. de Visiani addito uno alterove mycete ex Anglia et Pannonia. Michelia 2(6): 154–176. 10.1017/S0376892900001247 [DOI] [Google Scholar]

[B35] Saccardo PA. (1886) Sylloge Hyphomycetum. Sylloge Fungorum 4: 1–807. https://www.biodiversitylibrary.org/item/25421#page/9/mode/1up [Google Scholar]

[B36] Samarakoon BC, Phookamsak R, Wanasinghe DN, Chomnunti P, Hyde KD, McKenzie EHC, Promputtha I, Xu JC, Li YJ. (2020) Taxonomy and phylogenetic appraisal of Spegazziniamusae sp. nov and S.deightonii (DidymosphaeriaceaePleosporales) on Musaceae from Thailand. MycoKeys 70: 19–37. 10.3897/mycokeys.70.52043 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] Senanayake IC, Rathnayaka AR, Marasinghe DS, Calabon MS, Gentekaki E, Wanasinghe DN, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS, Chomnunti P, Boonmee S, Jayawardena RS, Wijayawardene NN, Doilom M, Jeewon R, Bhat JD, Zhang HX, Xie N. (2020) Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere: Journal of Fungal Biology 11(1): 2678–2754. 10.5943/mycosphere/11/1/20 [DOI] [Google Scholar]

[B38] Species Fungorum (2024) Species Fungorum-Search Page.

[B39] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] Tanaka K, Hirayama K, Yonezawa H, Sato G, Toriyabe A, Kudo H, Hashimoto A, Matsumura M, Harada Y, Kurihara Y, Shirouzu T, Hosoya T. (2015) Revision of the Massarineae (Pleosporales, Dothideomycetes). Studies in Mycology 82(1): 75–136. 10.1016/j.simyco.2015.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] Vilgalys R, Hester M. (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8): 4238–4246. 10.1128/jb.172.8.4238-4246.1990 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] Wang JF. (2014) Research on the Development of Tourism Industry in the Area of Pearl River Sources. Journal of Qujing Normal University 33(02): 6–10. [Google Scholar]

[B43] Wang DL, Wu YM, Gao WJ. (2015) Study on the Evolution of Rural Habitat in the Zhujiangyuan Nature reserve. Journal of Anhui Agriculture 43(23): 207–210. [Google Scholar]

[B44] White TJ, Bruns T, Lee S, Taylor J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (Eds) PCR Protocols: A guide to methods and applications.Academic Press, San Diego, 315–322. 10.1016/B978-0-12-372180-8.50042-1 [DOI]

[B45] Wijayawardene NN, Dissanayake LS, Dai DQ, Xiao YP, Wen TC, Karunarathna SC, Wu HX, Zhang H, Tibpromma S, Kang JC, Wang Y, Shen XC, Tang LZ, Deng CY, Liu YX, Kang YQ. (2021) Yunnan–Guizhou Plateau: A mycological hotspot. Phytotaxa 523(1): 1–31. 10.11646/phytotaxa.523.1.1 [DOI] [Google Scholar]

[B46] Wijayawardene NN, Hyde KD, Dai DQ, Sánchez-García M, Goto BT, Saxena RK, Erdoğdu M, Selçuk F, Rajeshkumar KC, Aptroot A, Błaszkowski J, Boonyuen N, da Silva GA, de Souza FA, Dong W, Ertz D, Haelewaters D, Jones EBG, Karunarathna SC, Kirk PM, Kukwa M, Kumla J, Leontyev DV, Lumbsch HT, Maharachchikumbura SSN, Marguno F, Martínez-Rodríguez P, Mešić A, Monteiro JS, Oehl F, Pawłowska J, Pem D, Pfiegler WP, Phillips AJL, Pošta A, He MQ, Li JX, Raza M, Sruthi OP, Suetrong S, Suwannarach N, Tedersoo L, Thiyagaraja V, Tibpromma S, Tkalčec Z, Tokarev YS, Wanasinghe DN, Wijesundara DSA, Wimalaseana SDMK, Madrid H, Zhang GQ, Gao Y, Sánchez-Castro I, Tang LZ, Stadler M, Yurkov A, Thines M. (2022a) Outline of Fungi and fungus-like taxa–2021. Mycosphere: Journal of Fungal Biology 13(1): 53–453. 10.5943/mycosphere/13/1/2 [DOI] [Google Scholar]

[B47] Wijayawardene NN, Phillips AJL, Pereira DS, Dai DQ, Aptroot A, Monteiro JS, Druzhinina IS, Cai F, Fan XL, Selbmann L, Coleine C, Castañeda-Ruiz RF, Kukwa M, Flakus A, Fiuza PO, Kirk PM, Kumar KCR, Arachchi ISL, Suwannarach N, Tang LZ, Boekhout T, Tan CSH, Jayasinghe RPPK, Thines M. (2022b) Forecasting the number of species of asexually reproducing fungi (Ascomycota and Basidiomycota). Fungal Diversity 114(1): 463–490. 10.1007/s13225-022-00500-5 [DOI] [Google Scholar]

[B48] Wijayawardene NN, Dai DQ, Zhu ML, Wanasinghe DN, Kumla J, Zhang GQ, Zhang TT, Han LS, Tibpromma S, Chen HH. (2022c) Fungi associated with dead branches of Magnoliagrandiflora: A case study from Qujing, China. Frontiers in Microbiology 13: 954680. 10.3389/fmicb.2022.954680 [DOI] [PMC free article] [PubMed]

[B49] Zhang Y, Fournier J, Phookamsak R, Bahkali AH, Hyde KD. (2013) Halotthiaceae fam. nov. (Pleosporales) accommodates the new genus Phaeoseptum and several other aquatic genera. Mycologia 105(3): 603–609. 10.3852/11-286 [DOI] [PubMed] [Google Scholar]

[B50] Zhaxybayeva O, Gogarten JP. (2002) Bootstrap, Bayesian probability and maximum likelihood mapping: Exploring new tools for comparative genome analyses. BMC Genomics 3(1): 4. 10.1186/1471-2164-3-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

﻿Three novel woody litter inhabiting fungi in Didymosphaeriaceae, Phaeoseptaceae and Synnemasporellaceae from Zhujiangyuan Nature Reserve, Yunnan Province, P.R. China

Gui-Qing Zhang

Nalin N Wijayawardene

Li-Hong Han

Jaturong Kumla

Nakarin Suwannarach

Qiang Li

Abdallah M Elgorban

Ihab M Moussa

Claudia Coleine

Dong-Qin Dai

Roles

﻿Abstract

﻿Introduction

﻿Materials and methodology

﻿Sample collection

﻿Morphology, isolation and preservation

﻿DNA extraction, PCR amplification and sequencing

Table 1.

Table 2.

﻿Phylogenetic analyses

Table 3.

﻿Results

﻿Phylogenetic analyses

Figure 1.

Figure 2.

Figure 3.

﻿Taxonomy

﻿Didymosphaeriaceae Munk

﻿. Spegazzinia

Notes.

﻿. Spegazzinia zhujiangyuanensis

Figure 4.

Etymology.

Holotype.

Description.

Culture characteristics.

Material examined.

GenBank numbers.

Notes.

Table 4.

﻿Phaeoseptaceae S. Boonmee, Thambug. & K.D. Hyde

﻿. Phaeoseptum

Notes.

﻿. Phaeoseptum zhujiangyuanense

Figure 5.

Etymology.

Holotype.

Description.

Culture characteristics.

Material examined.

GenBank numbers.

Note.

Table 5.

﻿Synnemasporellaceae X.L. Fan & J.D.P. Bezerra

﻿. Synnemasporella

Notes.

﻿. Synnemasporella fanii

Figure 6.

Etymology.

Holotype.

Description.

Culture characteristics.

Material examined.

GenBank numbers.

Note.

Table 6.

﻿Discussion

Supplementary Material

﻿Acknowledgments

Citation

Funding Statement

Contributor Information

﻿Additional information

Conflict of interest

Ethical statement

Funding

Author contributions

Author ORCIDs

Three novel woody litter inhabiting fungi in Didymosphaeriaceae, Phaeoseptaceae and Synnemasporellaceae from Zhujiangyuan Nature Reserve, Yunnan Province, P.R. China

Abstract

Introduction

Materials and methodology

Sample collection

Morphology, isolation and preservation

DNA extraction, PCR amplification and sequencing

Phylogenetic analyses

Results

Phylogenetic analyses

Taxonomy

Didymosphaeriaceae Munk

. Spegazzinia

. Spegazzinia zhujiangyuanensis

Phaeoseptaceae S. Boonmee, Thambug. & K.D. Hyde

. Phaeoseptum

. Phaeoseptum zhujiangyuanense

Synnemasporellaceae X.L. Fan & J.D.P. Bezerra

. Synnemasporella

. Synnemasporella fanii

Discussion

Acknowledgments

Additional information

References