Skip to main content
Indian Journal of Microbiology logoLink to Indian Journal of Microbiology
. 2023 Dec 7;64(2):457–466. doi: 10.1007/s12088-023-01123-3

Study of the Genomic Characterization of Antibiotic-Resistant Escherichia Coli Isolated From Iraqi Patients with Urinary Tract Infections

Kareem Mouhammed 1, Radhouane Gdoura 1,
PMCID: PMC11246310  PMID: 39011020

Abstract

Urinary tract infection is one of the last diseases prevalent in humans, with various causative agents affecting 250 million people annually, This study analyzed UTIs in Iraqi patients caused by Escherichia coli. ESBL enzymes contribute to antibiotic resistance. The research aimed to analyze ESBL gene frequency, resistance patterns, and genetic diversity of E. coli strains; Between Dec 2020 and May 2021, 200 urine samples were collected, cultured on blood agar, EMB, and MacConkey's plates, samples incubated at 37 °C for 24 h. Positive samples (> 100 cfu/ml) underwent Kirby-Bauer and CLSI antibiotic susceptibility testing. PCR detected virulence genes, Beta-lactamase coding genes, and biofilm-associated resistance genes in E. coli isolates; Out of 200 isolates, 80% comprised Gram-positive and Gram-negative bacteria. Specifically, 120 isolates (60%) were Gram-negative, while 40 isolates (20%) were Gram-positive. Among Gram-negative isolates, 20% were identified as E. coli. Remarkably, all E. coli strains showed resistance to all tested antibiotics, ranging from 80 to 95% resistance. The E. coli isolates harbored three identified resistance genes: blaTEM, blaSHV, and blaCTXM. Regarding biofilm production, 10% showed no formation, 12% weak formation, 62% moderate formation, and 16% strong formation; our study found that pathogenic E. coli caused 20% of UTIs. The majority of studied E. coli strains from UTI patients carried the identified virulence genes, which are vital for infection development and persistence.

Keywords: Urinary tract infections, E. coli, Susceptibility to antibiotics, Virulence factors, Biofilm

Introduction

Urinary tract infection is a term given to a group of clinical conditions ranging from mild symptoms to severe ones. When bacteria in the urine is greater than ten cells per mL, it is considered a urinary tract infection, a common medical problem that affects both men and women and can occur often at various ages is urinary tract infection (UTI). The majority of the approximately 150 million new UTI cases diagnosed each year are in women. Uropathogenic Escherichia coli (UPEC) is the most prevalent cause of UTIs (80–90%) despite the fact that many bacterial infections are known to cause UTIs [1]. Bacterial infection is the most common infection after respiratory tract infection in humans, accounting for approximately 25% of all infections, and this infection affects all age groups and both sexes [2].

UTIs have both medical and financial implications, as non-acute, uncomplicated cases are often considered as a straightforward condition without significant long-term medical consequences. Still, an acute UTI can increase the risk of developing pelvic nephritis and may cause premature birth for pregnant women and, thus, the death of the fetus as it impairs kidney functions [1]. Despite the various factors causing UTIs, the main cause is Gram-negative and Gram-positive bacteria, responsible for 95% of infections [3]. Mostly, UTI is caused by Gram-negative aerobic bacilli such as E. coli and Klebsiella, with a reduction in other pathogenicity up to more than 70% [4]. Daoud and Afif [5] indicated that E. coli was commonly encountered during the past ten years, with a percentage of 60.6% of the total samples examined in Lebanon. According to Al‐Saadi and Abdulnabi [6], 50% of the samples studied in Baghdad were bacteria E. coli that cause UTI, and the same percentage was found in Dohuk, indicating that E. coli is the main cause of both complex and uncomplicated infections known as UPEC (Uropathogenic E. coli). E. coli is regarded as a significant member of the intestinal microbiota, which constitutes the normal bacterial population in the digestive system. As an opportunistic pathogen, E. coli can cause a range of illnesses such as diarrhea, E. coli infection, neonatal meningitis, septicemia, and UTIs. The bacterium can easily migrate from the anal region to the urinary tract and bladder, with UTIs occurring 14 times more frequently in females than males [2]. The Gram-negative bacillus Escherichia coli, because of the close closeness of the gastrointestinal and urinary tracts, is the leading cause of low urinary infections (> 80%). It may, however, ascend and produce pyelonephritis, enter the circulation (bacteremia), or spread to other parts of the body due to infection. It's also linked to hospital-acquired pneumonia, septicemia, abscesses, and gastroenteritis; nevertheless, since it's an intestinal diner, it wasn't highly appreciated until lately [7]. Many effective antibiotics are available to treat UTIs, but the increased drug resistance of bacteria has made treating UTIs difficult. Bacteria can transmit and acquire antibiotic resistance.

The global issue of antibiotic resistance poses a significant public health concern, leading to an unavoidable rise in illness and death rates caused by infectious diseases. This, in turn, contributes to a decline in overall quality of life and an increased burden on healthcare systems and services [8]. Just two years after penicillin was introduced to the market in the mid-1940s, the initial instances of penicillin-resistant Escherichia coli and Staphylococcus aureus strains emerged [9]. Genes that offer selection benefits to bacteria that contain them have been found due to the range of habitats they colonize and the features of those environments [10]. Antibiotics used inappropriately and indiscriminately in treatments compel these microbes to adapt or perish, a mechanism known as “selective pressure” [11]. Antibiotic resistance genes are carried by microorganisms that can survive and grow under these conditions rendering the antibiotic useless. Antimicrobial agents like glycopeptides, aminoglycosides, quinolones, and cephalosporins have been utilized in animal feed not only as antibiotics but also as growth promoters. This practice creates an opportunity for the selection of resistant strains in animals, potentially serving as a reservoir for resistance genes. Consequently, multidrug-resistant bacteria can enter the food chain and the environment [12]. In light of this situation, the wisest course of action will be only to use antibiotics when essential and to limit their usage in animals. Several variables contribute to the fast emergence of resistance in a hospital setting.

The twenty-first century witnessed a remarkable rise in antibiotic resistance to be a global concern for public health, as the World Health Organization reported in 2016 confirmed a remarkable rise in antibiotic resistance, and suggested many measures such as diagnosing the main cause of the disease, rational use of antibiotics and investing in a new category of antibiotics and find alternatives [13].

One of the most common causes of infection in the urinary system is E. coli bacteria, which is the main cause because it has multiple virulence factors such as adhesion factors, capsule, toxins and iron acquisition systems. Overuse of antibiotics, especially beta-lactam antibiotics, used to treat UTIs has significantly increased ESBL-producing bacteria, limiting treatment options [14].

This study aimed to assess resistance patterns, the prevalence of ESBL-encoding genes, and the genetic variability of E. coli strains obtained from UTI patients admitted to the urology department of a hospital in Baghdad, Iraq.

Materials and Methods

Sample Collection

UTI sample collection was realized in Baghdad Hospitals from 200 patients with Age ≥ 18 year,male and female who had symptomatic urinary tract infections with fever, and had also be recurrent where diagnosis of three or more UTI occurrences in a year, as well as less than six months, it is considered a recurrent infection during the study period from December 2021 to May 2022.

Culture of Samples

Each urine sample was inoculated in blood agar, MacKonky agar and Hardy chrom agar (Oxoid, England) and incubated at 37 °C for 24 h before studying the remaining tests required for the isolates. A urine sample is considered positive if the number of colonies in the urine sample exceeds 105 cfu/ml.

Isolation and Identification of Bacteria

Pure colonies were isolated on blood agar, MacKonky agar and Hardy chrome agar. Then the identification of E. coli isolates involved the assessment of their cultural characteristics, microscopy features, and utilization of the Vitek 2 Compact System. Isolated E. coli were compared to standard bacteria ATCC 8739 from the State Company for Drug Industry and Medical Appliances.

Cultural Characteristics

On different culture mediums, the colors and forms of the forming colonies were examined. On blood agar media, colonies were big, rounded, grayish, and perhaps hemolytic. Colonies on Hardy chrom agar were pink, and the MacConkey media were spherical, wet, and colored pink from lactose fermentation.

Diagnosis with the VITEK 2 Compact System

The principle of the VITEK 2 cards is based on the broth micro dilution minimum inhibitory concentration technique. The effectiveness of this system relies on the chemical reactions occurring in the prepared cards, which provide reliable results for analysis. All E. coli isolates were identified at species level by using VITEK-2 compact system with the use of identification Gram negative bacteria (ID-GNB) cards according to the manufacturer's instructions. The system includes the VITEK- 2 compact instrument, a computer, and printer. The soft were collected data and analyzed using a comprehensive database that includes a wide range of Gram-positive and Gram-negative bacteria. This database serves as a valuable resource for interpreting and comparing the findings, allowing for a comprehensive assessment of the results obtained from the study. The procedure involved bacterial growth in the medium and subsequent transfer of colonies to glass tubes using sterile wooden sticks to create a suspension with a 0.5 McFarland standard using normal saline solution. Then, the tube is connected to the card. Each card contains 64 slots with indicators that interact with the sample to be diagnosed. The system records the changes that will occur, and the final results are obtained through a detailed report that identifies bacteria at the species level. There are two types of cards for this device: cards for Gram-negative (GN) bacteria and cards for Gram-positive (GP) bacteria [15]. Due to the accuracy and speed of its results, it was adopted instead of using the biochemical reactions of bacteria.

Antibiotic Susceptibility Testing

In order to conduct the antibiotic susceptibility test for 7 different antibiotics, [16] followed and explained the Kirby-Bauer method (Table 1). A bacterial suspension was created by selecting one to two isolated E. coli colonies from the original culture and adding them to a test tube containing four milliliters of normal saline. This produced a solution that was some what turbid compared to the McFarland standard (0.5). The plates were then turned over and incubated for 18–24 h at 37 °C. According to Clinical Laboratories Standards Institute [16], inhibition zones that developed around the discs were measured in millimeters (mm) using a metric ruler. By comparing the isolate's inhibition zones to standards, as shown in Table (1), it was determined if it was susceptible, intermediate, or resistant to a certain drug.

Table 1.

Diameter interpretive standards of inhibition zones according to [16]

No Antibiotic agent Concentration microgram/disc Diameter of zone inhibition (mm)
Sensitive Intermediate Resistant
1 Cefotaxime 30  ≥ 26 23–25  ≤ 22
2 Ampcillin 10  ≥ 17 14–16  ≤ 13
3 Trimethoprim/sulfamethoxazole 25  ≥ 16 11–15  ≤ 10
4 Gentamicin 10  ≥ 15 13–14  ≤ 12
5 Ciprofloxacin 5  ≥ 21 16–20  ≤ 15
7 Azetreonam 30  ≥ 22 16–21  ≤ 15
8 Amikacin 30  ≥ 17 15–16  ≤ 14

The zone of inhibition represents the area where bacterial growth is inhibited due to the effectiveness of the antibiotic in preventing bacterial proliferation. The size of the inhibition zone provides valuable information regarding the sensitivity of the bacteria to the specific antibiotic. Identify isolates that exhibit resistance to three or more types of antibiotics (MDR) to proceed with the remaining aspects of the study.

Detection of Gene Resistance of E. coli

To select the MDR E. coli isolated from urine samples, we performed a DNA amplification by PCR.

Extraction of Bacterial Genomic DNA

Bacterial genomic DNA was extracted from bacterial cultures using a Quick-g DNATM MiniPrep kit (Zymo Research, France). The Gram-negative bacteria extraction kit protocol: Centrifugation was performed on a 2 ml sample of the cell suspension for one minute at a speed of 13,000 rpm. The cells can be separated from the surrounding liquid using centrifugation. The liquid component, known as the supernatant, is left above the dense pellet of cells that forms at the bottom of the tube as a result of centrifugation. The concentrated cells in the pellet were left behind for additional processing or analysis after the centrifugation procedure, with the supernatant being carefully discarded or removed. We infused the mixture slowly after adding 300 ml of G-buffer solution and inverting the well.

Primer Design

Primers were created using the BLAST program (Basic Local Alignment Search Tool), which was used to find -lactamase genes connected to extended-spectrum -lactamases (including blaTEM, blaCTX-M, and blaSHV12). Primer verification was used to verify the correctness of these primers (Table 2).

Table 2.

Compendium of primers employed for qPCR amplification

Target gene Sequence (5’–3’) Tm (°C) Product size (bp) References
blaTEM F TTACCAATGCTTAATCAGTGAGG 56 863 U Gene lab
R GTATGAGTATTCAACATTTTCGTGTC
blaCTXM F GATATCGTTGGTGGTGCCATA 51 541 Edelstein et al. (2003)
R TGCGATGTGCAGTACCAGTA
blaSHV F CCGCGTAGGCATGATAGAAA 56 649 U Gene lab
R AATGCGCTCTGCTTTGTTATTC 56

PCR Amplification

Each reaction was carried out in a 50 μl reaction mixture (Table 3). PCR amplifications were performed using the GoTaq® G2 Green Master Mix (Promega). The amplification procedure comprised an initial denaturation stage at 94 °C for 5 min to unwind the DNA strands. Subsequently, a total of 35 cycles were performed, each consisting of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s to allow primer binding, and extension at 72 °C for 1 min to synthesize new DNA strands. Lastly, a final extension step at 72 °C for 5 min was carried out to ensure completion of DNA synthesis and to stabilize the amplified products. The PCR products were subsequently detected through agarose gel electrophoresis (1%).

Table 3.

Composition of the reaction mixture

Components Concentration Volume (50 µl)
Forward primer 10 µM/µl 4 µl
Reverse primer 10 µM/µl 4 µl
2X PCR Taq Master Mix 1X 25 µl
DNA 40 ng 4 µl
ddH2O 13 µl

Biofilm Assay

Biofilms are communities of microorganisms that are attached to a surface and play a significant role in the persistence of bacterial infections. Bacteria within a biofilm are several orders of magnitude more resistant to antibiotics, compared with planktonic bacteria.

The Piechota et al. [17] method was used to conduct the biofilm formation experiment. This approach can be summed up as follows: Fresh, pure colonies from each isolate should be seeded onto Luria Bertani broth that has been supplemented with 0.5% glucose. Incubate the mixture at 37 °C for 24 h without shaking, and then prepare a bacterial cell solution with about 108 CFU/ml. by dilution the culture to the 0.5 McFarland standard, Once in the wells of a sterile 96-well flat-bottom polystyrene plate, 200 µl of each isolate suspension was added. The plate was then incubated at 37 °C for 24 h without shaking.Clear away any extra medium, then wash twice in 200 l of sterile PBS (pH 7.4). For around 60 min, heat the fixed biofilm in a 60 °C oven. 200 l of 1% crystallization solution should be used to stain each well. Hold for 5 min. Clean the wells with PBS and let them air dry for 60 min. Use a microplate reader to measure the absorbance at 490 nm after the dye has been dissolved in 96% ethanol. The average result was calculated using duplicate results from each assay. Sterile LB broth was used as a negative control, and then calculate the biofilm formation rate are realized using the following formula: BR = AT – ANC, where: BR: the biofilm result, AT: the absorbance of the test strain measured at OD490 nm, and ANC: the OD490 nm of negative control wells. Absorbance values were considered positive for biofilm formation at ≥ 0.12, weak biofilm producers at < 0.2, moderate at 0.2–0.4, and strong producers at > 0.4.

Results

In this study, a comprehensive analysis was conducted on a total of 200 urine samples. Based on the results in Table 4, 80% (160/200) of samples were positive for the culture test. Out of the 160 positive isolates examined, 120 were identified as Gram-negative bacteria, accounting for 60% of the total. Additionally, 40 isolates were classified as Gram-positive bacteria, representing 20% of the total. Among the 120 Gram-negative isolates, 60 (20%) were specifically identified as E. coli. These findings highlight the high prevalence of E. coli as a Gram-negative bacterium, which is a significant contributor to urinary tract infections. Klebsiella spp. was also found to be prevalent in this study. On the other hand, among the Gram-positive bacteria, Staphylococcus spp. emerged as the most commonly encountered species.

Table 4.

The count and proportion of bacterial growth observed in the specimens

Bacterial growth No Percentage %
Total growth 160 80%
Gram-negative 120 60%
Gram-positive 40 20%
E. coli 60 20%
No growth 40 20%
Total 200 100

According to the results shown in (Table 5), the resistance percentage toward Cefotaxime was 95%. This result has been considered as a high percentage.

Table 5.

Antibiotics sensitivity

Antibiotics Resistance-R No (%) Sensitive-S No (%) P-value
AMP (Ampicillin) 57 (95.0) 3(5.0) 0.0001 **
CTX (Cefotaxime) 57 (95.0) 3 (5.0) 0.0001 **
SXT trimethoprim/Sulfamethoxazole 48 (80.0) 12(20.0) 0.0211 **
CIP (Ciprofloxacin) 57 (95.0) 3 (5.0) 0.0001 **
CN(Gentamicin) 52 (86.66) 8 (13.33) 0.0011 **
AK(Amikacin) 53 (88.33) 7 (11.66) 0.0011 **
ATM (Azithromycin) 48 (80.0) 12 (20.0) 0.0211 **

**P ≤ 0.01

Biofilm formation is acknowledged as a crucial factor in the virulence of diverse bacteria implicated in urinary tract infections (UTIs) among humans. Among the 60 E. coli isolates obtained from UTI cases, they were categorized into four groups based on their biofilm-forming abilities as shown in (Table 6): negative, weak, moderate, and strong. The distribution of biofilm formation was as follows: 10% showed no biofilm formation, 12% displayed weak biofilm formation, 62% exhibited moderate biofilm formation, and 16% demonstrated strong biofilm formation.

Table 6.

Biofilm formation results

Biofilm-forming ability Mean (%) Percentage% No.60
Negative biofilm 0.0921 10%
Weak biofilm 0.0988 12%
Moderate biofilm 0.1525 62%
Strong biofilm 0.3019 16%

In the present study, three resistance genes shown in (Table 7) were identified in Escherichia coli isolates (blaTEM, blaSHV and blaCTXM) using PCR.

Table 7.

The occurrence of resistance genes blaCTX-M, blaTEM, and blaSHV in E. coli isolates

No. of sample blaCTX-M blaTEM blaSHV
1  +   +   + 
2  +   +   + 
3  +   +   + 
4  +   −   − 
5  +   +   + 
6  +   −   − 
7  −   +   + 
8  +   +   − 
9  +   +   − 
10  +   +   − 
11  +   +   − 
12  +   +   + 
13  +   +   + 
14  −   +   − 
15  +   +   − 
16  +   +   − 
15  +   +   + 
18  +   +   − 
19  −   +   − 
20  +   +   + 

The current study revealed that the percentage of the blaTEM gene by conventional PCR was 90%, While the gen of blaSHV was 45% and blaCTX-M was 88%. The blaCTX-M type (including blaCTX-M-groups) and blaSHV type are the major ESBLs phenotype detected worldwide.

Discussion

This study agrees with studies conducted in Iraq by AL-Nasrawi and AL-Hashimy [18], who recorded that Escherichia coli was the most common pathogen, followed by Klebsiella ssp. Also, these results were compatible with studies conducted in Libya and Somalia, which revealed that the UTI with E. coli bacteria was ranked first, followed by the infection of Klebsiella spp [19].

In this study, out of the total 60 E. coli isolates, 42 isolates (70%) were obtained from female patients, while 18 isolates (30%) were from male patients. The age range of patients included both genders and spanned from 18 to 70 years. These findings are consistent with a previous study conducted by Ali and Khudhair [20]. Similarly, Jameel and Artoshi [21] reported similar results in 2019, observing a higher incidence of infection in females compared to males, with percentages of 68% and 32%, respectively, out of a total of 316 samples collected from diabetic and non-diabetic patients in Zakho city.

In a study conducted by Neamati et al. [22], the distribution of E. coli isolates from urinary tract infections was investigated. The study analyzed 150 urine samples collected from Beheshti Hospital in Kashan, Iran. The results revealed that 78% of the E. coli isolates were obtained from female patients, while the remaining 22% were from male patients. These findings provide valuable insights into the gender-based distribution of E. coli infections in the specific population studied. The anatomical differences play a significant role in these findings, as the short urethra in females, located in close proximity to the anus, facilitates the passage of UPEC (Uropathogenic Escherichia coli) to the bladder, increasing the risk of infection. In contrast, the longer male urethra makes it more challenging for bacteria to infect the bladder [23]. Furthermore, hormonal changes, such as decreased estrogen levels during menopause and pregnancy, contribute to the increased susceptibility to urinary tract infections [24].

Sabir et al. [25] observed that the resistance percentage of E. coli strains isolated from urine towards Cefotaxime was 96.56% and 89.7% respectively. At the same time, our finding was slightly higher than the resistance percentage mentioned in previous studies conducted in different regions in Egypt [26] who recorded 74.4% and 79% of the Cefotaxime resistance respectively. In contrast to previous findings, the current records revealed significantly higher resistance percentages of E. coli against Cefotaxime compared to the reported resistance percentage of 60% [27].

In this study, E. coli showed high resistance to Ampicillin, where the percentage was 95%. Other results were reported in Iraq by Jabber in 2020; Yaseen [28]; and Hameed and Shaokat in 2010, who showed that 100% were resistant to Ampicillin. A study by Polse et al. [29] in Zako/ Iraq included 106 uropathogenic E. coli isolates and showed that using disk diffusion assay, 100% of isolates were resistant to Ampicillin. Al-Helfi [30] in 2009 showed a high resistance rate in E. coli to Ampicillin (99%). In comparison, our study was slightly higher than previous studies recorded in Erbil city [3133]. Where, recorded the ratio of resistance to Ampicillin as 96.4%, 95.7% and 92.5%, respectively. According to another study conducted in Iraq, it was noted that a significant proportion (86.60%) of E. coli strains exhibited high resistance to Ampicillin, making them the most resistant isolates [34]. In contrast, Shah et al. [35] in 2019 and Momtaz et al. [36] in 2013 mentioned that 51% and 36% of isolates were resistant to Ampicillin. The resistance of E. coli to Ampicillin is related to the widespread use of this antibiotic without the real need and due to the multiple uses of this antibiotic by hospitals for different infections [31].

Also this study, E. coli shows resistance to Aztreoname (ATM) at 48%. This result is close to Abd Al-Mayahi and Almohana [31], who reported 48.2% but disagreed with Osman [37], who recorded the resistance percentage of E. coli for Aztreoname as 100%. In contrast, Kadhum et al. [38], and Awayid et al. [39] revealed resistance percentages of E. coli to Aztreonam as 88.1%, 75%, 76%, and 70% respectively.

The rate of Trimethoprim resistance among E. coli isolated from UTIs (80%) in this study was similar to the findings of another study in Sudan, which reported a resistance percentage of 88.3% for Trimethoprim [40]. While near with a study done by Al-Shaboot et al. [41] in 2021 who recorded resistance percentage of E. coli for Trimethoprim as 92.5%. While our study was slightly higher than previous studies recorded by Kadhum et al. [38], Awayid et al. [39], Abd Al-Mayahi and Almohana [31], and Jaber and Aal Owaif [42] who recorded the ratio of resistance to Trimethoprim as 74%, 71.11%, 71.4% and 67% respectively but disagreed with Yahiaoui, et al. [43], who recorded low rate of resistance (36.7%).

Moreover, the isolates showed high resistance against Ciprofloxacin (95%). These results are consistent with Al-Fayyadh et al. [44], who confirmed the high resistance to Ciprofloxacin (98.11%) of E. coli isolates. This finding disagrees with a later study carried out by [38] (66%) and Ali and Khudhair [20]. Contrary to the findings of Al-Jebouri and Mdish [45], who reported a resistance percentage of E. coli to Ciprofloxacin not exceeding 25%, and the results of Abd-Alsattar [46], who found a resistance rate of 5.6% for Ciprofloxacin in E. coli isolates, our study yielded inconsistent results.

Ciprofloxacin, a quinolone antibiotic, is commonly used as the first-line treatment for urinary tract infections (UTIs) due to its effectiveness against uropathogenic bacteria, particularly uropathogenic E. coli. It exerts its action by disrupting DNA replication and transcription in bacteria. However, the overuse and inappropriate use of ciprofloxacin can contribute to the development of resistance, limiting its long-term efficacy in treating UTIs. It is important to exercise caution and adhere to proper antibiotic prescribing practices to minimize the risk of resistance emergence [47].

Ciprofloxacin belongs to the class of fluoroquinolone antibiotics that act by binding to DNA gyrase, inhibiting bacterial growth. Mutations occurring in the subunits of DNA gyrase can significantly contribute to the development of high resistance rates to fluoroquinolones in gram-negative bacteria [48].

Gentamicin is a type of aminoglycoside, and it can be an option to treat UTI, but resistance rates hamper its utility in this study, the susceptibility of E. coli to Gentamicin was found to be considerably low, with a resistance rate of 86.66%. Gentamicin is an aminoglycoside antibiotic that inhibits bacterial protein synthesis. The high resistance observed in E. coli isolates emphasizes the importance of judicious use and appropriate prescribing of Gentamicin to effectively manage bacterial infections this result was slightly higher than the percentage recorded in Iraqi (71.1%) [39, 49] and the percentage recorded in Iran (76%) [50]. While several studies [38, 5153] showed a moderate level of resistance to Gentamicin: 65.8%, 56%, 52.9%, and 42.2% respectively. Whereas low resistance rates were mentioned by Maheswari et al. [54] (34.78%) and [40] (35%).

In the present study, the researchers evaluated the resistance pattern of E. coli isolates against Amikacin, an important antibiotic used for treating urinary tract infections. The results revealed a high resistance rate of 88.33% among the E. coli isolates. These finding highlights a concerning level of antibiotic resistance, indicating that Amikacin may not be as effective in combating E. coli infections in the tested population. These findings underscore the need for judicious use of antibiotics and the development of alternative treatment strategies to address the challenge of antibiotic resistance in E. coli infections. Our results are higher than those obtained by Ansari et al. [55] (32%) and Alqasemi et al. [56] (32.7%). In Korea, 1.2% of UPEC strains isolated from UTI are resistant to Amikacin [57]. However, our results were nearly consistent with Aljanaby and Aljanaby [58], who found resistance (78%) and (70%) to E. coli against Amikacin in comparison with the results of Pootong et al. [59] who reported resistance of 100%.

The current results were also compatible with those of Awayid et al. [39] and Obeed and Dhahi [60] in Iraq, who showed that resistance to nalidixic acid is 84.44% and 88%, respectively. Resistance rates in the present study were higher than those in Sudan and Iran recorded by [40] Ibrahim& Hamid [61], Malekzadegan et al. [62] and [63], which were 72%, 71.9% and 63%, respectively.

The development of multiple antibiotic resistance in bacterial isolates poses a significant and alarming challenge in the fields of medicine and pharmacology. This phenomenon creates difficulties in selecting appropriate treatment options for patients. Multiple resistance refers to the resistance of bacteria to more than one antibiotic, making it challenging to effectively combat infections. One of the primary contributors to the emergence of multiple resistance is the indiscriminate and widespread use of antibiotics without relying on sensitivity testing. This practice enhances the bacteria's ability to develop resistance against commonly used antibiotics, undermining their effectiveness in treatment. The consequences of multiple resistance are far-reaching, as it limits the available treatment choices, prolongs the duration of illness, and increases the risk of complications. To address this issue, it is crucial to promote responsible antibiotic use, including conducting sensitivity tests to guide appropriate antibiotic selection, thereby minimizing the development of multiple antibiotic resistance and preserving the effectiveness of these vital medications [64].

The isolates of E. coli have more than one mechanism to resist antibiotics, such as forming a biofilm. Since they are gram-negative bacteria, they have an outer membrane that encloses the cell wall, which contains channels called porins, preventing antibiotic molecules from entering the bacterial cell. E. coli can produce broad-spectrum B-lactamase enzymes, which are very important mechanisms in the fight against Beta-lactam antibiotics in the family of Enterobacteriaceae.

These findings differ from a study by Fattahi et al. [65] conducted in Iran, where all isolates were reported to form biofilms, with 48.6% classified as strong and 11.4% as moderate. These variations highlight the diversity in biofilm formation among E. coli strains and may have implications for UTI pathogenesis and treatment strategies.

In a study carried out by Tajbakhsh et al. [66], it was found that out of 130 E. coli isolates, 80 (61.53%) exhibited the capability to form biofilms. Biofilm formation refers to the ability of bacteria to adhere to surfaces and create a protective matrix, which enhances their survival and resistance to antimicrobial agents. The findings highlight the prevalence of biofilm-forming E. coli strains, underscoring the significance of this virulence factor in the context of urinary tract infections.. Among these isolates, 15 (18.7%) exhibited a strong biofilm reaction, 20 (25%) showed a moderate reaction, and 45 (56%) displayed a weak reaction. These findings are similar to our study, which also assessed the overall biofilm-forming capacity of the bacteria.

The development of biofilms enhances the severity and frequency of UTI and is closely related to E. coli antibiotic resistance. According to the current investigation, the clinical isolates of E. coli generally showed a significant tendency to develop a biofilm. Bacterial biofilms are often associated with the long-term persistence of organisms in various environments. It displays dramatically increased antibiotic resistance Karigoudar et al. [67].

Researchers such as Pishtiwan and Khadija [68] have reported comparable results, demonstrating that E. coli isolates exhibited the presence of blaTEM (81%), blaSHV (16.2%), and blaCTX-M (32.4%) genes. Mirkalantari et al. [69] showed a prevalence of 69.5% of blaCTX-M and 47.4% of blaTEM. Rozwadowski and Gawel [70] showed a prevalence of 84.3% of blaCTX-M, 28% of blaTEM and 28% of blaOX-48. These results contrast with those of prior research in Brazzaville, Congo, which found a lower prevalence: 74.42% for the blaTEM gene, 23% for blaCTX-M-1, 26% for blaSHV and 9.30% for blaOXA-48 (Fils et al., 2019). According to another study Oladeinde et al. [52] the prevalence rates for the genes blaTEM, blaCTX-M, blaOXA-48 and blaSHV-12 were 33.3%, 53.3%, 6.7% and 6.7%, respectively. According to Alqasim et al. [71], 31 (93.94%) isolates produced CTX-M, and 4 (12.12%) isolates produced TEM-type ESBLs. Several investigations found various frequencies of Beta-lactam genes in Iraq [72, 73].

Conclusion

E. coli was isolated and identified using samples from Iraq's Baghdad hospitals. The identified bacterial strains were resistant to Ampicillin, Ciprofloxacin, and cefoxitin was 95%, the drugs Amikacin at 88%, the drugs trimethoprim/sulphamethoxazole and aztreonam at 80%, 86% of the drugs gentamycin. The MDR E. coli are tested for gene virulence. The study revealed that a significant proportion of isolates (90%) tested positive for the blaTEM gene, indicating its presence in the E. coli population. Likewise, in this study, it was observed that 85% of the isolates examined carried the blaCTX-M gene, which is associated with extended-spectrum β-lactamase production. Additionally, 45% of the isolates harbored the blaSHV-12 gene, which is another common β-lactamase gene. These findings indicate a notable presence of these resistance genes among the E. coli isolates analyzed.

Furthermore, the isolates were subjected to evaluation for their biofilm-forming ability, a crucial virulence factor in bacterial infections. The results revealed a spectrum of biofilm production capabilities among the isolates. Specifically, 10% of the isolates exhibited no biofilm formation, 12% displayed weak biofilm production, 62% demonstrated moderate biofilm formation, and 16% exhibited a robust ability to form biofilms. These variations highlight the heterogeneity in biofilm-forming capacities among the E. coli isolates, which could potentially influence the pathogenicity and persistence of these bacteria in urinary tract infections.

Acknowledgements

This study was conducted in Microbiology Laboratory, Iraq. The authors would like to thank Baghdad hospital staff for their logistic support and their help in the sampling.

Author Contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by KM. The first draft of the manuscript was written by all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

We have not received any funding for this study.

Declarations

Conflict of interest

We declare that we have no conflict of interests in the publication. This work is not under consideration for publication elsewhere and all co-authors agree to the submission.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Hay AD et al. (2016) The diagnosis of urinary tract infection in young children (DUTY): a diagnostic prospective observational study to derive and validate a clinical algorithm for the diagnosis of urinary tract infection in children presenting to primary care with an acute illness. Health technology assessment [DOI] [PMC free article] [PubMed]
  • 2.Foxman B. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Am J Med. 2002;113:5–13. doi: 10.1016/S0002-9343(02)01054-9. [DOI] [PubMed] [Google Scholar]
  • 3.Adeniji OO, Ojemaye MO, Okoh AI. Antibacterial activity of metallic nanoparticles against multidrug-resistant pathogens isolated from environmental samples: nanoparticles/antibiotic combination therapy and cytotoxicity study. ACS Appl Bio Mater. 2022;5:4814–4826. doi: 10.1021/acsabm.2c00527. [DOI] [PubMed] [Google Scholar]
  • 4.Weinstein RA, Gaynes R, Edwards JR, System NNIS. Overview of nosocomial infections caused by gram-negative bacilli. Clin Infect Dis. 2005;41:848–854. doi: 10.1086/432803. [DOI] [PubMed] [Google Scholar]
  • 5.Daoud Z, Afif C (2011) Escherichia coli isolated from urinary tract infections of lebanese patients between 2000 and 2009: epidemiology and profiles of resistance. Chemother Res Pract 2011 [DOI] [PMC free article] [PubMed]
  • 6.Al-Saadi EAKD, Abdulnabi MA. Hematological changes associated with COVID-19 infection. J Clin Lab Anal. 2022;36:e24064. doi: 10.1002/jcla.24064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lindsay JA. Genomic variation and evolution of staphylococcus aureus. Int J Med Microbiol. 2010;300:98–103. doi: 10.1016/j.ijmm.2009.08.013. [DOI] [PubMed] [Google Scholar]
  • 8.Prestinaci F, Pezzotti P, Pantosti A. Antimicrobial resistance: a global multifaceted phenomenon. Pathogens Global Health. 2015;109:309–318. doi: 10.1179/2047773215Y.0000000030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Al-Dahbi AM, Al-Mathkhury HJ. Distribution of methicillin resistant staphylococcus aureus in Iraqi patients and healthcare workers. Iraq J Sci. 2013;54:293–300. [Google Scholar]
  • 10.Saleem AJ, Ali MR, Nasser NE. Prevalence of accessory gene regulator specificity groups among methicillin resistant staphylococcus aureus isolated from iraqi hospital patients. Int J Curr Microbiol App Sci. 2016;5:321–328. doi: 10.20546/ijcmas.2016.507.034. [DOI] [Google Scholar]
  • 11.Al-kaabi KT, Al-Kashwan TAJ, Al-Fahham HR. Molecular study of methicillin resistant staphylococcus aureus isolated from different hospitals in Najaf-Iraq. Hospital. 2016;35:22. [Google Scholar]
  • 12.Malachowa N, DeLeo FR. Mobile genetic elements of staphylococcus aureus. Cell Mol Life Sci. 2010;67:3057–3071. doi: 10.1007/s00018-010-0389-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.World Health Organization (2021) Global antimicrobial resistance and use surveillance system (GLASS) report: 2021
  • 14.Kaur B, Kumar S, Kaushik BK. Recent advancements in optical biosensors for cancer detection. Biosens Bioelectron. 2022;197:113805. doi: 10.1016/j.bios.2021.113805. [DOI] [PubMed] [Google Scholar]
  • 15.Khullar S, Rathore L, Khatri P, Parihar R, Meena S, Bora A, Sharma N. Identification and antibiogram of various gram-positive bacterial isolates from pyogenic samples by VITEK® 2 compact system. Int J Curr Microbiol App Sci. 2016;5:66–77. doi: 10.20546/ijcmas.2016.502.007. [DOI] [Google Scholar]
  • 16.CLSI 2020 Performance Standards for Antimicrobial Susceptibility Testing, 33rd Edition
  • 17.Piechota M, Kot B, Frankowska-Maciejewska A, Grużewska A, Woźniak-Kosek A (2018) Biofilm formation by methicillin-resistant and methicillin-sensitive Staphylococcus aureus strains from hospitalized patients in Poland. BioMed Research International 2018 [DOI] [PMC free article] [PubMed]
  • 18.AL-Nasrawi MM, AL-Hashimy AB. Molecular study of some virulence genes of Escherichia coli isolated from women with urinary tract infection in AL-Najaf City. Iraq J Biotechnol. 2020;3:2020. [Google Scholar]
  • 19.Mohamed Hayir T, Mohamed Y, Shaba A, Elmi S, Hassan A (2019) Bacterial uropathogens in urinary tract infections and antibiotic
  • 20.Ali MR, Khudhair AM. Detection of colony adhesion factors and genetic background of adhesion genes among multidrug-resistant uropathogenic Escherichia coli Isolated in Iraq. J Pure Appl Microbiol. 2018;12:2017–2025. doi: 10.22207/JPAM.12.4.38. [DOI] [Google Scholar]
  • 21.Jameel AY, Artoshi DM. Prevalence of urinary tract infections and their antimicrobial sensitivity among diabetic and non diabetic patients in zakho. Sci J Univ Zakho. 2019;7:125–131. doi: 10.25271/sjuoz.2019.7.4.629. [DOI] [Google Scholar]
  • 22.Neamati F, Firoozeh F, Saffari M, Zibaei M. Virulence genes and antimicrobial resistance pattern in uropathogenic Escherichia coli isolated from hospitalized patients in Kashan Iran. Jundishapur J Microbiol. 2015;8:2015. doi: 10.5812/jjm.17514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.McLaughlin SP, Carson CC. Urinary tract infections in women. Medical Clin. 2004;88:417–429. doi: 10.1016/S0025-7125(03)00148-2. [DOI] [PubMed] [Google Scholar]
  • 24.Hindi NKK, Hasson SO, Hindi SKK. Bacteriological study of urinary tract infections with antibiotics susceptibility to bacterial isolates among honeymoon women in Al Qassim Hospital, Babylon Province, Iraq. British Biotechnol J. 2013;3:332. doi: 10.9734/BBJ/2013/3573. [DOI] [Google Scholar]
  • 25.Sabir S, Anjum AA, Ijaz T, Ali MA, Nawaz M. Isolation and antibiotic susceptibility of E. coli from urinary tract infections in a tertiary care hospital. Pakistan J Med Sci. 2014;30:389. [PMC free article] [PubMed] [Google Scholar]
  • 26.Mahgoub FM, El-Gamal S. Microbiological profile of urinary tract infections with special reference to antibiotic susceptibility pattern of Escherichia coli isolates. Int J Curr Microbiol App Sci. 2018;7:911–920. doi: 10.20546/ijcmas.2018.702.115. [DOI] [Google Scholar]
  • 27.Rodrigues C, Joshi P, Jani S, Alphonse M, Radhakrishnan R, Mehta A. Detection of β-lactamases in nosocomial gram negative clinical isolates. Indian J Med Microbiol. 2004;22:247–250. doi: 10.1016/S0255-0857(21)02772-9. [DOI] [PubMed] [Google Scholar]
  • 28.Yaseen SS. Statistical study of urinary tract infection at all in children under the age of five in the city of Kirkuk. Kirkuk Univ J. 2014;9:22–42. [Google Scholar]
  • 29.Polse RF, Yousif SY, Assafi MS. Prevalence and molecular characterization of extended spectrum beta-Lactamases-producing uropathogenic Escherichia coli isolated in Zakho, Iraq. Journal of Microbiology and Infectious Diseases. 2016;6:163–167. doi: 10.5799/jmid.328863. [DOI] [Google Scholar]
  • 30.Al-Helfi (2009) Sensitivity of bacteria E. coli. Isolated from urinary tract infection towards ciprofloxacin and lomefloxacin. PhD, College of Science, University of Al-Mustansiriyah, Baghdad, Iraq
  • 31.Abd Al-Mayahi FS, Almohana AM. Antibiotic susceptibility patterns of Escherichia coli isolates from patients with significant bacteriuria. Al-Qadisiyah J Pure Sci. 2015;20:29–49. [Google Scholar]
  • 32.Nanakali ZG, Ahmad ZF. Antibiotic resistance study and detection of virulence gene among uropathogenic E. coli. Kirkuk Univ J Sci Stud. 2015;10:205–229. [Google Scholar]
  • 33.Kot B. Antibiotic resistance among uropathogenic. Pol J Microbiol. 2019;68:403–415. doi: 10.33073/pjm-2019-048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Fadhil (2020) Genotypic analysis of uropathogenic Escherichia coli isolated from Iraqi patients using seven single nucleotide polymorphisms (7SNPs) within fumC and fimH genes. Doctoral dissertation. PhD, Department of Microbiology, College of Medicine., Al Nahrain University, Iraq
  • 35.Shah C, Baral R, Bartaula B, Shrestha LB. Virulence factors of uropathogenic Escherichia coli (UPEC) and correlation with antimicrobial resistance. BMC Microbiol. 2019;19:1–6. doi: 10.1186/s12866-019-1587-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Momtaz H, et al. Uropathogenic Escherichia coli in Iran: serogroup distributions, virulence factors and antimicrobial resistance properties. Ann Clin Microbiol Antimicrob. 2013;12:1–12. doi: 10.1186/1476-0711-12-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Osman AA. Antibiotic resistance of bacteria isolated in urinary tract infections in Erbil City. Zanco J Pure Appl Sci. 2019;31:42–49. [Google Scholar]
  • 38.Kadhum HA, Saleh B, Kadhum HA (2020) Microbiological and molecular study for detection of uropathogenic Escherichia coli isolated from cases of urinarytract infection in Baghdad. Ann Trop Med Publ Health 23
  • 39.Awayid HS, Sahar BR, Jalil IS, Nouman KT. Immunization against multi drug resistance uropathogenic E. coli Isolate from urinary tract infection in pregnancy. Res J Pharm Technol. 2019;12:5444–5450. doi: 10.5958/0974-360X.2019.00944.2. [DOI] [Google Scholar]
  • 40.Ibrahim M, Bilal N, Hamid M. Increased multi-drug resistant Escherichia coli from hospitals in Khartoum state, Sudan. Afr Health Sci. 2012;12:368–375. doi: 10.4314/ahs.v12i3.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Al-Shaboot IAD, Al Sutani HJH, Abdulmunem H (xxxx) Aspirin plus heparin versus aspirin and oral prednisolone in the management of women with recurrent miscarriage
  • 42.Jaber AM, Aal Owaif H. Detection of genes involved in biofilms formation by Escherichia coli isolated from patients suffering of urinary tract infections. Plant Arch. 2020;20:5987–5992. [Google Scholar]
  • 43.Yahiaoui M, Robin F, Bakour R, Hamidi M, Bonnet R, Messai Y. Antibiotic resistance, virulence, and genetic background of community-acquired uropathogenic Escherichia coli from Algeria. Microb Drug Resist. 2015;21:516–526. doi: 10.1089/mdr.2015.0045. [DOI] [PubMed] [Google Scholar]
  • 44.Al-Fayyadh ZH, Turkie AM, Al-Mathkhury HJF (2017) New mutations in GyrA gene of Escherichia coli isolated form Iraqi patients. Iraqi J Sci pp 778–788
  • 45.Al-Jebouri MM, Mdish SA (2013) Antibiotic resistance pattern of bacteria isolated from patients of urinary tract infections in Iraq
  • 46.Abd-Alsattar M (2004) Partial purification of type-1pili extracted from E. coli and its role in infection. Ph. D. Thesis, College of Science, University of Baghdad
  • 47.Gupta N, Limbago BM, Patel JB, Kallen AJ. Carbapenem-resistant enterobacteriaceae: epidemiology and prevention. Clin Infect Dis. 2011;53:60–67. doi: 10.1093/cid/cir202. [DOI] [PubMed] [Google Scholar]
  • 48.Fàbrega A, Madurga S, Giralt E, Vila J. Mechanism of action of and resistance to quinolones. Microb Biotechnol. 2009;2:40–61. doi: 10.1111/j.1751-7915.2008.00063.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Sameer E, Aziz RAR. Molecular analysis of virulence genes of UTI causing bacteria among pregnant women in Baghdad city, Iraq. Syst Rev Pharm. 2020;11:1150–1162. [Google Scholar]
  • 50.Tayebi Z, Heidari H, Kazemian H, Ghafoori SM, Boroumandi S, Houri H. Comparison of quinolone and Î2-lactam resistance among Escherichia coli strains isolated from urinary tract infections. Infezioni in Med. 2016;24:326–330. [PubMed] [Google Scholar]
  • 51.Sharma S, Nwachukwu C, Wieseler C, Elsherif S, Letter H, Sharma S. MRI virtual biopsy of T2 hyperintense breast lesions, (in eng) J Clin Imaging Sci. 2021;11:18. doi: 10.25259/jcis_42_2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Oladeinde BH, Omoregie R, Olley M, Anunibe JA. Urinary tract infection in a rural community of Nigeria. N Am J Med Sci. 2011;3:75. doi: 10.4297/najms.2011.375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Ghaffar A, Langlois EV, Rasanathan K, Peterson S, Adedokun L, Tran NT. Strengthening health systems through embedded research. Bull World Health Organ. 2017;95:87–87. doi: 10.2471/BLT.16.189126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Maheswari UB, Palvai S, Anuradha PR, Kammili N. Hemagglutination and biofilm formation as virulence markers of uropathogenic Escherichia coli in acute urinary tract infections and urolithiasis. Indian J Urol IJU J Urolog Soc India. 2013;29:277. doi: 10.4103/0970-1591.120093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Ansari S, Nepal HP, Gautam R, Shrestha S, Neopane P, Gurung G, Chapagain ML. Community acquired multi-drug resistant clinical isolates of Escherichia coli in a tertiary care center of Nepal. Antimicrobial Resistance and Infection Control. 2015;4:1–8. doi: 10.1186/s13756-015-0059-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Alqasemi AS, Ibrahim M, Fadhil Al-Quraishi AM, Saibi H, Al-Fugara AK, Kaplan G. Detection and modeling of soil salinity variations in arid lands using remote sensing data. Open Geosci. 2021;13:443–453. doi: 10.1515/geo-2020-0244. [DOI] [Google Scholar]
  • 57.Jung H-J, et al. Genome-wide screening for enteric colonization factors in carbapenem-resistant ST258 Klebsiella pneumoniae. MBio. 2019;10:e02663–e2718. doi: 10.1128/mBio.02663-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Aljanaby AAJ, Aljanaby IAJ. Profile of antimicrobial resistance of aerobic pathogenic bacteria isolated from different clinical infections in Al-Kufa central hospital-Iraq during period from 2015 to 2017. Res J Pharm Technol. 2017;10:3264–3270. doi: 10.5958/0974-360X.2017.00579.0. [DOI] [Google Scholar]
  • 59.Pootong A, Mungkornkeaw N, Norrapong B, Cowawintaweewat S. Phylogenetic background, drug susceptibility and virulence factors of uropathogenic E. coli isolate in a tertiary university hospital in central Thailand. Trop Biomed. 2018;35:195–204. [PubMed] [Google Scholar]
  • 60.Obeed NJ, Dhahi MAR. The role of mutation and gene expression level of marRAB operon in multi antibiotic resistance uropathic Escherichia coli and 0157: H7 isolates from patients in Baghdad. J Pharm Sci Res. 2020;12:365–374. [Google Scholar]
  • 61.Ibrahim ME, Bilal NE, Hamid ME. Increased multi-drug resistant Escherichia coli from hospitals in Khartoum state. Sudan. African health sciences. 2012;12:368–375. doi: 10.4314/ahs.v12i3.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Malekzadegan Y, Rastegar E, Moradi M, Heidari H, Sedigh Ebrahim-Saraie H (2019) Prevalence of quinolone-resistant uropathogenic Escherichia coli in a tertiary care hospital in south Iran. Infect Drug Resis pp 1683–1689 [DOI] [PMC free article] [PubMed]
  • 63.Bakhshi M, Zandi H, Bafghi MF, Astani A, Ranjbar VR, Vakili M. A survey for phylogenetic relationship; presence of virulence genes and antibiotic resistance patterns of avian pathogenic and uropathogenic Escherichia coli isolated from poultry and humans in Yazd, Iran. Gene Rep. 2020;20:100725. doi: 10.1016/j.genrep.2020.100725. [DOI] [Google Scholar]
  • 64.Dash SK, Chakraborty SP, Mandal D, Roy S. Isolation and characterization of multi drug resistant uropathogenic Escherichia coli from urine sample of urinary tract infected patients. Int J Life Sci Pharma Res. 2012;2:25–39. [Google Scholar]
  • 65.Fattahi S, Kafil HS, Nahai MR, Asgharzadeh M, Nori R, Aghazadeh (2015) Relationship of biofilm formation and different virulence genes in uropathogenic Escherichia coli isolates from Northwest Iran. GMS Hyg Infect Control 10 [DOI] [PMC free article] [PubMed]
  • 66.Tajbakhsh E, Ahmadi P, Abedpour-Dehkordi E, Arbab-Soleimani N, Khamesipour F. Biofilm formation, antimicrobial susceptibility, serogroups and virulence genes of uropathogenic E. coli isolated from clinical samples in Iran. Antimicrob Resist Infect Control. 2016;5:1–8. doi: 10.1186/s13756-016-0109-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Karigoudar RM, Karigoudar MH, Wavare SM, Mangalgi SS. Detection of biofilm among uropathogenic Escherichia coli and its correlation with antibiotic resistance pattern. J Lab Phys. 2019;11:017–022. doi: 10.4103/JLP.JLP_98_18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Pishtiwan AH, Khadija KM (2019) Prevalence of blaTEM, blaSHV, and blaCTX-M genes among ESBL-producing Klebsiella pneumoniae and Escherichia coli isolated from thalassemia patients in Erbil, Iraq. Mediter J Hematol Infect Dis 11(1) [DOI] [PMC free article] [PubMed]
  • 69.Mirkalantari S, Masjedian F, Irajian G, Siddig EE, Fattahi A. Determination of the frequency of β-lactamase genes (bla SHV, bla TEM, bla CTX-M) and phylogenetic groups among ESBL-producing uropathogenic Escherichia coli isolated from outpatients. J Lab Med. 2020;44:27–33. doi: 10.1515/labmed-2018-0136. [DOI] [Google Scholar]
  • 70.Rozwadowski M, Gawel D. Molecular factors and mechanisms driving multidrug resistance in uropathogenic Escherichia coli—an update. Genes. 2022;13:1397. doi: 10.3390/genes13081397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Alqasim A, Abu Jaffal A, Alyousef AA (2018) Prevalence of multidrug resistance and extended-spectrum β-lactamase carriage of clinical uropathogenic Escherichia coli isolates in Riyadh, Saudi Arabia. Int J Microbiol 2018 [DOI] [PMC free article] [PubMed]
  • 72.Al-Dahmoshi HO, Al-Khafaji NS, Al-Allak MH (2020) Antibiotic resistance among Iraqi local E. coli isolates. In: E. coli infections-importance of early diagnosis and efficient Treatment. IntechOpen
  • 73.Hama-Soor TA, Salih SS, Muhamad SJ. The β-lactamase profile of Escherichia coli isolates from patients with urinary tract infections in teaching hospital in Sulaimani, Iraq. Ann Parasitol. 2021;67:659–670. doi: 10.17420/ap6704.382. [DOI] [PubMed] [Google Scholar]

Articles from Indian Journal of Microbiology are provided here courtesy of Springer

RESOURCES