Establishment of a Novel Cellular Model for Alzheimer’s Disease in vitro Studies

Abstract

Alzheimer’s disease (AD) is a neurodegenerative disease characterized by memory loss, cognitive impairment, and behavioral and psychological symptoms of dementia. The limited efficacy of drugs for the treatment of neurodegenerative diseases reflects their complex etiology and pathogenesis. A novel in vitro model may help to bridge the gap between existing preclinical animal models and human clinical trials, thus identifying promising therapeutic targets that can be explored in upcoming clinical trials. By assisting in the identification of the mechanism of action and potential dangers, in vitro testing can also shorten the time and expense of translation. Aim: As a result of these factors, our objective is to develop a powerful and informative cellular model of AD within a short period of time.

Through triggering the MAPK and NF- κβ signaling pathways with the aid of small chemical compounds (PAF C-16 and BetA), respectively, in mouse microglial (SIM-A9) and neuroblast Neuro-2a (N2a) cell lines. Results: PAF C-16, initiated an activation effect at a concentration of 3.12 nM to 25 nM in the SIM-A9 and N2a cell lines after 72 hours. BetA, activated the NF-κβ pathway with a concentration of 12.5 nM to 25 nM in the SIM-A9 and N2a cell lines after 72 hours. The combination of the activator chemicals provided suitable activation for MEK1/2-ERK and NF-κβ in more than three subcultures. Activators significantly initiate APP and MAPT gene expression, as well as the expression of proteins APP, β. Amyloid, tau, and p-tau. The activation of the targeted pathways leads to significant morphological changes. Conclusion: We can infer that the MEK1/2-ERK and NF- κβ pathways, respectively, are directly activated by the PAF C-16 and BetA chemicals. The activation of MEK1/2-ERK pathway results in the activation of the APP gene, which in turn activates the β. Amyloid protein, which in turn results in plaque. Furthermore, NF-κβ activation results in the activation of the MAPT gene, which leads to Tau and p-Tau protein activation, which ultimately results in tangles. This can be put into practice in just three days, with a high level of activity and stability that is passed down to the next three generations (subculture), with significant morphological changes. In microglial and neuroblast cell lines, we were successful in creating a novel AD-cell model.

Graphical Abstract

Introduction:

Alzheimer’s disease (AD) is a crucial area for biomedical study because it is one of the most prevalent neurodegenerative illnesses. It is the most common cause of dementia, attributing to 60–70% of all cases worldwide [1]. Over 55 million individuals worldwide currently have dementia and an estimated 10 million new cases are reported annually [2]. In the United States, many individuals suffer from AD or another form of dementia. In 2050, 88 million Americans aged 65 and older will suffer from this disease, an increase from 58 million in 2021. A significant proportion of Americans aged 65 and over are considered to be part of the “baby boom generation” and are at the greatest risk of developing AD as a result of their advanced age [3].

AD is a slowly progressing brain disease that begins long before symptoms develop. AD patients exhibit a progressive loss of memory and mental abilities in the linguistic, visuospatial, and executive domains [4]. The buildup of the protein beta-amyloid (Aβ) peptide (plaques) outside of neurons and the development of neurofibrillary (tangles) (NFTs) by hyperphosphorylated Tau protein inside of neurons in the brain are the hallmark diseases of AD. Neuronal loss and brain tissue damage accompany these alterations [5]. The amyloid precursor protein (APP) gene is sequentially cleaved to produce the Aβ, while the microtubule associated protein Tau (MAPT) gene is the encoded gene for Tau protein [5, 6].

According to several studies, the buildup of pathogenic Aβ aggregates and hyperphosphorylated Tau protein in neurofibrillary plaques, as well as neuroinflammation, oxidative stress, and other characteristics of AD, have all been linked to mitogen-activated protein kinases (MAPKs) activation [7] [8, 9]. While extracellular regulated kinases (ERK1/2) activities are altered at all stages of this illness, including those with minimal clinical symptoms, MAPK activity is only related with mild and severe stages of AD [10].

The primary route through which extracellular signals, such as inflammatory cytokines and reactive oxygen species, are transferred from the plasma membrane to the nucleus is MAPK pathways. Among them, the central nervous system benefits from the ERK1/2 pathway [11]. The cytosolic targets of ERK, which participate in the creation of pathological hallmarks and in neurodegeneration, include several of the proteins that result in pathological deposits in the brain during AD, such as Tau protein and Aβ [12, 13]. Furthermore, Dr. Faucher and his colleagues have demonstrated that in the early stages of AD, Aβ aggregates can activate the ERK1/2 signaling pathway (SP) in the brain [14, 15].

The fact that Tau pathology and toxicity are complex and cell-type-specific is demonstrated by the protection against Tau-mediated cognitive deficits through the inactivation of microglial nuclear factor kappa β (NF-κβ) despite increased Tau inclusions. Importantly, microglial NF-κβ activation leads to Tau-accumulation, which mediates neuronal toxicity and cognitive impairments [16]. NF-κβ, a transcriptional regulator, expresses several genes that code for proteins important for immune response, inflammation, cell proliferation, survival, and apoptosis [17, 18]. An inflammatory response and oxidative stress play a role in some pathological circumstances, including ischemic stroke, autoimmune diseases, and neurodegenerative diseases like AD [19–21]. The transcription of certain genes occur in response to the activation of NF-κβ by a variety of cellular stress stimuli that amplify the cellular stress response, such as the production of cytokines (tumor necrosis factor TNFα, Interleukin-1, growth factors), neurotrophic factors, or viral infections [22]. Consequently, NF-κβ signaling plays a crucial role in a variety of physiological activities, as well as in several pathological conditions, where it is negatively regulated through either activating or suppressing its target genes [19].

Small chemical compounds such as U-0126 (1,4-Diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene), which is the ‘code’ name for a compound. It is a non-ATP competitive inhibitor of mitogen-activated protein kinase (MEK) isoforms MEK1 and MEK2. Some researchers have utilized it as a means of deactivating the MAPK pathway [23–28]. While PAF C-16, also known as platelet-activating factor C-16, is an activator of PAF-R, MAP kinase, and MAP kinase kinase. In response to inflammation, immune cells, such as monocytes and macrophages, produce this naturally occurring phospholipid. Researchers have reported that human macrophages produce IL-6 and reactive oxygen species as a result of their interaction with PAF G-protein-coupled receptors (PAFR). Other researchers have also used it to activate the MAPK pathway. [29–33].

Furthermore, QNZ ((E)-3-(2-(4-cyanostyryl)-4-oxoquinazolin-3(4H)-yl) benzoic acid), which is a quinazoline derivative that inhibits NF-κβ activation. NF-κβ enhances the transcription of pro-inflammatory cytokines, and QNZ inhibits lipopolysaccharide (LPS)-stimulated TNFα production in mouse splenocytes, as well as CXCL1-mediated pro-inflammatory increase in potassium currents in adult rat neurons [34–37]. In contrast, Betulinic Acid (BetA), which is a cytotoxic compound isolated from naturally occurring pentacyclic triterpenoids. Several biological activities have been associated with it; it has been used by many researchers as an activator for the NF-κβ pathway [38–40].

The ineffectiveness of medications used to treat neurodegenerative illnesses reflects their complicated pathophysiology and etiology. Multiple risk factors, such as genetic predispositions and environmental triggers, combined with aging, contribute to their susceptibility. To determine the underlying molecular pathways and associated pharmaceutical targets, more research is needed. The recent failure of several clinical trials aimed at neurodegenerative diseases has raised questions about the applicability of animal disease models to human patients, in addition to the ethical issues surrounding their use in medical research. This has led to a demand for better research tools in this area [41, 42].

Aim of the work:

By bridging the gap between present pre-clinical animal models and humans using novel in vitro models, it may be possible to identify promising therapeutic targets that can be examined in upcoming clinical trials. In vitro testing can also shorten the time and expense of translation by assisting in the identification of the mechanism of action and any potential dangers [43]. In light of these factors, our aim is to simulate the onset of AD in mouse microglial (SIM-A9) and neuroblast Neuro-2a (N2a) cell lines by triggering the MAPK and NF-κβ signaling pathways with the aid of small chemical compounds (PAF C-16 and BetA), respectively, since the MAPK kinase pathway targets APP activation, then β. Amyloid protein activation leading to Aβ accumulation, while the NF-κβ pathway targets Tau protein activation, which leads to Tau phosphorylation accumulation.

Materials and Methods:

Study design:

Our study involves two different groups in which we will regress their values against those of the control group as a blank. First, we will deactivate the MEK1/2- ERK, and NF-κβ pathways by using U-0126 and QNZ, respectively. It is then used as a negative control for MEK1/2-ERK and NF-κβ pathways. Second, we will activate the MEK1/2-ERK, and NF-κβ pathways by using PAF C-16 and BetA, respectively. We will then check the activity of MEK1/2- ERK and NF-κβ pathways in comparison with the blank and negative control groups (Fig. 1).

Fig. 1:

In this diagram, we illustrate the hypothesis that underlies our study design. We will regress the values of two groups against those of the control group as a blank. First, we will deactivate the MEK1/2- ERK, and NF-κβ pathways using U-0126 and QNZ, respectively. It is then used as a negative control for MEK1/2-ERK and NF-κβ pathways. Second, we will activate the MEK1/2-ERK, and NF-κβ pathways by using PAF C-16 and BetA, respectively. We will then check the activity of MEK1/2- ERK and NF-κβ pathways in comparison with the blank and negative control groups, through APP and MAPT gene expression, in addition to APP, β.Amyloid, Tau, p-Tau, MAPK, and NF-κβ protein expression.

Small chemical molecules:

U-0126 as a MEK/ERK (MEK1 and MEK2) pathway inhibitor, catalog # (73522) 1 mg [23–28], and QNZ as a NF-κβ pathway inhibitor, catalog # (73352) 1 mg [34–37] (Stemcell Technologies). PAF C-16 as a MAPK kinase pathway activator, catalog # (5 F0922) 5 mg [29–33], and BetA as a NF-κβ pathway activator, catalog # (G0122) 25 mg [38–40] (Chem Cruz), were used as a small chemical molecule.

Cell Culture:

SIM-A9 (ATCC^® CRL3265^™) and N2a (ATCC^® CCL-131^™) were obtained from ATCC (Manassas, VA, USA). SIM-A9, a cell line of mouse microglial cell was cultured in a 6-well plate at a cell density of 1.6×10⁵ cells per well or 96-well plate at a cell density of ∼8×10³ cells per well in complete growth medium Modified Eagle Medium/NutrientMixture F-12 (DMEM:F-12) supplemented with heat inactivated fetal bovine serum (FBS) (10% v/v), heat inactivated horse serum (5% v/v) (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), and 1 % phosphatidyl serine (PS) was added. When the cell achieved 80% confluence, the medium was changed to complete growth medium without PS [44]. N2a, a cell line of mouse neuroblast cell was cultured in a 6-well plate at a cell density of 7×10⁵ cells per well or 96-well plate at a cell density of 7×10⁴ cells per well in ATCC-formulated Eagles Minimum Essential Medium (EMEM) supplemented with heat inactivated FBS (10% v/v) (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA). When the cell achieved 70–80% confluence, the medium was changed to complete growth medium [45]. All cell cultures were maintained in a standard incubator at 37^o C in 5% CO2 and 95% air.

Cell proliferation assessment:

The effect of the inhibitors (U-0126 and QNZ) and the activators (PAF C-16 and BetA) with variable concentrations on SIM-A9 and N2a proliferation were assessed using Cell counting kit-8 (CCK-8) assay (Dojindo Laboratories, Kumamoto, Japan) following the manufacturer’s instructions. After 24 hours of incubation, cells were treated with 10 % CCK-8 for approximately 2 hours. The optical density (OD) value was determined at 450 nm using a microplate reader to calculate cell proliferation. The suitable molar concentration (IC50) for the studied chemicals was calculated based on the readings of the CCK-8 test by using AAT Bioquest online tools (https://www.aatbio.com).

Gene expression evaluation:

APP and MAPT genes were used to evaluate the gene expression inhibition or activation level of Aβ and Tau protein, respectively. SIM-A9 and N2a cells were collected from the plate after 24, 48, and 72 hours to evaluate the suitable effect time of the studied chemicals. Then, the total RNA was extracted using Quick-RNA Miniprep Kit (ZYMO Research, Irvine, CA, USA). 1 μg of total RNA was used for reverse transcription using the M-MLV Reverse Transcriptase (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. For quantitative reverse transcriptase PCR (qRT-PCR), PowerUp SYBR Green Master Mix (Thermo Scientific) was used and conducted on a Bio-Rad iQ5 thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA) with primers of App Forward; TCCGTGTGATCTACGAGCGCAT, Reverse; GCCAAGACATCGTCGGAGTAGT and Mapt Forward; AATCGACAGAAGGCGAGGAC, Reverse; CCCTGGACTAGACAAAGGCTG. Differences in expression were evaluated by the comparative cycle threshold method using Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a control.

Western Blot:

For sample preparation, approximately 40,000 cells of the SIM-A9 cell line and approximately 90,000 cells of N2a cell line were plated on 24-well plates for 72 hrs. The cells were collected directly in 100 μL protein sample buffer (#2463560, Invitrogen) and then denatured at 90 °C for 10 min. Individual samples of 15 μL were loaded in each lane. Western blot was then carried out following standard protocols. Primary antibodies used were APP (#PA5-19923, Invitrogen), β. Amyloid (1–42) (D3E10 , Cell signaling), Tau protein (#PA5-27287, Invitrogen), Phospho-Tau (Ser404) (D2Z4G, Cell signaling), MAPK (Erk 1/2) p44/42 137F5 (#4695, Cell signaling), and NF-κβ p65 (D14E12, Cell signaling). Three separate blot analyses of the samples were conducted. Optical densitometry was used to semi quantify the bands and ImageJ digital imaging processing software was used for analysis (ImageJ 1.53t, National Institutes of Health, Bethesda, MD, USA). GAPDH has been used as an endogenous control to normalize the expression of each protein under investigation.

Morphological investigation:

Cell morphology was assessed by bright field imaging with an inverted Olympus IMT-2 microscope [X50] from 0 to 72 hours of treatment. Living photos were taken within a range of 20 pictures for each treatment in the studied cell lines. The percent of mature cells and branched cells in different samples were calculated depending on the labeling index (the ratio of positively stained cells/total cells×100). Scale bar=50 μm.

AD-Positive control:

SIM-A9 and N2a cell lines were treated for 24 hours with (1 μg/ml) lipopolysaccharide (LPS) (Escherichia coli 026:B6 in aqueous solution, Invitrogen, Thermo Fisher Scientific), and we used it as a positive control for our study [46, 47]. The positive control was used to compare with our cell model regarding the morphological changes. The positive control was also used to confirm and compare the protein expression of MEK1/2-ERK and NF-κβ activity after serial seeding.

Acridine Orange/Ethidium Bromide (AO/EB) staining:

For determining live, apoptotic, and necrotic cells, the assays were performed in accordance with Ribble et al. [48]. We prepared EB and AO cocktails in phosphate-buffered saline (100 mg/mL). After 72 hours of treatment with the activator chemicals at a concentration of 25 nM, the cells were incubated with a cocktail of EB/AO (100 mg/mL) for 3 minutes for qualitative analysis of apoptotic cells. Apoptotic cell was assessed by counting 600 cell imaging with an inverted fluorescence Nikon ECLIPSE TE2000-S microscope [X40]. The average percentage of bright orange cells were taken after EB/AO staining for 3 minutes. The percent of bright orange cells in different samples were calculated depending on the labeling index (the ratio of positively stained cells/total cells×100). Green stained cells were counted as live cells and bright orange stained cells were counted as apoptotic cells.

Confocal localization of proteins:

To confirm our hypothesis about the model’s stability, we determined the protein localization of all the targeted proteins in the study. We conducted the assays according to the guidelines provided by Toshiyuki M. [49]. The Nikon A1R inverted confocal microscope [40X] objective was used with the NIS Elements Advanced Research Software to detect the localization of all target proteins, including “AB, p-Tau, MABK, and NF-KB”. Confocal microscopy was performed following 72 hours of treatment with the activator chemicals at a concentration of 25 nM in accordance with standard protocols for protein localization[50]. For the preparation of the samples, approximately 80,000 SIM-A9 cells and approximately 175,000 N2a cells were plated over coverslips in 12-well plates for 72 hours. It was fixed with 4% paraformaldehyde solution (pH 7.4) (420801, BolLegend, CA 92121 USA), and then permeabilized with 500 mL of permeabilization buffer (0.05–0.3% Triton X-100) (BP151-100, 223834, Fisher Bioreagents, USA). By adding 3% BSA to 1X PBS, the cell was blocked. The 500 liters of PBS were used three times for five minutes each to wash between the previous steps. The antibody dilution buffer was composed of 1% BSA in 1X PBST. Antibodies used as primary antibodies were β. Amyloid (D54D2) XP (Rabbit mAb, Cell signaling), Phospho-Tau (Thr181) (D9F4G) (Rabbit mAb, Cell signaling), p44/42 MAPK (Erk 1/2) 137F5 (Rabbit mAb, Cell signaling), and NF-κβ p65 (D14E12) XP (Rabbit mAb, Cell signaling). As a secondary antibody, we used Anti-rabbit IgG (H+L), F(ab’)22 Fragment (Alexa Fluor 488 conjugate). A digital imaging processing program named ImageJ was used for the analysis of the figures (ImageJ 1.53t, National Institutes of Health, Bethesda, MD, USA).

Statistical analysis:

The data were analyzed using Microsoft Excel 365 and statistical package for social science ‘IBM SPSS Statistics for Windows, version 28 (IBM Corp., Armonk, N.Y., USA)’. Continuous normally distributed variables were represented as mean ± SD with 95% confidence interval and a p value < 0.05 to be considered statistically significant. To compare the means of normally distributed variables between groups, a Student’s t test was performed. The percent of branched mature cells in different samples was calculated depending on the labeling index (the ratio of positively stained cells/total cells×100), while the χ² test was used to determine the distribution between groups. Gene expression of the studied genes was calculated based on the fold-change method, according to the Law of Fold-Change, which is 2^−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. IC50 was calculated using the average of 5 replicates for each chemical concentration, while the IC50 was determined using the Law of IC50: IC50 = (0.5 - b)/a.

Results:

Cell viability:

To determine the suitable concentration of MAPK and NF-κβ along with inhibitor or activator chemicals, we began at concentrations of 1000, 500, 250, 125, 62.5, 31.25, 15.6, 7.5, and 0 nM for the inhibitor chemicals (U-0126 and QNZ) respectively, and concentrations of 200, 100, 50, 25, 12.5, 6.25, 3.12, 1.56, and 0 nM for the activator chemicals (PAF C-16 and BetA) respectively. In addition, we made a combination between each inhibitor or activator to assess the combination total effect on the MAPK and NF-κβ pathways with either inhibition or activation.

The results showed that the appropriate concentration for U-0126 (MEK1/2-ERK inhibitor) is 57.2 nM in SIM-A9 and 121.6 nM in the N2a cell lines. It was also shown that the optimal QNZ (NF-κβ inhibitor) concentration for SIM-A9 and N2a cell lines was 58.8 nM and 70.1 nM, respectively. In the case of the combination of the inhibitor chemicals, U-0126 and QNZ (MEK1/2-ERK & NF-kβ), the concentrations were found to be 45.0 nM in SIM-A9 while in the N2a cell line the concentration was 65.1 nM. Therefore, we selected 31.25 nM as the optimal concentration from the results.

The results also showed that the appropriate concentration for PAF C-16 (MEK1/2-ERK activator) was 39.7 nM in SIM-A9 and 46.7 nM in the N2a cell lines. BetA (NF-κβ activator) was shown in SIM-A9 at 25.8 nM and 44.8 nM in the N2a cell lines. The combination between the activator chemicals PAF C-16 and BetA (MEK1/2-ERK & NF-kβ) resulted in a concentration of 25.7 nM in SIM-A9 and 39.0 nM in the N2a cell lines (Table 1), (Fig. 2).

Table 1:

IC50 summary of the inhibitor chemicals “U-0126 and QNZ” and activator chemicals “PAF C-16 and BetA” in the studied cell lines

Aimed Pathways	Inhibitor			Activator
	S. chemicals	IC50		S. chemicals	IC50
		SIM-A9	N2a		SIM-A9	N2a
MEK1/2-ERK	U-0126	57.2 nM	121.6 nM	PAF C-16	39.7 nM	46.7 nM
NF-kB	QNZ	58.8 nM	70.1 nM	BetA	25.8 nM	44.8 nM
MEK1/2-ERK & NF-kB	U-0126 & QNZ	45.0 nM	65.1 nM	PAF C-16 & BetA	25.7 nM	39.0 nM

Fig. 2:

A CCK8 method was used to determine the cell viability percentage under the effect of the studied chemicals in serial concentration and the chemical concentration required to decrease cell viability by 50%. The half maximal inhibitory concentration (IC50) was used to determine the potency of inhibitor chemicals “U-0126 and QNZ” and activator chemicals “PAF C-16 and BetA” in inhibiting the viability rate of the studied cell lines “SIM-A9 and N2a”. IC50 was calculated using the average of 5 replicates for each chemical concentration, while the IC50 was determined using the Law of IC50: IC50 = (0.5 - b)/a. To calculate IC50, one would need a series of dose-response data (drug concentrations x1, x2, ...,xn and growth inhibition y1, y2, ...,yn). The values of y are in the range of 0–1. The simplest estimate of IC50 is to plot an x-y graph and fit the data in a straight line (linear regression). The IC50 value is then estimated by a fitted line, Y = a X + b. (n = 5, student t-test), Significances are shown in the above dots: *P < 0.01 vs. negative control (NC), NS; Non-significant.

Activation perimeters:

Based on the solid base, which explains that the APP gene is sequentially cleaved to produce the Aβ, while the MAPT gene is the encoded gene for Tau protein [5, 6]. To confirm our hypothesis, we used the genes APP and MAPT (Fig. 1). Since activation of the MAPK pathway results in selective activation of the APP gene, which enhances the activation of the β. Amyloid protein, which results in the accumulation of amyloid outside of neurons, leading to plaque formation, which is one of AD hallmarks. While NF-κβ pathway activation leads to targeted Tau protein activation, which causes Tau phosphorylation accumulation inside neurons, which contributes to neurofibrillary tangle formation, which is a main second hallmark of AD. Therefore, we used the APP and MAPT genes as molecular agents, to determine whether the chemicals we used inhibited or activated the targeted pathways (MAPK and NF-κβ).

We checked the inhibition and activation effects of the studied pathways MAPK and NF-κβ through the detection of APP and MAPT gene expression, respectively. The results showed that U-0126 began to inhibit APP gene expression after 48 hours with a concentration of 31.25 nM (p. value < 0.001) in SIM-A9 cell line and (p. value < 0.01) in N2a cell line (Fig. 3a), whereas PAF C-16 began to activate after 72 hours with a concentration of 3.12 nM (p. value < 0.001) in SIM-A9 cell line and (p. value = 0.02) in N2a cell line (Fig. 3b).

Fig. 3:

APP gene expression was measured to estimate the activity level of the MAPK signaling pathway in the studied cell lines under the effects of a) U-0126 as an inhibitor chemical and b) PAF C-16 as an activator chemical. MAPT gene expression was measured to estimate the activity level of NF-κβ signaling pathway in the studied cell lines under the effects of c) QNZ as an inhibitor chemical and d) BetA as an activator chemical. Gene expression of the APP and MAPT genes was calculated using three replicates for the fold-change, while the fold-change is calculated using the Law of Fold-change, which is 2^−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. Values are mean ± SD (n = 3 for each concentration, student t-test). The significance is shown above the dots: *P < 0.05 vs. 0 nM concentration.

While the QNZ began to inhibit MAPT gene expression after 48 hours, starting from a concentration of 1.87 nM in both cell lines (p. value < 0.01), as well as in the higher concentrations. (Fig. 3c), whereas BetA began to activate after 72 hours with a concentration of 12.5 nM (p. value = 0.01) in SIM-A9 cell line and (p. value < 0.001) in N2a cell line (Fig. 3d).

We relied on the fold-change value of the APP and MAPT genes to determine whether the activity is high or not. If the value is higher than the fixed cut-off point of one, this indicated activation of the targeted gene, whereas if it is less than that, this indicated the suppression of the targeted gene.

Activation perimeters under the combination effect:

In addition, we examined the inhibition and activation effects of the studied pathways MAPK & NF-κβ after treatments with the following chemical combinations: inhibitors (U-0126 & QNZ) and activators (PAF C-16 & BetA).

The results showed that the inhibitor chemicals started the inhibition effect on APP and MAPT gene expression after 72 hours, starting from a concentration of 1.87 nM in SIM-A9 cell line (p. value < 0.01) and higher concentrations were also observed (Fig. 4a). The inhibition of the APP and MAPT genes in N2a cell line started after 72 hours at a concentration of 3.75 nM and higher concentrations were also observed (p. value < 0.01) (Fig. 4b).

Fig. 4:

APP and MAPT gene expressions were measured to estimate the activity level of MAPK and NF-κβ signaling pathways under the effect of the studied chemical combination, respectively. U-0126 and QNZ acted as inhibitor chemicals in a) SIM-A9 cell lines and b) N2a cell lines. PAF C-16 and BetA acted as activator chemicals in c) SIM-A9 cell lines and d) N2a cell lines. Gene expression of the APP and MAPT genes were calculated using three replicates for the fold-change, while the fold-change was calculated using the Law of Fold-change, which is 2^−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. Values are mean ± SD (n = 3 for each concentration, student t-test). The significance is shown above the dots: *P < 0.05 vs. 0 nM concentration.

The results under the activation effect showed that the activator chemicals started the activation effect on APP and MAPT gene expression after 72 hours, starting from a concentration of 1.56 nM in SIM-A9 cell line (p. value < 0.01 and higher concentrations were also observed (Fig. 4c). APP and MAPT genes were activated in N2a cells after 48 hours at a concentration of 3.12 nM (p < 0.01) and after 72 hours from a concentration of 6.25 nM (p < 0.01) and in both time periods, higher concentrations were also observed (Fig. 4d).

Activation of the targeted pathways:

To confirm the activation of the targeted pathways (MAPK and NF-κβ) beyond gene expression evaluation, we evaluated protein expression of the targeted markers (MAPK and NF-κβ). As well as pathway-specific markers (APP and Tau), and downstream signaling markers (B. Amyloid, and p-Tau).

To learn more about the effects of the small chemical molecules used in activation, we examined the protein expression of APP, β Amyloid, Tau protein, p-Tau, MAPK, and NF-κβ by Western Blot. We found that inhibiting the small chemical molecules significantly suppress the protein expression of the studied pathways. We also found that these activator chemicals are powerful chemicals best known for activating the APP, and Aβ through the MAPK pathway and Tau in addition to p-Tau proteins through the NF-κβ pathway (Fig. 5).

Fig. 5:

Western blot analysis and relative quantification of the targeted protein were analyzed in the following studied cell lines: (a) APP in SIM-A9 cell line; (b) APP in N2a cell line; (c) β-Amyloid in SIM-A9 cell line; (d) β-Amyloid in N2a cell line; (e) Tau in SIM-A9 cell line; (f) Tau in N2a cell line; (g) p-Tau in SIM-A9 cell line; (h) p-Tau in N2a cell line; (i) MAPK in SIM-A9 cell line; (j) MAPK in N2a cell line; (k) NF-kβ in SIM-A9 cell line; (l) NF-kβ in N2a cell line; and (m) representative western blot of protein expression of APP, Tau protein, MAPK, and NF- kβ in the studied cell lines, for three days after treatment with the inhibitor and activator chemicals. Three separate blot analyses of the samples were conducted. Optical densitometry was used to semi-quantify the bands and ImageJ (1.53t) digital imaging processing software was used for analysis. In terms of protein expression, GAPDH serves as an endogenous control. Protein levels are represented as mean ± SD ratio values quantified from the targeted protein bands versus GAPDH compared to the negative control. (n = 3, student t-test); significances are shown above the bars: **P < 0.01 vs. negative control.

Morphological changes:

We took a living photo for the studied cell line after three days of treatment. We found that the normal SIM-A9 cell line has fusiform and bipolar appearances, indicating 60 % cellular differentiation with long branched process. We also found that the N2a cell line appears to have many matured cells with numerous long branched processes at 40% (Fig. 6 a, b). Morphological changes in the studied cell line under the effect of PAF C-16 to activate MAPK kinase showed that the SIM-A9 cell line appears to show complete branched reduction at 10% fine branched processes, with evidence of clustering of degenerated cells and no signs of maturation. The N2a cell line appeared to show a little branched reduction and clustering of degenerated cells, while not showing evidence of maturation at 15% (Fig. 6 c, d). In the case of the activation of NF-κβ by BetA, the SIM-A9 appears to show complete branched reduction, with only 5% evidence of maturation and clustering of degenerated cells. While the N2a shows signs of cellular degeneration with a few pyramidal cells with 5% short branches (Fig. 6 e, f). The morphological changes under the combination of PAF C-16 and BetA to activate MAPK and NF-κβ showed that there no evidence of maturation (0%) with strong clustering of degenerated cells in SIM-A9 and N2a cell lines (Fig. 6 g, h). All the morphological changes for our model were superior when compared with the positive control “LPS” (Fig. 6 i, j).

Fig. 6:

AD-activated cells with normal cell lines and the positive control “LPS” were compared through activation of the MAPK and NF-kβ pathways simultaneously in the following conditions: a) SIM-A9 in normal condition; b) N2a in normal condition; c) SIM-A9 under MAPK activation by PAF C-16; d) N2a under MAPK activation by PAF C-16; e) SIM-A9 under NF-kβ activation by BetA; f) N2a under NF-kβ activation by BetA; g) SIM-A9 under MAPK and NF-kβ activation by PAF C-16 and BetA respectively; h) N2a under MAPK and NF-kβ activation by PAF C-16 and BetA respectively. Positive control “LPS” was used in (i) SIM-A9 and j) N2a cell lines. Cell morphology was assessed by bright field imaging with an inverted Olympus IMT-2 microscope [X50] from 0 to 72 hours after treatment. K) The average percentage of mature branches were taken within a range of 20 fields for each treatment in the studied cell lines. The percent of branched mature cells in different samples were calculated depending on the labeling index (the ratio of positively stained cells/total cells×100). (n = 20, X² test); significances are shown above the bars: **P < 0.01 vs. the normal group. Scale bar = 50 μm.

Stability of the activated pathways:

We checked the MAPK and NF-κβ pathway activities in the studied cell line through the following criteria: after 72 hours of treatment with the activator chemicals at a concentration of 25 nM, the cell line was collected by a scraper and centrifuged for 5 minutes at 1000 rpm and then reseeded in a new plate. We divided the cells every two days and repeated this step two more times after. The gene expression of APP and MAPT was assessed with a comparison to a negative control “un-activated” group, as well as with 1st activated passage (original activated batch) group. The results showed that the MAPK and NF-κβ pathways were still active after serial subculture in both studded cell lines when compared to the negative control or the original activated batch (Fig. 7 a, b). Interestingly, the pathways were also still active under the influence of chemical combination effects (Fig. 7 c, d).

Fig. 7:

Pathway activity state after serial seeding from the 1st activated passage in the studied cell lines were analyzed: a) APP gene expression to determine the activity state of the MEK1/2-ERK pathway under the effect of PAF C-16; and b) MAPT gene expression to determine the activity state of the NF-kβ pathway under the effect of BetA. APP and MAPT gene expressions were studied to determine the activity state of MEK1/2-ERK and NF-kβ pathways under the effect of PAF C-16 and BetA combinations in c) SIM-A9 cell lines and d) N2a cell lines. Each subculture provided three samples and we created three replicates from each sample. Gene expression of the APP and MAPT genes were calculated using three replicates for the fold-change. The fold-change is calculated using the Law of Fold-change, which is 2^−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. Values are mean ± SD (n = 3 for each concentration, student t-test). The significance is shown above the dots: Black P < 0.05 vs. NC; Red P < 0.05 vs. original activated batch ; NC = negative control.

The MAPK and NF-κβ protein expression was assessed after serial seeding by W.B. The protein expression was done to confirm that the activity of MAPK and NF-κβ pathways were still active after serial seeding from the original activated batch. Whereas we used the positive control to confirm our results [46, 47].

The results showed that the MAPK pathway was still active after three subcultures from the original activated batch, compared with the negative control (p value <0.01) in SIM-A9 and N2a cell lines. The results were also compared to the positive control (p value <0.01) in the 1st and 2nd subcultures, as well as the 3rd subculture (p value < 0.05) in SIM-A9 and (p value <0.01) in N2a (Fig. 8 a, c).

Fig. 8:

Western blot analysis and relative quantification of the MAPK and NF- kβ were analyzed to determine the pathway activity state after serial seeding from the 1st activated passage in the following: (a) MAPK pathway; (b) NF- kβ pathway; (c) representative western blot of protein expression of MAPK and NF- kβ, for three subcultures from the 1st activated passage in the studied cell lines, in comparisons with normal cell lines and the positive control “LPS”. Three separate blot analyses of the samples were conducted. Optical densitometry was used to semi-quantify the bands and ImageJ (1.53t) digital imaging processing software was used for analysis. In terms of protein expression, GAPDH serves as an endogenous control. Protein levels are represented as mean ± SD ratio values quantified from the targeted protein bands versus GAPDH compared to the negative control. (n = 3, student t-test); significances are shown above the bars: **P < 0.01 vs. negative control; ^#P < 0.05 or ^##P < 0.01 vs. positive control.

In SIM-A9 and N2a cell lines, NF-κβ protein expression remained active after three subcultures from the original activated batch as compared to the negative control (p value <0.01). In the first and second subcultures, the findings were also compared to the positive control (p value <0.01); in the third subculture, SIM-A9 and N2a (p value <0.05) (Fig. 8 b, c).

Analyze the model’s stability:

1. Successful protection test: To demonstrating the validity of successful protection of our AD cell model, we evaluated the effect of MAPK and NF-κβ inhibitor chemicals combination U-0126 and QNZ (31.25 nM) on a stable AD cell model induced by PAF C-16 and BetA. The expression of the APP and MAPT genes was evaluated 24, 48, and 72 hours after inhibition of an established activation model “original activated batch”. This model was treated with the MAPK and NF-κβ inhibitor chemicals “U-0126 and QNZ”.

   The results showed that the inhibitor chemicals did not affect the activation of APP and MAPT gene expression after 24, 48, and 72 hours in SIM-A9 cell line (p. value < 0.001) when compared to negative control. When compared to the original activated batch, there was no significant difference after 24 hours, but APP and MAPT expression significantly increased after 48 and 72 hours (p. value < 0.001) (Fig. 9a).

   There was a significant increase in APP and MAPT expression in the N2a cell line after 24 and 48 hours (p 0.01) compared to the negative control. Comparatively to the original activated batch, the expression of both APP and MAPT was slightly decreased (p 0.001), but it was upregulated for 48 hours compared to the negative control. After 72 hours, the inhibitor chemicals significantly affected the expression of APP and MAPT in comparison with either the negative control or the original activated batch (p< 0.001) (Fig. 9b).

2. Apoptosis estimation: There is evidence that massive neuronal death due to apoptosis occurs frequently in the brains of patients suffering from neurodegenerative diseases, and apoptotic cell death has been confirmed in neurons and glial cells of AD patients [51]. We evaluated our model to determine whether it would also exhibit apoptosis in microglia and neuroblast cell lines. AO/EB staining was used to evaluate the apoptosis percentage in the studied cell line after 72 hours of activation by the activated chemicals. As shown in Fig. 10, SIM-A (65%) and N2a (85%) cell lines showed a significant increase in apoptosis percentage when compared with the negative control (p<0.001).

3. Protein localization: We conducted confocal studies to confirm the quality of our AD cell model. The confocal microscopy was conducted following 72 hours of treatment with the activator chemicals at a concentration of 25 nM in accordance with standard protocols for protein localization [50]. According to the results, the SIM-A9 and N2a undifferentiated cells appear to have protein localization compared to the negative controls for all studied proteins, β. Amyloid, p-Tau, p44/42 MAPK (Erk 1/2), and NF-κβ (Fig. 11).

Fig. 9:

Successful protection test: APP and MAPT gene expressions were studied to determine the activity state of MEK1/2-ERK and NF-kβ pathways under the effect of U-0126 and QNZ combinations over the activated model, a) SIM-A9 cell lines and d) N2a cell lines. Each inhibited after activation model were provided three samples and we created three replicates from each sample. Gene expression of the APP and MAPT genes were calculated using three replicates for the fold-change. The fold-change is calculated using the Law of Fold-change, which is 2^−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. Values are mean ± SD (n = 3 for each concentration, student t-test). The significance is shown above the dots: * P < 0.05 vs. negative control; ^# P < 0.05 vs. original activated batch.

Fig. 10:

Apoptosis evaluation in the activated model. Morphological assays by EB/AO staining in cells to identify live and apoptotic cells with the fluorescence of green and bright orange, respectively. a) Negative control in SIM-A9 cell. b) Activated model in SIM-A9 cell. c) Negative control in N2a cell. d) Activated model in N2a cell. Apoptotic cell was assessed by counting 600 cell imaging with an inverted fluorescence Nikon ECLIPSE TE2000-S microscope [X40]. e) The average percentage of bright orange cells were taken after EB/AO staining for 3 minutes. The percent of bright orange cells in different samples were calculated depending on the labeling index (the ratio of positively stained cells/total cells×100). (n = 600, X² test); significances are shown above the bars: **P < 0.01 vs. the negative control. Scale bar = 50 μm.

Fig. 11:

Confocal studies of the studied proteins. The Nikon A1R inverted confocal microscope [40X] objective was used with the NIS Elements Advanced Research Software to detect the localization of all target proteins. Protein localization was determined by confocal microscopic analysis after transfecting the indicated proteins with β. Amyloid (D54D2) XP (Rabbit mAb, Cell signaling), Phospho-Tau (Thr181) (D9F4G) (Rabbit mAb, Cell signaling), p44/42 MAPK (Erk 1/2) 137F5 (Rabbit mAb, Cell signaling), and NF-κβ p65 (D14E12) XP (Rabbit mAb, Cell signaling) followed by Anti-rabbit IgG (H+L), F(ab’)22 Fragment (Alexa Fluor 488 conjugate). Thus, expression of the cellular genes shows green color, DAPI depicts the nucleus. DAPI in negative control in a) SIM-A9 and b) in N2a cell lines. β. Amyloid protein localization in c) SIM-A9 and d) in N2a cell lines. p-Tau protein localization in e) SIM-A9 and f) in N2a cell lines. MEK1/2-ERK protein localization in g) SIM-A9 and h) in N2a cell lines. NF-kβ protein localization in i) SIM-A9 and j) in N2a cell lines. Scale bar = 50 μm.

Discussion:

AD is a severe neurological disease that causes a progressive decline in the patient’s quality of life due to the profound loss of cognitive ability and behavioral control. Uncertainty exists over AD’s pathophysiology [52]. Since 1992, the amyloid cascade hypothesis has been used to explain the etiology and pathogenesis of AD. According to this theory, the buildup of pathogenetic amyloid protein, which is derived from APP, sets off a chain reaction that results in the accumulation of NFTs, neuronal cell death, and ultimately dementia [53]. The theory was revised to classify AD as a multifaceted disorder due to the failure of the anti-Aβ therapy, which also revealed the limitations of animal disease models, after the anti-Aβ therapy was largely successful in mouse models of AD [54]. Animal models of AD are only able to replicate early-onset familial Alzheimer’s disease (EOFAD), not the true pathophysiology of AD found in humans [55, 56]. In fact, animal models of AD frequently lack critical elements like significant neuronal loss and the emergence of NFTs, exhibiting just a subset of its clinical symptoms. Due to differences in sequence and structure, along with the short lifespan of mice, animal models do not give enough time for the accumulation of events that take decades in humans. In fact, one theory found the Tau protein was not found to be susceptible to aggregate formation in rodents [57].

Therefore, the creation of novel in vitro models based on the precise triggers for Aβ and Tau phosphorylation accumulations offers a potent complementary strategy to get around the drawbacks of the present AD transgenic mice. In this study, we aimed to establish a new cell model that depends on targeting the pathways responsible for activating both Aβ and Tau phosphorylation in microglial and neuroblast cell lines. This is in line with the study performed by Choi and his colleagues in 2015 who mentioned the inclusion of neuroinflammatory components is significant in the etiology of AD (such as microglial cells) as they will shed light on the viability of the amyloid hypothesis [58]. The next significant step in fully capturing AD in a cellular model will be the reconstruction of substantial neuronal death resulting from Aβ and Tau pathology.

Small chemical compound, U-0126, has been found to primarily target the RAF/MEK/ERK pathway [24]. It prevents the upstream MEK1/MEK2 from activating and influencing the activity of p38 MAPK, thereby preventing the activation of ERK1/2 [26]. This study revealed that U-0126, which acts as a selective, non-ATP competitive inhibitor of MEK isoforms MEK1 and MEK2, inhibits the MEK1/2-ERK pathway with a concentration of 31.25 nM in SIM-A9 and N2a cell lines after 48 hours. Our results were in line with the previous studies [24, 28], where they found that MEK1 and MEK2 were inhibited with IC50 values of 72 nM and 58 nM in COS-7 cell line and human monocytes cells respectively.

The quinazoline derivative (QNZ) inhibits nuclear factor NF-κβ activation. NF-κβ increases the transcription of pro-inflammatory cytokines and QNZ blocks the production of tumor necrosis factor (TNF) in mouse splenocytes induced by lipopolysaccharide (LPS) [35], as well as the pro-inflammatory increase in potassium currents mediated by CXCL1 in adult rat neurons [37]. In a typical screen, it does not inhibit kinases [36]. QNZ was found to begin its inhibitory effects between concentrations of 1.87 nM to 31.25 nM in SIM-A9 and N2a cell lines after 48 hours. However, a previous study found that the QNZ inhibits NF-κβ pathway activation with IC50 = 11 nM in human Jurkat T lymphocyte cells, while in mouse splenocytes with IC50 = 7 nM [35].

Another small chemical compound, PAF C-16, is an activator and ligand for the platelet activating factor receptor with a C16 alkane group. It also functions as a signaling lipid outside of cells. It has been demonstrated that PAF C-16 increases vascular permeability and subsequently causes inflammation. In CHO cells, PAF C-16 has been demonstrated to activate MAPK and MEK (MAP kinase kinase, MAPKK) [29–33]. Our results revealed that PAF C-16 started an activation effect from a concentration of 3.12 nM to 25 nM in SIM-A9 and N2a cell lines after 72 hours. PAF C-16 has also been found to activate MEK in SH-SY5Y cells with a value of 20 μM [29], while PAF increased the production of ³H-labeled inositol phosphates (IPs) with values of 1.2–1.5 nM [59].

BetA is a cytotoxic agent found in the bark of the Platanus acerifolia (plane) tree. Subunits p50 and p65 were present in BetA-induced NF-κβ DNA-binding complexes. Increased IKK activity, phosphorylation of Ikβ-a at serine 32/36, and Ikβ-a degradation were all implicated in BetA-induced NF-κβ activation [60]. We found that BetA activated the NF-κβ pathway with a concentration of 12.5 nM to 25 nM in SIM-A9 and N2a cell lines after 72 hours. These results were consistent with Kasperczyk H et al’s report [60], in which they found that BetA can activate NF-κβ in different cell lines, SH-SY5Y neuroblastoma and LN229 glioblastoma cells, after treatment for 12 and 24 hours with 6, 10, or 15 mg/ml BetA. Importantly, the results of these studies also mentioned a proapoptotic function of NF-κβ upon activation by BetA in many cell types without any indexes for an anti-apoptotic role of NF-κβ induced by BetA.

Many previous studies mentioned the inhibition role of U-0126 on the MEK1/2-ERK pathway, as well as the inhibitory effect of QNZ on NF-κβ pathway. Kim S et al. [61] states that ERK1/2 activation is required for cytokine signaling and inhibition of ERK1/2 can prevent activation of NF-κβ. Accordingly, the inhibitors were combined (U-0126 & QNZ) to determine the combination effect regarding the MEK1/2-ERK and NF-κβ pathways in our study, so were the activator chemicals (PAF C-16 & BetA).

Our results showed that the combination of U-0126 and QNZ inhibited the MAPK and NF-κβ pathways at the same time. The inhibition occurred after 72 hours with a concentration increase from 1.87 nM to 31.25 nM in the SIM-A9 cell line, while it occurred in the N2a cell line after 72 hours with a concentration increase of 3.75 nM to 31.25 nM. The combination of PAF C-16 and BetA activators resulted in an activation after 72 hours at a concentration of 1.56 nM to 25 nM in the SIM-A9 cell line, while the activation occurred in the N2a cell line after 48 hours with a concentration of 3.12 nM to 31.25 nM. It should also be noted that activation in the N2a cell line was also found after 72 hours with a concentration of 6.25 nM to 25 nM (Fig. 4). We found that the combination of U-0126 and QNZ had definite inhibitory effects, but it also resulted in the activation of the MAPK and NF-κβ when PAF C-16 and BetA were also combined. These results were verified through the protein expression results shown in Figure 5 (Fig. 5).

Evidence from two human studies with 7 and 8 AD cases each suggests that the microglia may undergo morphological changes in AD [62, 63]. In rodent models of AD [64, 65], as well as in post-mortem brains from AD patients [47, 66, 67], it has been extensively documented that AD is characterized by a decreased number of dendritic spines and a decreased level of synaptic proteins. These observations prompted us to investigate the morphological changes after the activation of MAPK and NF-κβ in comparison with the normal studied cell lines. Our results showed that the MAPK-activated cell line by PAF C-16 was a cluster of degenerated cells with branched reduction. Additionally, no evidence of maturation was found in either the SIM-A9 cell line or the N2a cell line. While the NF-κβ cell line activated by BetA showed clustering of degenerated cells, no evidence of maturation, and complete branched reduction in the SIM-A9 and N2a cell lines, a few pyramidal cells with short branches were observed. Under the activator combination effect, the cell lines showed no evidence of maturation, with strong clustering of degenerating cells and complete reduction of the branches (Fig. 6). Our results were consistent with the previous reports [47, 66, 68–71], which found that dendritic spines appear to be the most accurate measure of synaptic activity and cognitive performance.

Interestingly our results showed that the activated pathways were stable after three serial subcultures in the studied cell lines from the original activated batch, in comparison with the negative control or with the original activated batch (Fig. 7). Our findings through W.B. analysis revealed that even after repeated subcultures, the PAF C-16 and BetA combination induced more activation for the MAPK and NF-κβ pathways than the positive control “LPS” (Fig. 8) [46, 47]. This is a strong indicator that the activation of MAPK and NF-κβ through the PAF C-16 and BetA was genuine and constant for a significant period. It is anticipated that these results will allow researchers in the field of AD to obtain many answers to their questions within a short period of time.

From the model’s stability analysis, we found that even after exposure to inhibitors in the studied cell lines from the original activated batch for 48 hours, the model was still stable compared to either the negative control or the original activated batch (Fig. 9). This confirms the successful protection of our model in the studied cell lines. A surprising observation was that the model expressed a high percentage of apoptosis following activation when compared to an activated group, which is evidence that our model could be used to study the programmed death of neurons in a stable cellular model (Fig. 10) [51]. Finally, the quality of our AD cell model was confirmed by the detection of protein localization in the studied cell lines via confocal studies in undifferentiated SIM-A9 and N2a (Fig. 11).

Future Studies:

we intend to conduct an in-depth investigation of the molecular mechanisms by using an undifferentiated neural cell line. This limitation will be overcome by using extended follow-up protocols and bulk RNA-seq as well as single-cell RNA-seq methodologies for a comprehensive examination of the molecular cascades following cell activation by PAF C-16 and BetA, which ultimately leads to Alzheimer’s disease.

Conclusion:

We can conclude that the PAF C-16 and BetA chemicals can directly activate MEK1/2-ERK and NF-κβ pathways, respectively. This ultimately leads to the activation of the APP gene, which leads to β-Amyloid activation. Reasoning Aβ accumulation (the main cause of plaque). Tau activation and accumulation of Tau phosphorylation (the main cause tangles) are a result of MAPT gene activation caused by NF-κβ pathway stimulation. We succeeded in establishing a novel AD-cell model in microglial and neuroblast cell lines. We showed that it is possible to implement the cell line in a very short period of time (three days) with a high level of stability and activity, which is transmitted to the subsequent three generations (subculture). In addition, these cell lines show significant morphological changes necessary for AD studies. Further, the model can be used for neuronal programmed cell death studies. This study focused on stimulating AD cell model in SIM-A9 and N2a cell lines and this novel approach leaves the possibility to explore in other cell lines. These novel cell lines will provide a more useful model for AD researchers and will accelerate the new drug discovery process. Finally, the investigation of molecular mechanisms of the targeted pathways are vital for the pathogenic cascades of AD.

Highlights:

• Alzheimer’s disease (AD) is a neurodegenerative disease characterized by memory loss, cognitive impairment, and behavioral symptoms. By bridging the gap between preclinical animal models and clinical trials, a novel in vitro model may help identify promising therapeutic targets for future clinical trials. In vitro testing aids in identifying the mechanism of action and potential dangers, reducing translation time and expense.

• Our objective is to develop a powerful and informative cellular model of AD within a short period of time. Through triggering the MAPK and NF-κβ signaling pathways with the aid of small chemical compounds (PAF C-16 and BetA), respectively, in mouse microglial (SIM-A9) and neuroblast Neuro-2a (N2a) cell lines.

• MEK1/2-ERK and NF-κβ pathways, are directly activated by the PAF C-16 and BetA chemicals, respectively.

• The activation of MEK1/2-ERK pathway results in the activation of the APP gene, which in turn activates the β. Amyloid protein, which in turn results in plaque. Furthermore, NF-κβ activation results in the activation of the MAPT gene, which leads to Tau and p-Tau protein activation, which ultimately results in tangles.

• This can be put into practice in just three days, with a high level of activity and stability that is passed down to the next three generations (subculture), with significant morphological changes. In microglial and neuroblast cell lines, we were successful in creating a novel AD-cell model.

Data Availability

“The datasets generated during and/or analysed during the current study are available in whenever and wherever you need them”