Abstract
OBJECTIVE
To investigate the protective effect of resveratrol on cardiomyocytes after hypoxia/ reoxygenation intervention based on PTEN-induced putative kinase protein 1/Parkinson disease protein 2 (PINK1/PARKIN) signaling pathway.
METHODS
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenylte-trazolium bromide was used to detect the effect of resveratrol on the viability of H9C2 cells; the hypoxia/ reoxygenation (H/R) model was established in tri-gas incubator; 2’, 7’-Dichlorofluorescin diacetate staining was used to measure the content of reactive oxygen species (ROS); the changes of mitochondrial membrane potential was determined by 5,5’,6,6’-Tetrachloro-1,1’,3,3’-tetraethyl-imidacarbocyanine iodide staining; the changes of mitochondrial respiratory chain complex activity was evaluated by enzyme activity kits; flow cytometry was used to detect the ratio of apoptotic cells; transmission electron microscope was used to observe the ultrastructure of H9C2 cells; Western blot was used to detect the protein changes of mitochondrial 20 kDa outer membrane protein (TOM20), translocase of inner mitochondrial membrane 23 (TIM23), presenilins associated rhomboid-like protein (PARL), PINK1, PARKIN and mitofusin 1 (Mfn1), mitofusin 2 (Mfn2), phosphotyrosine independent ligand for the Lck SH2 domain of 62 kDa (P62), microtubule-associated protein 1 light chain 3 beta (LC3B); the mRNA levels of PINK1 and PARKIN was detected by quantitative polymerase chain reaction; immunoprecipitation assay was used to detect the interaction between PARKIN and Ubiquitin.
RESULTS
Resveratrol could inhibit the proliferation of H9C2 cells in a time- and concentration- dependent manner; however, pretreatment with low cytotoxic resveratrol could reduce the H/R-induced increase in cellular ROS levels, alleviate the loss of mitochondrial membrane potential induced by H/R, inhibit H/R-induced apoptosis of H9C2 cells, and protect the mitochondrial structure and respiratory chain of H9C2 cells from H/R damage. Resveratrol could further increase the levels of p62, PINK1, PARKIN protein, the expression of PINK1, PARKIN mRNA and the ratio of LC3BⅡ/LC3BⅠin H/R-induced H9C2 cells, inhibit the interaction between PARKIN and Ubiquitin in H/R-induced H9C2 cells, and further reduce the expression of TOM20,TIM23, PARL, Mfn1 and Mfn2 protein in H/R-induced H9C2 cells. The effect of resveratrol is consistent with that of autophagy activator on H/R-induced H9C2 cells.
CONCLUSION
Resveratrol can protect H9C2 cells from H/R injury, which may be related to resveratrol promoting mitochondrial autophagy by activating PINK1/PARKIN signaling pathway.
Keywords: resveratrol; myocytes, cardiac; hypoxia; PTEN phosphohydrolase; Parkinson disease associated proteins; mitochondrial autophagy
1. INTRODUCTION
At present, the incidence rate and death rate of acute ischemic myocardial infarction is increasing with the increasing incidence rate of cardiovascular diseases, which is caused by irregular lifestyles.1 Because of its acute onset and shorter effective rescue time, acute ischemic myocardial infarction has a high mortality rate.2, 3 However, even in a very short period of time, reperfusion itself may cause secondary damage to heart cells, lead to the damage of heart function, and even produce more serious and irreversible damage to cardiomyocytes,4-6 including cardiomyocyte apoptosis, autophagy, necrosis and necrotic apoptosis, which is called myocardial ischemia-reperfusion injury. There-fore, the prevention of ischemia-reperfusion injury is of great significance in the rescue of patients with ischemic myocardial infarction.
Although the exact mechanism of ischemia-reperfusion injury remains elusive, most of previous studies have suggested that the ischemia-reperfusion injury seems related to inflammatory reaction,7 mitochondrial mem-brane permeability transition pore, intracellular calcium overload, oxidative stress injury and apoptosis.8, 9 It was found that the longer the ischemia time, the stronger the local inflammation and reactive oxygen species (ROS) production after reperfusion.10 At present, ischemia-reperfusion injury has been found to be closely related to the activation and inactivation of various regulatory mechanisms and signaling pathways of mito-chondria.11,12 The normal function of cardio-myocytes depends on the function of a large number of mitochondria, which is closely related to oxygen supply. Due to the inhibition of the synthesis of antioxidant enzymes in the process of ischemia/reperfusion, a large amount of ROS is accumulated and can't be scavenged immediately, attacking its own mitochondrial membrane structure, resulting in the reduction of mitochondrial membrane potential and the damage of mitochondrial membrane structure and function, and then further affecting cardiomyocytes functions.11,12 The damaged mitochondria can be removed in time by “mitochondrial autophagy” in order to prevent the damaged mitochondria from causing further damage to the cells. Mitochondrial autophagy is a selective autophagy, which can specifically eliminate the mitochondria with abnormal function or damaged structure, regulate the quantity and quality of mitochondria, and maintain the normal physiological activities of cells.13,14 Some studies suggested that mitochondrial autophagy is closely related to myocardial ischemia-reperfusion injury.15,16 If the damaged mitochondria cannot be removed in time during ischemia/reperfusion, it may induce the activation of mitochondrial apoptosis pathway and the production of more ROS to cause greater damage to cells and then induce cardiomyocyte apoptosis. Therefore, the activation of mitochondrion autophagy can alleviate the ischemia-reperfusion injury.17-19
The main signal pathways regulating mitochondrial autophagy are PTEN-induced putative kinase protein 1/Parkinson disease protein 2 (PINK1/PARKIN) pathway,20,21 BCL2/adenovirus E1B 19 kDa protein interacting protein 3/Nip-like protein X (BNIP3/NIX) pathway22-24 and FUN14 domain-containing protein 1 pathway, prohibitin pathway.25 these pathways above are not completely independent, and exist cross regulation between them, so as to maintain the balance of mitochondrial autophagy. PINK1/PARKIN pathway plays an important role in maintaining the normal function of cardiomyocytes and myocardial protection in ischemia-reperfusion injury. PINK1, which is sensitive to mitochondrial membrane potential, can phosphorylates the PARKIN protein on mitochondrial membrane in the damaged mitochondria. The binding of phosphorylated PARKIN to ubiquitin mediates the binding with autophagy related proteins, and then induces mitochondrial autophagy.21, 24 A variety of drugs and methods with cardioprotective effect are considered to play a role through PINK1/PARKIN pathway.26, 27
Resveratrol is a kind of polyphenol monomer of Traditional Chinese Medicine, which is rich in Polygonum cuspidatum, grape, peanut, red wine and so on. It has anti-inflammatory, antibacterial, antioxidant, anti-tumor, anti-aging and other biological activities.28-31 A large number of studies have found that resveratrol has a protective effect on cardiomyocytes in a variety of injuries and diseases,32 including hypoxia/reoxy-genation-, doxorubicin-, arsenic trioxide- and diabetes- induced injury.33-35 At present, studies have found that resveratrol protects cardiomyocytes by reducing hypoxia-induced inflammatory response,36 enhancing antioxidant capacity of cardiomyocytes,37 and improving mitochondrial membrane permeability of cardio-myocytes under hypoxia/reoxygenation.38 The protective mechanisms above lead to the inhibition of hypoxia/ reoxygenation-induced mitochondrial apoptosis through early protection.39,40 However, under the condition of hypoxia/reoxygenation, some mitochondria in cardio-myocytes have been damaged and cannot be repaired. if the damaged mitochondria are not removed in time, it will cause mitochondrial apoptosis. The way of clearing the damaged mitochondria is to initiate mitochondrial autophagy.41 At present, studies have found that resveratrol can enhance cell mitochondrial dynamics, promote autophagy, remove dysfunctional mitochondria, inhibit apoptosis, and protect nerve cells, nucleus pulposus cells and cardiomyocytes,42-44 Further studies found that the activation of mitochondria autophagy by resveratrol to clearing the impaired mitochondria requires the involvement of autophagy protein 5 and PINK1 genes.41 However, the molecular mechanism of resveratrol on myocardial protection in the process of ischemia-reperfusion is still unclear, and many molecular mechanisms have been found to participate in it, including 5'-AMP-activated protein kinase (AMPK) pathway,45 wingless-related MMTV integration site 5A (Wnt5a)/frizzled,46 NAD dependent deacetylase sirtuin 1/Transformation related protein 53 (Sirt1/p53) pathway.47, 48 However, these molecular pathways above were not significantly correlated with mitochondrial autophagy. Considering the important role of PINK1/PARKIN pathway in mitochondrial autophagy, this study will explore the protective effect of resveratrol on myocardial cells during ischemia-reperfusion, and explore the molecular mechanism of resveratrol in ischemia-reperfusion based on PINK1/PARKIN pathway mediated mitochondrial autophagy.
2. MATERIALS AND METHODS
H9C2 cells were purchased from the cell bank of the typical culture preservation Committee of Chinese Academy of Sciences; Resveratrol (Res) (R5010, Sigma-Aldrich, St. Louis, MO, USA); Bromhexine Hydrochloride (BHH) (HY-b0372a, MedChemExpress, Newark, NJ, USA); High glucose dulbecco's modified eagle medium (H-DMEM) (Gibco, Grand Island, NY, USA); Fetal Bovine Serum (FBS) (Hyclone, Logan, UT, USA); 0.25% trypsin (t1300, Solarbio, Beijing, China); 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (m8180, Solarbio, Beijing, China); 2', 7'-Dichlorofluorescin diacetate (DCFH-DA) (MB4682, Meilunbio, Dalian, China); 5,5',6,6'-Tetrachloro-1,1',3,3'-tetraethyl-imidacarbocyanine iodide (JC-1) (c2006, Beyotime, Shanghai, CHN); mitochondrial separation Kit (C3601, Beyotime, Shanghai, China) oxide respiratory chain complex Ⅰ, oxidative respiratory chain complexⅡ, oxidative respiratory chain complex Ⅲ and oxidative respiratory chain complex Ⅳ activity detection kit (A089-1-1, A089-2-1, A089-3-1, A089-4-1, respectively) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China), Glutaraldehyde (G6257, Sigma, St. Louis, MO, USA); Apoptosis detection kit (CA1020, Solarbio, Beijing, China); Radio immunoprecipitation assay (RIPA) lysis buffer (p0013c, Beyotime, Shanghai, China); Horseradish peroxidase (HRP) labeling Goat anti Rabbit IgG (A0208, Beyotime, Shanghai, China); SYBR Premix Ex TaqTM Ⅱ (RR820A, Takara, Tokyo, Japan); Trizol reagent (9109, Takara, Tokyo, Japan); PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A, Takara, Tokyo, Japan); Mouse anti mitofusin 1 (Mfn1) monoclonal antibody (ab126575, Abcam, Cambridge, UK), Rabbit anti mitofusin 2 (Mfn2) monoclonal antibody (ab124773, Abcam, Cambridge, UK); mouse anti phosphotyrosine independent ligand for the Lck SH2 domain of 62 kDa (P62) monoclonal antibody (sc-48402, Santa, CA, USA), rabbit anti microtubule-associated protein 1 light chain 3 beta (LC3B) monoclonal antibody (ab192890, Abcam Cambridge, UK); rabbit anti Ubiquitin monoclonal antibody (ab134953, Abcam Cambridge, UK); rabbit anti PTEN-induced putative kinase protein 1 (PINK1) polyclonal antibody (ab23707, Abcam Cambridge, UK); mouse anti Parkinson disease protein 2 (PARKIN) monoclonal antibody (sc-32282, Santa Cruz, Dallas, TX, USA); rabbit anti mitochondrial 20 kDa outer membrane protein (TOM20) polyclonal antibody(bs-7357R, Bioss, Beijing, China); rabbit anti translocase of inner mitochondrial membrane 23 (TIM23) polyclonal antibody (bs-7375R, Bioss, Beijing, China); rabbit anti presenilins associated rhomboid-like protein (PARL) polyclonal antibody (bs-7634R, Bioss, Beijing, China); Agarose beads labeled with A/G protein (36403ES03, Qcbio Science & Techologies, Shanghai, China).
2.1. Cell culture
Rat cardiomyocyte H9C2 cell lines were cultured in high glucose DMEM medium containing 10% FBS at 37 ℃ in 5% CO2 incubator. When the cells grew to 80% confluence, the cells were digested with 0.25% trypsin for passage.
2.2. MTT assay was used to detect the effect of resveratrol on the proliferation of H9C2 cells
After the cells grew into logarithmic growth phase, the cells were digested with 0.25% trypsin to form single-cell suspension. The single-cell suspension was adjusted with a complete medium to a concentration of 1.5×105 cells/mL and were seeded into the 96 well plate with 100 μL per well. After the 96 well plates were incubated for 24 h in 5% CO2 incubator at 37 ℃, the resveratrol was added into the well with the final concentration of 0, 6.25, 12.5, 25, 50, 100, 200 g/L with 6 parallel wells per one concentration, and the same volume of solvent was added as blank control. After treatment for 24, 48 and 72 h, respectively, 20 μL MTT solution (5 mg/mL, i.e. 0.5% MTT) was added into each well. After incubation for 4h, the medium was discarded, and 150 μL DMSO was added into each well to dissolve MTT. The optical density value was detected at 490 nm, and the inhibition rate was calculated.
2.3. Establishment of hypoxia/reoxygenation injury model
After the cells grew to logarithmic growth phase, the complete medium was replaced by sugar free medium which was treated for deoxidation by ultrasonic. Then the cells were placed into tri-gas incubator and cultured at 37 ℃, 5% CO2 and 95% N2 for 6 h. After hypoxia treatment, the cells were taken out and cultured in complete medium (10% FBS+H-DMEM) at 37 ℃, 95% O2 and 5% CO2 for reoxygenation. The hypoxia-reoxygenation model was established.
2.4. Cell grouping and intervention
Before modeling, H9c2 cells were pretreated with resveratrol and autophagy activator for 24 h. The intervention concentration of BHH was 100 μM. The intervention concentration of resveratrol in low- and high- dose resveratrol groups (L-dose Res group and H-dose Res group) were 6.25 and 12.5 g/L, respectively. After pretreatment, hypoxia reoxygenation injury was performed as the method mentioned in “2.3” section. The model group was only subjected to hypoxia reoxygenation injury, while the blank group was not subjected to any treatment.
2.5. DCFH-DA was used to detect the changes of reactive oxygen species
After the cells were intervened in 6-well plate according to the method mentioned in “2.4” section, the cells were washed twice with PBS, and 10 mM DCFH-DA prepared with serum-free H-DMEM medium was added to each well with a volume of 1 mL. The cells were cultured in 5% CO2 incubator at 37 ℃ for 30 min, washed with PBS twice, and then observed by fluorescence microscope.
2.6. JC-1 was used to detect the changes of mito-chondrial membrane potential
After the cells were intervened in 6-well plate according to the method mentioned in “2.4” section, the cells were washed twice with PBS, and 10 μg/mL JC-1 solution prepared with JC-1 staining buffer was added to each well with a volume of 1 mL. The cells were cultured in 5% CO2 incubator at 37℃ for 30 min, washed twice with JC-1 staining buffer, and then observed by fluorescence microscope.
2.7. Activity of mitochondrial respiratory chain complex was detected
The mitochondria extraction protocol was carried out according to the instructions of cell mitochondria separation kit. The activity of oxidative respiratory chain was detected by the activity detection kit, and the steps were carried out according to the instructions. The activity of oxidoreductase complexⅠ, oxidoreductase complexⅡ, oxidoreductase complex Ⅲ and oxido-reductase complex Ⅳ were calculated based on the absorbance value (A) measured by microplate reader at 450, 600, 550 nm, respectively.
2.8. Changes of apoptosis were detected by flow cytometry
After intervened in 6-well plate according to the method mentioned in “2.4” section, the cells were digested with 0.25% trypsin into single-cell suspension, washed with PBS by centrifugation at 1500 rpm, and then resuspended with the binding buffer. 5 μL FITC-labeled Annexin Ⅴ and 10 μL PI was added into 200 μL cell suspension (5 × 105 cells/mL) for incubation at room temperature for 20 min, and cell apoptosis was detected by flow cytometry.
2.9. Ultrastructure of cells was observed by transmission electron microscope
After treated in T25 culture flask according to the method mentioned in “2.4” section, the cells were digested with 0.25% trypsin into single-cell suspension, washed with PBS by centrifugation at 1500 rpm. The cellular precipitation was fixed with 2.5% glutaraldehyde solution and osmic acid (1%), dehydrated with a gradient concentration of ethanol, infiltrated with acetone and embedding solution. Ultrathin sections (50 nm) were prepared and then stained with uranyl acetate and lead citrate. The cell ultrastructure was observed under transmission electron microscope.
2.10. Changes of PINK1, PARKIN, Mfn1, Mfn2, Beclin1, p62 and LC3 protein were detected by Western blot
After the intervention, RIPA lysis buffer was used to lysed the cells on ice for 30 min, and the lysate was centrifuged at 12 000 rpm at 4 ℃for 10 min. the supernatant was taken and its protein concentration was detected by bicinchoninic acid (BCA) kit. 4 × loading buffer was added to the supernatant. After boiling and denaturation, the protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Then, the separated protein was transferred to PVDF membrane followed by blocking with bovine serum albumin in PBST buffer for 2 h at room temperature, and incubated with primary antibody overnight at 4 ℃. Sequently, the second antibody was incubated for 2 h at room temperature, enhanced chemiluminescence lumen-escent solution was used to detected the proteins of interest. The relative protein abundance was detected and photographed with an Intelligent Dark Box II with a Fujifilm LAS-1000 camera and images were analyzed by Image J.
2.11. Changes of PINK1 and parkin mRNA were detected by quantitative polymerase chain reaction (qPCR)
After the intervention, the total RNA was extracted using Trizol reagent. 1 × 107 cells added with 1 mL Trizol stand for 5 min at room temperature, then were centrifuged at 13000 rpm for 5 min. 0.3 mL chloroform were added into the supernatant followed by violent shaking for 15 s, then standing for 10 min at room temperature, centrifuging at 13000 rpm, selecting the supernatant, adding 0.75 mL isopropanol into the supernatant, standing for 10 min, centrifuging at 13000 rpm for 10 min, discarding supernatant, cleaning pre-cipitate with 75% ethanol, discarding supernatant by centrifugation, keeping precipitate dry, dissolving with DEPC water. According to the Takara reaction kit, genomic DNA reaction was removed and mRNA were reversed transcribed to cDNA by the reverse transcription reaction kit. The amplification procedure was as follows: pre denaturation: 95 ℃, 10 min, 1 cycle; amplification: 95 ℃, 15 s, 60 ℃, 15 s, 72 ℃, 30 s, 40 cycles. The sequences of the primers were showed in Table 1. The relative expression level of mRNA=2–ΔΔCt. The sequences of the primers as follows: PINK1 Forward: TGCAATGCCGCTGTGTATGA, Reverse: TCTGCT-CCCTTTGAGACGAC; Parkin Forward: AGCTAAA-CCCACCTACCACAG, Reverse CATCCGGTTT-GGAATTAAGACA; GAPDH Forward: CTGGAGA-AACCTGCCAAGTATG, Reverse: GGTGGAAGAAT-GGGAGTTGCT.
2.12. Interaction between PARKIN and Ubiquitin was detected by protein immunoprecipitation
After the intervention, 1mL RIPA lysis buffer was added to the cells (1×107 cells), and the cells were lysed on ice for 20 min, and transferred to a 1.5 mL EP tube, and further lysed on ice for 10 min. The lysates were centrifuged at 12 000 × g at 4 ℃ for 10min. the supernatant was taken and its protein concentration was detected by BCA kit. Add 20 μL A/G-beads to the supernatant, mix well, incubate at 4 ℃ for 30 min, remove the non-specific binding protein, and centrifuge at 4℃ at 3000 × g to get the supernatant. The supernatant was divided into three parts, one was added with IgG as negative control, one was added as input group (except for the primary antibody), the other was added with 10 μL primary antibody, and incubated overnight at 4 ℃. 20 μL A/G-beads were added to the three groups. After mixing gently, the three groups were incubated at 4 ℃ for 4h, centrifuged at 1000 × g at 4 ℃ for 5 min. The supernatant was discarded and the immuneoprecipitation complex was collected. The complex was washed four times with 1mL precooled IP lysis buffer, centrifuged at 4 ℃ at 3000 × g for 5min each time. Add 4 × loading buffer, boil in boiling water for 10 min, centrifuge at 4 ℃ and 1000 × g for 5 min, and take the supernatant for Western blot detection.
2.13. Statistical methods
Statistical software SPSS 25.0 (IBM Corp. Released 2017. IBM SPSS Statistics for Windows, Version 25.0. Armonk, NY, USA) is used for statistical analysis of the data, and the measurement data are expressed by mean ± standard deviation (). If the data conforms to the normal distribution, one-way analysis of variance is used for comparison between multiple groups. In further post hoc tests, if the variance is homogeneous, least significant difference-t test is used for pairwise com-parison between groups. If the variance is uneven, Dunnett's T3 test is used for pairwise comparison between components. The difference was statistically significant (P < 0.05).
3. RESULTS
3.1. Resveratrol could inhibit the proliferation of H9C2 cells in a time and concentration dependent manner
At the same intervention time, with the increase of resveratrol concentration, the inhibition rate of H9C2 cell proliferation activity gradually increased; at the same intervention concentration, with the increase of inter-vention time, the inhibition rate of resveratrol on H9C2 cell proliferation activity gradually increased. Therefore, resveratrol can inhibit the proliferation of H9C2 cells in a time and concentration dependent manner. The IC50 of resveratrol on the proliferation of H9C2 cells at 24, 48 and 72 h were 80.12, 45.97, 11.46 g/L (Figure 1).
Figure 1. Resveratrol inhibited the proliferation of H9C2 cells in a time and concentration dependent manner, which was determined using an 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide cell survival assay.

H9c2 cells were treated with resveratrol at the concentrations of 0, 6.25, 12.5, 25, 50, 100 and 200 g/L for 24, 48 and 72 h, respectively.
3.2. Resveratrol can reduce the increase of reactive oxygen species induced by H/R in H9C2 cells
Compared with the control group, the ROS level in H9C2 cells in H/R group increased significantly (P < 0.05); compared with H/R group, the ROS level in H9C2 cells in high-dose resveratrol group and autophagy activator group decreased significantly (P < 0.05) (Figure 1S in supplemented materials).
3.3. Resveratrol can increase H/R induced decrease of H9C2 cell membrane potential
Compared with the control group, the mitochondrial membrane potential of H9C2 cells in H/R group decreased significantly (P < 0.05); compared with H/R group, the mitochondrial membrane potential of H9C2 cells in high-dose resveratrol group and autophagy activator group increased significantly (P < 0.05) (Figure 2).
Figure 2. Resveratrol can increase decrease of the mitochondrial membrane potential induced by H/R in H9C2 cells (× 200).
The mitochondrial membrane potential was detected by JC-1 staining (A, F, K: control, no treatment; B, G, L: H/R, hypoxia/reoxygenation injury; C, H, M: L-dose Res, 6.25 g/L for 24 h, D, I, N: H-dose Res, 12.5 g/L for 24 h; E, J, O: BHH, 100 μM for 24 h) and the fluorescence intensity was measured with ImageProPlus software and the Red/Green ratio was analyzed by SPSS25.0 Software (P). H/R: hypoxia/reoxygenation; JC-1: 5,5',6,6'-Tetrachloro-1,1',3,3'-tetraethyl-imidacarbocyanine iodide; L-dose Res: low-dose resveratrol; H-dose Res: high-dose resveratrol; BHH: bromhexine hydrochloride. aP < 0.01 vs control group, bP < 0.01 vs H/R group.
3.4. Resveratrol can reverse the inhibition of mitochondrial oxidative respiratory chain induced by H/R in H9C2 cells
Compared with the control group, the activities of mitochondrial oxidative respiratory chain complexesⅠ, Ⅱ, Ⅲ and Ⅳ in H/R group were significantly decreased (P < 0.05); compared with H/R group, the activities of mitochondrial oxidative respiratory chain complexesⅠ, Ⅱ, Ⅲ and Ⅳ in high-dose resveratrol group and autophagy activator group were significantly increased (P < 0.05) (Table 1S in supplemented materials).
3.5. Resveratrol can inhibit H/R-induced apoptosis of H9C2 cells
Compared with the control group, the proportion of early and late apoptotic cells in H/R group was significantly increased (P < 0.05); compared with H/R group, the proportion of early and late apoptotic cells in high-dose resveratrol group and autophagy activator group were significantly decreased (P < 0.05) (Figure 2S in supplemented materials).
3.6. Resveratrol can activate mitochondrial autophagy
Compared with the control group, the morphology of mitochondria in H9C2 cells in H/R group was significantly abnormal, the inner cristae was reduced, the morphology of mitochondria was swollen, and the number of autophagosomes and autophagosomes had no significant change; compared with H/R group, the morphology of mitochondria in H9C2 cells in autophagy activator group, low, medium and high dose resveratrol groups gradually returned to normal, the number of autophagosomes and autophagosomes gradually increased, and the number of leukocytes gradually increased Resveratrol reversed H/R-induced abnor-malities of mitochondrial morphology, autophagosomes and autophagosomes in H9C2 cells in a concentration dependent manner (Figure 3).
Figure 3. Resveratrol can activate mitochondrial autophagy (× 15 000).
The ultrastructure of H9C2 cells was detected by transmission electron microscope. The red arrow indicates the mitochondrial cristae and the white arrow indicates the mitochondrial membrane. A: control, no treatment; B: H/R, hypoxia/reoxygenation injury; C: L-dose Res, 6.25 g/L for 24 h; D: H-dose Res, 12.5 g/L for 24 h; E: BHH, 100 μM for 24 h. H/R: hypoxia/reoxygenation; BHH: bromhexine hydrochloride.
3.7. Resveratrol promotes the expression of PINK1 and PARKIN protein and mRNA and inhibits the expression of TOM20, TIM23 and PARL protein in H9C2 cells induced by H/R
Compared with the control group, the protein and mRNA expressions of PINK1 and PARKIN in H9C2 cells in H/R group were significantly increased (P < 0.05), the protein expressions of TIM23 protein in H9C2 cells in H/R group were significantly decreased (P < 0.05); compared with H/R group, the protein and mRNA expressions of PINK1 and PARKIN in H9C2 cells in high-dose resveratrol group and autophagy activator group were significantly increased (P < 0.05), the protein expressions of TOM20, TIM23 and PARL protein in H9C2 cells in low-, high-dose resveratrol group and autophagy activator group were significantly decreased (P < 0.05) (Figure 4).
Figure 4. Resveratrol promotes the expression of PINK1 and PARKIN protein and mRNA and inhibits the expression of TOM20, TIM23 and PARL protein in H9C2 cells induced by H/R, which were detected by Western blot (A, B) and qPCR (C), respectively.
PINK1: PTEN-induced putative kinase protein 1; PARKIN: Parkinson disease protein 2; TOM20: mitochondrial 20 kDa outer membrane protein; TIM23: translocase of inner mitochondrial membrane 23; PARL: presenilins associated rhomboid-like protein; H/R: hypoxia/reoxygenation; qPCR: quantitative polymerase chain reaction. aP < 0.01 vs control group, bP < 0.01 vs H/R group.
3.8. Resveratrol promotes H/R-induced interaction between PARKIN and ubiquitin in H9C2 cells
Compared with the control group, the interaction amount of PARKIN and Ubiquitin in H9C2 cells in H/R group was significantly increased (P < 0.05); compared with H/R group, the interaction amount of PARKIN and ubiquitin in H9C2 cells in high-dose resveratrol group and autophagy activator group were significantly increased (P < 0.05) (Figure 5).
Figure 5. Resveratrol promotes interaction between PARKIN and ubiquitin in the H/R-induced H9C2 cells.
A: Co-IP assay; B: the semi-quantitative analysis of the interaction between PARKIN and ubiquitin was conducted by the ImageProPlus software. PARKIN: Parkinson disease protein 2; H/R: hypoxia/reoxygenation. aP < 0.01 vs Control group, bP < 0.01 vs H/R group.
3.9. Resveratrol decreased the expression of Mfn1 and Mfn2 in H9C2 cells induced by H/R, and inhibited mitochondrial fusion
Compared with the control group, the expression of Mfn1 and Mfn2 protein in H9C2 cells in H/R group were significantly decreased (P < 0.05); compared with H/R group, the expression of Mfn1 and Mfn2 in H9C2 cells in high-dose resveratrol group and autophagy activator group were significantly decreased (P < 0.05) (Figure 3S in supplemented materials).
3.10. Resveratrol promotes the expression of Beclin1, p62 and LC3 in H9C2 cells induced by I/R, and promotes autophagy
Compared with the control group, the expression of p62 and LC3BⅡ/LC3BⅠratio in H9C2 cells in H/R group was significantly increased (P < 0.05); compared with H/R group, the expression of p62 and LC3B Ⅱ/LC3BⅠ ratio in H9C2 cells in high-dose resveratrol group and autophagy activator group were significantly increased (P < 0.05) (Figure 6).
Figure 6. Resveratrol promotes the expression of Beclin 1, p62 and LC3 in H9C2 cells induced by H/R, which were detected by Western blot (A, B).
LC3: microtubule associated protein light chain 3; H/R: hypoxia/reoxygenation. aaP<0.01 vs Control group, bbP<0.01 vs H/R group.
4. DISCUSSION
In order to select the appropriate resveratrol concentration, so as not to produce higher cytotoxicity to H9C2 cells, affecting the experimental results, or the concentration is too low to have a protective effect on H9C2, this study first investigated the effect of resveratrol on the proliferation activity of H9C2 cells by MTT kit, the results showed that resveratrol could inhibit the proliferation activity of H9C2 cells in a time-concentration dependent manner. According to intervention time and inhibition ability of resveratrol, two concentrations with inhibition rate less than 20% were selected as intervention concentrations in subsequent studies under 24 h conditions.
In order to explore the protective effect of resveratrol on hypoxia-reoxygenation cardiomyocytes, the H/R model of H9C2 cells was established in vitro. In hypoxia-reoxygenation cardiomyocytes, the increase of ROS level is the main characteristic, which is one of the main factors leading to myocardial injury.49, 50 Therefore, this study first detected the ROS content in cells, and found that the ROS level in H/R group was significantly increased, but resveratrol pretreatment could significantly reduce the ROS accumulation induced by H/R, which initially suggested that resveratrol had a protective effect on H/R-treated cardiomyocytes. At present, it has been found that H/R leads to the accumulation of ROS in cells because H/R blocks the production of ATP in mitochondria. On the one hand, the decrease of ATP reduces the level of antioxidants in the antioxidant system of cells. On the other hand, xanthine oxidoreductase system, NADPH oxygenase system and uncoupled nitric oxide synthase system are activated during reoxygenation to produce a large amount of ROS.4 In this way, a large number of ROS are produced in the process of reoxygenation, and cannot be removed in time, resulting in the accumulation of ROS in cells.
The accumulated ROS in hypoxia-reoxygenation cells attacked mitochondrial membrane, damaged mito-chondrial structure, increased permeability of mitochondrial membrane, and then led to the decline of mitochondrial membrane potential, destroyed oxidative respiratory chain, promoted cytochrome c to leak into cytoplasm from mitochondria in large quantities, inducing apoptosis of myocardial cells.51, 52 the damaged mitochondria further led to ROS production, forming vicious circle, further aggravating cell damage and apoptosis.53 Therefore, the mitochondrial membrane potential, oxidative respiratory chain activity and apoptosis were further detected in this study. The results showed that H/R could cause the decrease of mitochondrial membrane potential in H9C2 cells, the inhibition of oxidative respiratory chain and the elevation of apoptosis. After resveratrol pretreatment, compared with H/R group, the mitochondrial membrane potential and the activity of oxidative respiratory chain in H/R-treated H9C2 cells increased significantly, and the apoptosis rate of H/R-treated H9C2 cells decreased significantly. The above results further confirmed that resveratrol can protect the mitochondrial structure from ROS attack by reducing ROS level, and protecting hypoxia-reoxygenation H9C2 cells. Further transmission electron microscopy results showed that H/R could cause the mitochondrial morphology of H9C2 cells to be abnormal, but there was no increase in autophagosome and lysosome. However, the proportion of mitochondria in the normal morphology of H9C2 treated with resveratrol was significantly higher than that of H/R group cells, and the number of autophagosome and lysosomes increased significantly. This may suggest that resveratrol can protect myocardial cells in H/R by reducing ROS accumulation and further improving the ability of cells to remove damaged mitochondria. Previous studies have confirmed the hypothesis. Studies by Ney and Yamashita have found that mitochondrial autophagy can protect the cells from apoptosis or necrosis by clearing the damaged mitochondria in the cells, thus protecting the cells.23,54 In H9C2 cells treated with hypoxia and reoxygenation, the activation of mitochondrial autophagy can protect the cells.26 The results showed that mitochondrial autophagy activator can reverse the increase of reactive oxygen, the decrease of mitochondrial membrane potential and the inhibition of mitochondrial respiratory chain complex activity, decrease the ratio of apoptosis and damage mitochondria induced by H/R, and increase the number of autophagy and lysosomes. These results suggest that mitochondrial autophagy can protect H9C2 cells induced by H/R, which is consistent with other studies.
The activation of PINK1-PARKIN pathway can initiate mitochondrial autophagy.55 In normal cells, PINK1 protein enters into the mitochondrial matrix with the help of TOM and TIM23, and is rapidly cleaved by the PARL protein in mitochondria to degrade, which makes the level of PINK1 in healthy mitochondria very low and even unable to detect.20 Under the adverse conditions of hypoxia and high glucose, the depolarization of mitochondrial membrane potential lead to the decrease of the activities of TOM and TIM23, so PINK1 protein could not enter the inner membrane from outside mitochondria, resulting in its dense distribution outside mitochondria. PINK1 protein gathered in the outer membrane of mitochondria was activated by phosphorylation.20 After that, PINK1 phosphorylates ubiquitin in the outer membrane of mitochondria. The high affinity between phosphorylated Ubiquitin and PARKIN protein promotes the aggregation of PARKIN protein and the activation of E3 ubiquitin ligase,56 thus activating PINK1-PARKIN pathway, which provides the basis for further activating mitochondrial autophagy. In this study, H/R can induce the expression of PINK1 and PARKIN at protein and mRNA levels, decrease the expression of TIM23 and increase the interaction between PARKIN and Ubiquitin, and activate the PINK1-PARKIN pathway, but the autophagosome and lysosome in cardiomyocytes did not increase significantly, the damage of mitochondria did not decrease, and the apoptosis of cardiomyocytes was more serious, which may be related to the insufficient activation of PINK1-PARKIN pathway in H/R, which cannot effectively reduce the damage of H/R to cells through mitochondrial autophagy. However, after resveratrol pretreatment, the protein and mRNA expressions of PINK1 and PARKIN in H/R-treated H9C2 cells were further significantly increased. Meanwhile, the protein expression of TOM20, TIM23 and PARL were further significantly decreased and the interaction between PARKIN and Ubiquitin was further significantly increased, autophagosome and lysosome in cardiomyocytes were significantly increased, mito-chondrial damage and apoptosis were significantly reduced, which had the same effect as mitochondrial autophagy activator in H/R-treated H9C2 cells. These results suggest that resveratrol can further activate the PINK1-PARKIN pathway in H/R-induced H9C2 cells through inducing the expression of PINK1 and PARKIN at protein and mRNA levels and inhibit the PINK1 transport pathway. When PARKIN is activated, hexokinase 1, outer mitochondrial membrane protein porin 1, Mfn1 and Mfn2 are ubiquitinated.57-59 Sub-sequently, the ubiquitinated protein was recognized by autophagy receptor proteins p62, optineurin, cell mig-ration-inducing gene 19 protein, Tax1-binding protein 1 homolog and nuclear domain 10 protein 52.60-62 P62 is an adaptor protein, one end of which connects to ubiquitin chain of mitochondrial membrane protein, and the other end specifically binds to LC3 through LIR domain.63 LC3 is a receptor protein on autophagosome, which connects with p62 to activate autophagy pathway, and then mitochondria are phagocytized by autophagosome to form a new mixed structure and enter lysosome to degrade.64 In this study, we found that although the protein levels of Mfn1 and Mfn2 in H9C2 cells induced by H/R decreased significantly, the protein levels of Mfn1 and Mfn2 in H9C2 cells pretreated with resveratrol and then intervened by H/R further decreased significantly, this possible reason is that the further activation of PINK1-PARKIN pathway by resveratrol under H/R condition leads to the enhanced ubiquitination of Mfn1 and Mfn2, which then initiates mitochondrial autophagy and is degraded together. The evidence that resveratrol can further enhance autophagy under H/R condition was confirmed by the detection of autophagy related proteins in this study. This study found that after resveratrol pretreatment, the expression of p62 and the ratios of LC3BⅡ/LC3BⅠ proteins, which were originally increased in H9C2 cells after hypoxia reoxygenation, were further significantly increased. These results suggest that resveratrol can protect H9C2 cells from H/R injury by further activating PINK1-PARKIN pathway and increasing mitochondrial autophagy in H/R cardiomyocytes.
In conclusion, our findings suggest that hypoxia-reoxygenation can significantly increase the ROS level in cardiomyocytes, and then damage the structure and function of mitochondria, and induce cardiomyocyte apoptosis. However, resveratrol can reverse the damage of hypoxia reoxygenation on cardiomyocytes, and the possible mechanism is that resveratrol can activate PINK1-PARKIN to promote the mitochondrial autophagy in H/R cardiomyocytes and realize the protective effect on cardiomyocytes.
Funding Statement
Supported by Open Fund of Key Laboratory of Dunhuang Medicine, Ministry of Education (No. DHYX20-09); Youth Research Foundation of the Gansu University of Chinese Medicine (No. ZQ2017-14)
References:
- 1. Boateng S, Sanborn T. Acute myocardial infarction. Dis Mon 2013; 59: 83-96 [DOI] [PubMed] [Google Scholar]
- 2. Reed GW, Rossi JE, Cannon CP. Acute myocardial infarction. Lancet 2017; 389: 197-210. [DOI] [PubMed] [Google Scholar]
- 3. Frank A, Bonney M, Bonney S, et al. Myocardial ischemia reperfusion injury: from basic science to clinical bedside. Semin Cardiothorac Vasc Anesth 2012; 16: 123-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Wu MY, Yiang GT, Liao WT, et al. Current mechanistic concepts in ischemia and reperfusion injury. Cell Physiol Biochem 2018; 46: 1650-67. [DOI] [PubMed] [Google Scholar]
- 5. Toldo S, Mauro AG, Cutter Z, et al. Inflammasome, pyroptosis, and cytokines in myocardial ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol 2018; 315: H1553-68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Shi B, Ma M, Zheng Y, et al. mTOR and Beclin1: two key autophagy-related molecules and their roles in myocardial ischemia/reperfusion injury. J Cell Physiol 2019; 234: 12562-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Boag SE, Andreano E, Spyridopoulos I. Lymphocyte communication in myocardial ischemia/reperfusion injury. Antioxid Redox Signal 2017; 26: 660-75. [DOI] [PubMed] [Google Scholar]
- 8. Yang CF. Clinical manifestations and basic mechanisms of myocardial ischemia/reperfusion injury. Ci Ji Yi Xue Za Zhi 2018; 30: 209-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Morciano G, Bonora M, Campo G, et al. Mechanistic role of mPTP in ischemia-reperfusion injury. Adv Exp Med Biol 2017; 982: 169-89. [DOI] [PubMed] [Google Scholar]
- 10. Minutoli L, Puzzolo D, Rinaldi M, et al. ROS-mediated NLRP3 inflammasome activation in brain, heart, kidney, and testis ischemia/reperfusion injury. Oxid Med Cell Longev 2016; 2016: 2183026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Lesnefsky EJ, Chen Q, Tandler B, et al. Mitochondrial dysfunction and myocardial ischemia-reperfusion: implications for novel therapies. Annu Rev Pharmacol Toxicol 2017; 57: 535-65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Bugger H, Pfeil K. Mitochondrial ROS in myocardial ischemia reperfusion and remodeling. Biochim Biophys Acta Mol Basis Dis 2020; 1866: 165768. [DOI] [PubMed] [Google Scholar]
- 13. Melser S, Lavie J, Bénard G. Mitochondrial degradation and energy metabolism. Biochim Biophys Acta 2015; 1853: 2812-21. [DOI] [PubMed] [Google Scholar]
- 14. Vásquez-Trincado C, García-Carvajal I, Pennanen C, et al. Mitochondrial dynamics, mitophagy and cardiovascular disease. J Physiol 2016; 594: 509-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Murata D, Arai K, Iijima M, et al. Mitochondrial division, fusion and degradation. J Biochem 2020; 167: 233-41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Tong M, Sadoshima J. Mitochondrial autophagy in cardiomyopathy. Curr Opin Genet Dev 2016; 38: 8-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Zhang P, Liu X, Huang G, et al. WITHDRAWN: Schisandrin B suppresses NLRP3 inflammasome activation to alleviate myocardial ischemia reperfusion injury via maintaining mitochondrial autophagy. Biochem Biophys Res Commun 2017; 494: 425. [DOI] [PubMed] [Google Scholar]
- 18. Gustafsson AB, Gottlieb RA. Eat your heart out: role of autophagy in myocardial ischemia/reperfusion. Autophagy 2008; 4: 416-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. López De Figueroa P, Lotz MK, Blanco FJ, et al. Autophagy activation and protection from mitochondrial dysfunction in human chondrocytes. Arthritis Rheumatol 2015; 67: 966-76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Sekine S, Youle RJ. PINK1 import regulation; a fine system to convey mitochondrial stress to the cytosol. BMC Biol 2018; 16: 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Eiyama A, Okamoto K. PINK1/Parkin-mediated mitophagy in mammalian cells. Curr Opin Cell Biol 2015; 33: 95-101. [DOI] [PubMed] [Google Scholar]
- 22. Zhao Y, Zhu Q, Song W, et al. Exercise training and dietary restriction affect PINK1/Parkin and Bnip3/Nix-mediated cardiac mitophagy in mice. Gen Physiol Biophys 2018; 37: 657-66. [DOI] [PubMed] [Google Scholar]
- 23. Ney PA. Mitochondrial autophagy: origins, significance, and role of BNIP3 and NIX. Biochim Biophys Acta 2015; 1853: 2775-83. [DOI] [PubMed] [Google Scholar]
- 24. Ashrafi G, Schwarz TL. The pathways of mitophagy for quality control and clearance of mitochondria. Cell Death Differ 2013; 20: 31-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Springer MZ, Macleod KF. In Brief: Mitophagy: mechanisms and role in human disease. J Pathol 2016; 240: 253-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Zhu W, Liu F, Wang L, et al. pPolyHb protects myocardial H9C2 cells against ischemia-reperfusion injury by regulating the Pink1-Parkin-mediated mitochondrial autophagy pathway. Artif Cells Nanomed Biotechnol 2019; 47: 1248-55. [DOI] [PubMed] [Google Scholar]
- 27. Dhanabalan K, Huisamen B, Lochner A. Mitochondrial oxidative phosphorylation and mitophagy in myocardial ischaemia/ reper-fusion: effects of chloroquine. Cardiovasc J Afr 2020; 31: 169-79. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Nunes S, Danesi F, Del Rio D, et al. Resveratrol and inflammatory bowel disease: the evidence so far. Nutr Res Rev 2018; 31: 85-97. [DOI] [PubMed] [Google Scholar]
- 29. Vestergaard M, Ingmer H. Antibacterial and antifungal properties of resveratrol. Int J Antimicrob Agents 2019; 53: 716-23. [DOI] [PubMed] [Google Scholar]
- 30. Vervandier-Fasseur D, Latruffe N. The potential use of resveratrol for cancer prevention. Molecules 2019; 24: 4506. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Valentovic MA. Evaluation of resveratrol in cancer patients and experimental models. Adv Cancer Res 2018; 137: 171-88. [DOI] [PubMed] [Google Scholar]
- 32. Dyck GJB, Raj P, Zieroth S, et al. The effects of resveratrol in patients with cardiovascular disease and heart failure: a narrative review. Int J Mol Sci 2019; 20: 904-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Xu H, Cheng J, Wang X, et al. Resveratrol pretreatment alleviates myocardial ischemia/reperfusion injury by inhibiting STIM1-mediated intracellular calcium accumulation. J Physiol Biochem 2019; 75: 607-18. [DOI] [PubMed] [Google Scholar]
- 34. Liu MH, Shan J, Li J, et al. Resveratrol inhibits doxorubicin-induced cardiotoxicity via sirtuin 1 activation in H9c2 cardiomyocytes. Exp Ther Med 2016; 12: 1113-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Zhao XY, Li GY, Liu Y, et al. Resveratrol protects against arsenic trioxide-induced cardiotoxicity in vitro and in vivo. Br J Pharmacol 2008; 154: 105-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Feng H, Mou SQ, Li WJ, et al. Resveratrol inhibits ischemia-induced myocardial senescence signals and NLRP3 inflammasome activation. Oxid Med Cell Longev 2020; 2020: 2647807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Sun ZM, Guan P, Luo LF, et al. Resveratrol protects against CIH-induced myocardial injury by targeting Nrf2 and blocking NLRP3 inflammasome activation. Life Sci 2020; 245: 117362. [DOI] [PubMed] [Google Scholar]
- 38. Tian M, Xie Y, Meng Y, et al. Resveratrol protects cardiomyocytes against anoxia/reoxygenation via dephos-phorylation of VDAC1 by Akt-GSK3 β pathway. Eur J Pharmacol 2019; 843: 80-7. [DOI] [PubMed] [Google Scholar]
- 39. Zhang X, Huang L F, Hua L, et al. Resveratrol protects myocardial apoptosis induced by ischemia-reperfusion in rats with acute myocardial infarction via blocking P13K/Akt/e-NOS pathway. Eur Rev Med Pharmacol Sci 2019; 23: 1789-96. [DOI] [PubMed] [Google Scholar]
- 40. Yu D, Xiong J, Gao Y, et al. Resveratrol activates PI3K/AKT to reduce myocardial cell apoptosis and mitochondrial oxidative damage caused by myocardial ischemia/reperfusion injury. Acta Histochem 2021; 123: 151739. [DOI] [PubMed] [Google Scholar]
- 41. Sebori R, Kuno A, Hosoda R, et al. Resveratrol decreases oxidative stress by restoring mitophagy and improves the pathophysiology of dystrophin-deficient MDX mice. Oxid Med Cell Longev 2018; 2018: 9179270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Lin KL, Lin KJ, Wang PW, et al. Resveratrol provides neuroprotective effects through modulation of mitochondrial dynamics and ERK1/2 regulated autophagy. Free Radic Res 2018; 52: 1371-86. [DOI] [PubMed] [Google Scholar]
- 43. Qu X, Chen X, Shi Q, et al. Resveratrol alleviates ischemia/reperfusion injury of diabetic myocardium via inducing autophagy. Exp Ther Med 2019; 18: 2719-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Zhang B, Xu L, Zhuo N, et al. Resveratrol protects against mitochondrial dysfunction through autophagy activation in human nucleus pulposus cells. Biochem Biophys Res Commun 2017; 493: 373-81. [DOI] [PubMed] [Google Scholar]
- 45. Liu MH, Lin XL, Guo DM, et al. Resveratrol protects cardiomyocytes from doxorubicin-induced apoptosis through the AMPK/P53 pathway. Mol Med Rep 2016; 13: 1281-6. [DOI] [PubMed] [Google Scholar]
- 46. Wu X, Zhou S, Zhu N, et al. Resveratrol attenuates hypoxia/reoxygenation-induced Ca2+ overload by inhibiting the Wnt5a/Frizzled-2 pathway in rat H9c2 cells. Mol Med Rep 2014; 10: 2542-8. [DOI] [PubMed] [Google Scholar]
- 47. Xu RY, Xu XW, Deng YZ, et al. Resveratrol attenuates myocardial hypoxia/reoxygenation-induced cell apoptosis through DJ-1-mediated SIRT1-p53 pathway. Biochem Biophys Res Commun 2019; 514: 401-6. [DOI] [PubMed] [Google Scholar]
- 48. Hong W, Tatsuo S, Shou-Dong W, et al. Resveratrol upregulates cardiac SDF-1 in mice with acute myocardial infarction through the deacetylation of cardiac p53. PLoS One 2015; 10: e0128978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Granger DN, Kvietys PR. Reperfusion injury and reactive oxygen species: the evolution of a concept. Redox Biol 2015; 6: 524-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Cadenas S. ROS and redox signaling in myocardial ischemia-reperfusion injury and cardioprotection. Free Radic Biol Med 2018; 117: 76-89. [DOI] [PubMed] [Google Scholar]
- 51. Jin X, Xue B, Zhou Q, et al. Mitochondrial damage mediated by ROS incurs bronchial epithelial cell apoptosis upon ambient PM (2.5) exposure. J Toxicol Sci 2018; 43: 101-111. [DOI] [PubMed] [Google Scholar]
- 52. Sinha K, Das J, Pal PB, et al. Oxidative stress: the mitochondria-dependent and mitochondria-independent pathways of apoptosis. Arch Toxicol 2013; 87: 1157-80. [DOI] [PubMed] [Google Scholar]
- 53. Kaminskyy VO, Zhivotovsky B. Free radicals in cross talk between autophagy and apoptosis. Antioxid Redox Signal 2014; 21: 86-102. [DOI] [PubMed] [Google Scholar]
- 54. Yamashita SI, Kanki T. How autophagy eats large mitochondria: autophagosome formation coupled with mitochondrial fragmentation. Autophagy 2017; 13: 980-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Sun L, Zhao M, Yang Y, et al. Acetylcholine attenuates hypoxia/reoxygenation injury by inducing mitophagy through PINK1/parkin signal pathway in H9c2 cells. J Cell Physiol 2016; 231: 1171-81. [DOI] [PubMed] [Google Scholar]
- 56. Mcwilliams TG, Prescott AR, Montava-Garriga L, et al. Basal mitophagy occurs independently of PINK1 in mouse tissues of high metabolic demand. Cell Metab 2018; 27: 439-49.e435. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Okatsu K, Iemura S, Koyano F, et al. Mitochondrial hexokinase HKI is a novel substrate of the Parkin ubiquitin ligase. Biochem Biophys Res Commun 2012; 428: 197-202. [DOI] [PubMed] [Google Scholar]
- 58. Ham SJ, Lee D, Yoo H, et al. Decision between mitophagy and apoptosis by Parkin via VDAC1 ubiquitination. Proc Natl Acad Sci USA 2020; 117: 4281-91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Mclelland GL, Goiran T, Yi W, et al. Mfn2 ubiquitination by PINK1/parkin gates the p97-dependent release of ER from mitochondria to drive mitophagy. Elife 2018; 7: e32866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Yamada T, Dawson TM, Yanagawa T, et al. SQSTM1/p62 promotes mitochondrial ubiquitination independently of PINK1 and PRKN/parkin in mitophagy. Autophagy 2019; 15: 2012-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Lazarou M, Sliter DA, Kane LA, et al. The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 2015; 524: 309-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Marques-Aleixo I, Santos-Alves E, Torrella JR, et al. Exercise and doxorubicin treatment modulate cardiac mitochondrial quality control signaling. Cardiovasc Toxicol 2018; 18: 43-55. [DOI] [PubMed] [Google Scholar]
- 63. Liu H, Dai C, Fan Y, et al. From autophagy to mitophagy: the roles of P62 in neurodegenerative diseases. J Bioenerg Biomembr 2017; 49: 413-22. [DOI] [PubMed] [Google Scholar]
- 64. Park S, Choi SG, Yoo SM, et al. Choline dehydrogenase interacts with SQSTM1/p62 to recruit LC3 and stimulate mitophagy. Autophagy 2014; 10: 1906-20. [DOI] [PMC free article] [PubMed] [Google Scholar]





