Presence and mRNA Expression of the sar Family Genes in Clinical and Non-clinical (Healthy Conjunctiva and Healthy Skin) Isolates of Staphylococcus epidermidis

Abstract

Staphylococcus aureus possesses sar family genes, including sarA, S, R, T, U, V, X, Y, Z, and rot, which are transcription factors involved in biofilm formation and quorum sensing. In contrast, Staphylococcus epidermidis has sarA, R, V, X, Y, Z, and rot genes; specifically, SarA, Z, and X are involved in biofilm formation. The expression of the sar family members in S. epidermidis isolated from clinical and non-clinical environments is unknown. This study aimed to establish if clinical and non-clinical isolates of S. epidermidis express the sar family members. We genotyped isolates from clinical ocular infections (n = 52), or non-clinical healthy conjunctiva (n = 40), and healthy skin (n = 50), using multilocus sequence typing (MLST) and the staphylococcal chromosomal cassette mec (SCCmec). We selected strains with different genotypes and representatives of each source of isolation, and the presence of the sar family genes was detected using PCR and RT-qPCR to determine their expression. The sar family genes were present in all selected strains, with no observed differences. The relative expression of the sar family showed that all selected strains expressed each gene weakly, with no significant differences observed between them or between different sources of isolation. In conclusion, the presence and relative expression of the sar family genes are very similar among strains, with no differences based on their origin of isolation and genotype.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12088-024-01339-x.

Introduction

Staphylococcus epidermidis is currently considered an opportunistic pathogen [1]. Infections caused by S. epidermidis are primarily associated with medical devices and are challenging to treat [2]. The presence of specific antibiotic resistance genes, such as the methicillin resistance cassette, and the formation of biofilms complicates treatment [3]. Biofilms are multicellular aggregates that exhibit resistance to antibiotics and host defense mechanisms [4].

Many factors can contribute to staphylococcal virulence, including cell wall-associated proteins, secreted toxins, proteases, lipases, modulins, and biofilms. The intercellular adhesion polysaccharide (PIA) is the main component of the S. epidermidis biofilm [5]. This structure is a specialized three-dimensional framework resulting from the adhesion and accumulation of microorganisms on a biotic or abiotic surface, supported by a diverse extracellular matrix (carbohydrates, proteins, DNA, or a combination of any of them) [6].

The IcaADBC operon codifies for PIA synthesis responsible proteins, which consists of four genes: icaA, icaD, icaB, and icaC, along with a repressor gene, icaR, and two promoters, P1 and P2 [7]. The SarA protein encoded by the sarA gene (staphylococcal accessory regulator gene) regulates transcription of the IcaADBC operon [8]. This protein acts as a promoter activator through the P2 promoter [8].

Finally, after biofilm maturation, the biofilm undergoes degradation through a bacterial population census, referred to as "quorum sensing." The release of bacteria from the biofilm enables them to attach to another surface [9]. The Agr operon mediates quorum sensing in S. epidermidis, and it is similar to Staphylococcus aureus, playing a role in the induction of virulence proteins such as toxins and modulins [10].

S. aureus has many transcription factors related to metabolism, environmental adaptation, and virulence in its genome. These transcription factors are crucial for various functions in this microorganism, allowing the expression of other genes essential for S. aureus development. Among these transcription factors, the group known as the MarR/SlyA family (multiple antibiotic resistance regulators) represents one of the most important transcription factor groups related to virulence [11]. Within the MarR/SlyA family, there is a subfamily called Sar, which consists of 11 members: Rot, SarA, SarS, SarR, MgrA, SarT, SarU, SarV, SarX, SarY, and SarZ [12]. These members are directly or indirectly involved in regulating target genes related to virulence, biofilm formation, autolysis, antibiotic resistance, and metabolic processes [13].

Sar proteins are classified based on their structural features into three groups: (1) single-domain proteins, including SarA, -R, -T, -V, -X, and Rot; (2) two-domain proteins, including SarS, -U, and -Y; (3) MarR-like proteins, such as MgrA and SarZ [14].

As mentioned earlier, the SarA protein plays a vital role in biofilm formation by activating the P2 promoter of the IcaADBC operon [8]. Moreover, members of the Sar subfamily regulate the Agr operon (responsible for quorum sensing) [15]. There is also evidence of internal regulation within the Sar subfamily, where these genes can be activated or repressed by other subfamily members [16]. In S. aureus, SarR negatively regulates SarA and is a positive activator of Agr operon, similar to SarU. In contrast, SarX is a negative regulator of Agr operon, and MgrA can regulate SarX. Rot represses the synthesis of toxins induced by the Agr operon. SarS activates the synthesis of protein A, and SarT is an activator of the sarS gene and a repressor of alpha hemolysin (hla) synthesis. SarZ is a positive regulator of hla gene. SarV is a positive regulator of autolysis repressed by SarA and MgrA. The function of SarY remains to be discovered [16]. This subfamily has also been implicated in other processes related to staphylococcal virulence.

In the case of S. epidermidis, the Sar subfamily consists of SarA, R, V, X, Y, Z, and Rot [17–20]. Some of these proteins are involved in biofilm formation, such as SarA, SarZ, and SarX [18, 20] in laboratory strains, but their role in clinical isolates still needs to be discovered; even more, the functions of the other members of this subfamily in this bacterium still need to be clarified. Therefore, this study aimed to determine the expression level of the Sar subfamily in clinical and commensal isolates of S. epidermidis and to compare their expression under normal bacterial growth conditions.

Materials and Methods

Strains

The strains used in this study correspond to isolates obtained in previous work [21] from patients with ocular infections (n = 52), from the conjunctiva of individuals without ocular infections (n = 40), and from the forearms of healthy volunteers (n = 50).

For the genotyping of the isolates, Multilocus Sequence Typing (MLST) of ocular infection, healthy conjunctiva, and healthy skin isolates was performed by the previous study of Flores-Páez et al. [21].

Genomic DNA Extraction

Strains were inoculated in trypticase soy broth (TSB, Sigma-Aldrich, Edo. Mexico, Mexico) and incubated for 24 h. Afterward, they were centrifuged at 21,633 × g for 1 min. The cells were resuspended in 200 µL of saline solution, and glass beads (≤ 100 µm) were added to cover half of the volume. The tubes were agitated in a cell disruptor (Genie, Scientific Industries, SI-DD38, USA) for 5 min. Following agitation, 200 µL of Winston's solution (2% triton x-100, 1% SDS, 100 mM NaCl, ten mM Tris base, pH 8, 1 mM EDTA) and 400 µL of phenol–chloroform-isoamyl alcohol solution (25:24:1) were added. The mixture was inverted and centrifuged at 13,845 × g for 15 min. After this, the aqueous phase was separated, and DNA was precipitated with isopropanol at double the original volume. It was allowed to incubate at room temperature for 10 min. The mixture was centrifuged at 13,845 × g for 15 min, washed twice with 70% ethanol, and finally resuspended in sterile distilled water, stored at −20 °C until use.

Multiple PCR for Strain Genotyping Using SCCmec Cassette

Once the DNA from the strains was obtained, each concentration was determined, and it was diluted to a concentration of 100 ng/µL. The SCCmec cassette was determined based on Velázquez et al. [22], involving a PCR with primers for the mecA gene and SCCmec cassette types I, II, III, and IV. Subsequently, another PCR was carried out with primers for the subtypes of type V (Va, Vb, Vc, Vd). PCR conditions were based on Velázquez et al. [22].

PCR for Amplification of sar Genes

Sar genes amplification was carried out in a total reaction volume of 25 µL, containing 5 µL of 5 × buffer (Bioline, TN, USA), 0.5 µL of forward primer (10 µM), and 0.5 µL of reverse primer (10 µM) for each gene (Table 1), 0.2 µL of Taq DNA polymerase (5 U/µL) (Bioline), and 1 µL of genomic DNA. The PCR conditions were as follows: 94 °C for 2 min, 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, followed by a final extension step at 72 °C for 5 min, using a thermocycler (Thermo Hybaid PxE 0.2, USA).

Table 1.

sar genes primers

Gene	Primers sequence	Gene locus	bp	Tm (°C)	%GC	Amplicon (bp)
sarA	F: TCTTTCATCGTGTTCATTACG	106–127	21	59	38.1	178
	R: AATCAGCTTTGAAGAATTTGC	263–284	21	58	33.3
sarR	F: TACTGTTCTTTCATCATGCAC	76–97	21	59	38.1	116
	R: AAGAAATTGCTACATGTTCAG	171–192	21	57	33.3
sarV	F: CGGTTTCTGAGCGTAATTTAG	96–117	21	59	42.9	106
	R: CGAGACACATTACATTTCGAG	181–202	21	59	42.9
sarX	F: TTAGATGAGCGAATTCTTATGC	133–155	22	59	36.4	199
	R: CAAATAAAGCATCAAATTCACTC	309–332	23	57	30.4
sarY	F: TCTTAATAATAGGTCCCATTGC	153–175	22	58	36.4	170
	R: GTGCCATAGTCAATTTAGAGTG	301–323	22	59	40.9
sarZ	F: AATGGCGATAGAAGATGATGAG	132–154	22	60	40.9	174
	R: TTAAAGAAATTTGAAGGTTCCG	274–296	22	58	31.8
Rot	F: TGTACGTTCATCATCTTGAGG	127–148	21	60	42.9	131
	R: AAGGCTCAATGACTTTAAAGG	237–258	21	59	38.1

F = forward; R = reverse; bp = base pairs; Tm = melting temperature; GC = guanin-cytosine

RNA Extraction

Total RNA was extracted from 3 mL of bacterial culture grown in TSB medium at 37 °C for 24 h. The bacterial pellet was obtained by centrifugation at 15,000 × g for 3 min. The supernatant was removed, and a wash was performed with TE buffer (10 µM Tris, one µM EDTA, pH = 8). Subsequently, 200 µL of TE buffer and glass beads (≤ 100 µm) were added to cover half of the volume, and cell lysis was achieved using a cell disruptor at 865 × g for 7 min. Afterward, 800 µL of Trisure (Bioline) was added, and the disruption continued for 3 min. The mixture was centrifuged at 15,000 × g for 3 min, and the Trisure was collected in a new tube. 200 µL of chloroform was added, mixed by inversion, and incubated at room temperature for 10 min. Afterward, it was centrifuged at 15,000 × g for 10 min, and the aqueous phase was collected. The volume obtained was doubled with isopropanol and precipitated at −20 °C for 12 h. After this time, the tubes were centrifuged at 15,000 × g for 15 min. The supernatant was decanted, and 100 µL of 70% ethanol was added. It was then centrifuged at 15,000 × g for 15 min, decanted, and the remaining ethanol evaporated. Finally, the RNA was resuspended in 20 µL of sterile distilled water. In addition to the extraction, the RNA was treated with DNase I (Bioline), using 2 µL of DNase I buffer (10x) and 1 µL of DNase I (10,000 units). The tubes were incubated at 37 °C for 45 min; then, the temperature was raised to 75 °C for 10 min to inactivate the enzyme.

cDNA Synthesis

Once total RNA was obtained, the concentration was determined using a NanoDrop 2000 (Thermo Scientific, USA) to adjust each sample to a concentration between 3 and 6 µg/µL. For each sample, two Eppendorf tubes with total RNA were used, corresponding to a positive and a negative RT-PCR, to which 1 µL of Random Hexamer (Bioline) was added, and the volume was adjusted to 10 µL with sterile distilled water. They were then subjected to 75 °C for 10 min and immediately placed on ice. Subsequently, each tube received 4 µL of buffer (5x), 2 µL of DTT (0.1 M dithiothreitol), 1 µL of dNTPs (10 mM), and 2 µL of water, and they were incubated for 2 min at room temperature. Then, 1 µL of M-MLV reverse transcriptase enzyme (Bioline) was added to the tube corresponding to the positive RT-PCR, and it was incubated at room temperature for 8 min. Finally, they were placed in a thermocycler at 37 °C for 1 h and then at 65 °C for 10 min.

Real-Time PCR

A reaction mixture was prepared with the following reagents: 2 µL of cDNA, 10 µL of Master Mix (SYBR green one master), 0.2 µL of each primer (forward and reverse; Table 1), and 7.6 µL of water for each tube. A real-time thermocycler (Line-Gene K) was used with a PCR program consisting of an initial step at 94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s and 60 °C for 40 s for each cycle. The relative expression was calculated using the 2-$\mathrm{\Delta }\mathrm{\Delta }$Ct method, with 16S rRNA as the reference housekeeping gene.

Statistical Analysis

Fisher's exact test was used to compare the proportions of SCCmec types to determine significant differences, and the two-way ANOVA analysis with Tukey´s multiple comparison test was used to compare the expression of sar genes.

Results

Genotyping of S. epidermidis Strains Using SCCmec and MLST

A representative of the SCCmec cassette genotyping is shown in Fig. 1, displaying the electrophoretic migration of the amplified products corresponding to each type of the SCCmec cassette.

Fig. 1.

SCCmec cassette types. The electrophoretic pattern exhibited by each amplified product is exemplified according to their molecular size. Lane 1: molecular size marker (M), Lane 2: strain 35 (type I), Lane 3: strain 50 (type II), Lane 4: strain 7 (type III), Lane 5: strain 82 (type IV)

The results of the SCCmec cassette type for each strain and the percentages within each source of isolation are shown in Supplementary Tables 1, 2, and 3. Table 2 displays the summary of SCCmec genotyping for each source of isolation. SCCmec type II was the most frequently encountered in all three sources of isolation, with isolates from ocular infections at 31%, those from healthy conjunctiva at 35%, and those from healthy skin at 40%. The second most common SCCmec types for ocular infection isolates were types I (27%) and IV (27%). For healthy conjunctiva isolates, it was type IV at 27.5%; for healthy skin isolates, it was type III at 22%. SCCmec type V was not found in any strains analyzed in this study.

Table 2.

Percentage of SCCmec cassette type in the three sources

Source	SCCmec cassette type (number of strains)
	I (%)	II (%)	III (%)	IV (%)	V (%)
Ocular infections	14 (27)	16 (31)	8 (15)	14 (27)	0
Healthy conjunctiva	7 (17.5)	14 (35)	8 (20)	11 (27.5)	0
Healthy skin	10 (20)	20 (40)	11 (22)	9 (18)	0

Considering the different genotypes of ST (Multilocus Sequence Type) reported by Flores-Paéz et al. [21] and the type of SCCmec cassette (Supplementary Tables 4, 5, and 6), representative strains were selected for each ST and SCCmec group from each source of isolation. In total, we chose 28 strains, distributed as 14 strains from healthy conjunctiva, 6 from healthy skin, and 8 from ocular infections (Table 3).

Table 3.

Selected strains

Ocular infection			Healthy concjuctiva			Healthy skin
Strain	ST	SCCmec	Strain	ST	SCCmec	Strain	ST	SCCmec
35	2	I	13	26	II	6	2	II
50	9	II	17	135	IV	7	189	III
54	23	II	29	494	II	9	481	II
90	87	I	31	43	IV	47	370	II
96	10	I	35	23	II	52	9	I
98	38	I	48	9	II	82	23	IV
1654	71	III	92	4	II
1948	46	IV	94	238	III
			103	48	III
			106	5	II
			128	118	II
			131	173	II
			137	10	I
			139	2	I

ST = sequence type; SCCmec = Staphylococcal chromosome cassette mec

Determination of the Presence of sar Genes

The genetically selected strains were examined for their genomes' presence of the sarA, sarR, sarV, sarX, sarY, sarZ, and rot genes. All strains analyzed exhibited all sar genes and rot, except for strains 82 and 1948, which belong to isolates from healthy skin and ocular infections, respectively, and did not have the sarA gene (Supplementary Tables 4, 5, and 6).

Relative Expression of sar Genes in the Selected Bacteria

After confirming that all selected strains from each source of isolation had the sar genes, we conducted a relative expression analysis for each sar gene. The analysis of relative gene expression for the sar genes showed that the isolates from ocular infections had similar expression values for all of them, ranging between 0.54 and 0.71 (Table 4). The relative expression values for the individual sar genes in each strain were very similar, and we observed the same pattern for the other genes in the Sar subfamily. We confirmed the same observation for the other two isolation sources, with relative expression values ranging from 0.54 to 0.71. Similarly, when comparing the results between each sar gene and each strain, they were very similar, indicating no significant differences (p > 0.05, ANOVA analysis with Tukey’s test) in expression between strains for each gene and among the three groups (Tables 4, 5, and 6). The relative expression values obtained in this assay were less than 1, indicating that the relative expression was lower than that of the reference gene 16S rRNA. Therefore, we considered that the sar genes exhibited weak expression.

Table 4.

Relative expression of sar genes in S. epidermidis isolated from ocular infections

		Ocular infections				Relative expression
Strain	ST	SCCmec	sarA (Ctp = 21.6)	sarR (Ctp = 21.6)	sarV (Ctp = 21.5)	sarX (Ctp = 21.8)	sarY (Ctp = 21.8)	sarZ (Ctp = 21.6)	rot (Ctp = 21.8)
35	2	I	0.58	0.58	0.54	0.65	0.71	0.6	0.68
50	9	II	0.6	0.6	0.6	0.68	0.71	0.58	0.68
54	23	II	0.6	0.63	0.55	0.65	0.68	0.6	0.65
90	87	I	0.6	0.6	0.54	0.65	0.68	0.6	0.65
96	10	I	0.58	0.63	0.54	0.68	0.68	0.6	0.68
98	38	I	0.58	0.63	0.55	0.63	0.65	0.58	0.68
1654	71	III	0.6	0.63	0.55	0.68	0.68	0.58	0.65
1948	46	IV	0.6	0.55	0.55	0.71	0.65	0.58	0.65

ST = sequence type; SCCmec = Staphylococcal chromosome cassette mec; C_tp corresponds to the average of Ct

Table 5.

Relative expression of sar genes in S. epidermidis isolated from healthy conjunctiva

		Healthy conjunctiva				Relative Expression
Strain	ST	SCCmec	sarA (Ctp = 21.8)	sarR (Ctp = 21.7)	sarV (Ctp = 21.8)	sarX (Ctp = 21.6)	sarY (Ctp = 21.8)	sarZ (Ctp = 21.6)	rot (Ctp = 21.8)
13	26	II	0.68	0.6	0.68	0.6	0.65	0.58	0.68
17	135	IV	0.65	0.65	0.65	0.6	0.65	0.58	0.68
29	494	II	0.65	0.6	0.63	0.63	0.68	0.58	0.71
31	43	IV	0.6	0.71	0.68	0.6	0.68	0.55	0.71
35	23	II	0.68	0.71	0.65	0.63	0.68	0.58	0.68
48	9	II	0.68	0.71	0.68	0.63	0.63	0.58	0.65
92	4	II	0.68	0.63	0.68	0.65	0.63	0.58	0.65
94	238	III	0.68	0.63	0.68	0.6	0.68	0.58	0.68
103	48	III	0.68	0.65	0.65	0.6	0.65	0.6	0.68
106	5	II	0.65	0.68	0.65	0.6	0.65	0.6	0.63
128	118	II	0.63	0.65	0.71	0.63	0.65	0.6	0.68
131	173	II	0.71	0.65	0.71	0.63	0.68	0.58	0.65
137	10	I	0.71	0.63	0.68	0.63	0.68	0.58	0.65
139	2	I	0.71	0.68	0.68	0.68	0.68	0.55	0.65

ST = sequence type; SCCmec = Staphylococcal chromosome cassette mec; C_tp corresponds to the average of Ct

Table 6.

Relative expression of sar genes in S. epidermidis isolated from healthy skin

		Healthy skin				Relative expression
Strain	ST	SCCmec	sarA (Ctp = 21.7)	sarR (Ctp = 21.7)	sarV (Ctp = 21.6)	sarX (Ctp = 21.8)	sarY (Ctp = 21.7)	sarZ (Ctp = 21.5)	rot (Ctp = 21.9)
6	2	II	0.6	0.58	0.6	0.65	0.68	0.55	0.71
7	189	III	0.68	0.65	0.58	0.68	0.68	0.58	0.71
9	481	II	0.65	0.63	0.58	0.65	0.65	0.55	0.68
47	370	II	0.63	0.68	0.6	0.65	0.65	0.55	0.68
52	9	I	0.63	0.68	0.6	0.68	0.65	0.58	0.71
82	23	IV	0.65	0.63	0.6	0.63	0.6	0.6	0.65

ST = sequence type; SCCmec = Staphylococcal chromosome cassette mec; C_tp corresponds to the average of Ct

Discussion

The sar gene subfamily functions as transcription factors and is involved in various processes related to the pathogenicity of S. aureus [12]. However, the presence and expression of the sar gene subfamily in S. epidermidis from different sources of isolation (clinical and non-clinical) with different genotypes (SCCmec and MLST) have yet to be studied, which was the focus of this work.

The presence of the sar gene subfamily was consistent in all studied strains, regardless of SCCmec type, genotype ST, or the source of isolation, except for strains 82 and 1948 isolated from healthy skin and ocular infections, respectively, where the sarA gene was not detected. These findings suggest that the sar gene subfamily is present in S. epidermidis strains and may be necessary for the biology of this bacterium, both in terms of virulence and commensal lifestyle. This result is similar to what was reported by Ibarra (2013) [12], who found the sar gene subfamily present in 12 strains of S. aureus. In the case of S. aureus, the sar subfamily consists of 10 members. However, proteins SarT and SarU are absent in some sequenced clinical S. aureus isolates, such as strains UAMS-1, MRSA252, and RF122, as well as in other Staphylococcus species [23–25]. SarT and SarU appear absent in the S. epidermidis genome, so they were not studied.

Regarding the relative expression of the sar gene subfamily, we expected that there would be differences in expression between S. epidermidis strains isolated from clinical cases (ocular infections) and commensal strains. However, the results indicated no difference in the expression of the sar genes among the three sources of isolation and a low relative expression in all strains. A study involving six clinical and laboratory strains of S. aureus demonstrated that the relative expression of the Sar subfamily exhibited a similar pattern among them and was growth phase-dependent, except for the sarX gene. In other words, the sar gene expression was higher during the exponential growth phase and lower during the late exponential phase [26]. These results are similar to our work and partly explain the low expression of the sar genes in our strains since we determined their expression during the late exponential growth phase (24 h).

Furthermore, it has been shown that some members of the Sar subfamily are transcribed or translated at shallow levels under normal growth conditions, as is the case for sarU, sarT, and sarV [27–29]. The Sar subfamily is interconnected, and they can repress each other transcriptional elements. This idea partly explains the low expression; for instance, shallow transcription of sarV or sarT is associated with repression mediated by MgrA and SarA, while a sarT mutant enhances the undetectable transcription of sarU [27–29]. Interestingly, this weak expression pattern of the sar subfamily is also present in non-clinical strains, such as conjunctival and healthy skin strains. This observation suggests that the sar subfamily is essential in S. epidermidis, as the expression of these genes is not related to the source of isolation or genotype, implying that the sar genes are involved in the general biological functionality of the bacterium and possibly independent of its virulence.

While this study focused on transcriptional levels, there might be differential changes at the translational level, as seen in the case of the sarA gene. Transcription is more robust during the early exponential growth phase of S. aureus strains RN6390, SH1000, and COL, but translation is constitutive and independent of the growth phase. The same pattern is observed for the rot gene in S. aureus strains UAMS-1 and RN6390, and for SarZ, there is no correlation between transcription and translation during different growth phases [26]. This phenomenon has also been observed in S. aureus strains RN6390 and UAMS-1 [30]. These remarks suggest that the Sar subfamily might be regulated at the translational level, or there may be factors contributing to the stability of these proteins, implying that the low transcription of the sar genes in our isolates does not necessarily indicate low translation levels.

Despite the many similarities between S. epidermidis and S. aureus, differences exist in the Sar subfamily. For instance, SarA has been shown to induce biofilm formation in S. aureus [31] while it represses biofilm formation in S. epidermidis [32]. Additionally, SarX and SarZ have been characterized in strains S. aureus RN6390, SH1000, Newman, and S. epidermidis 1457. However, the transcription and translation levels of SarX are high during the late exponential growth phase in S. aureus RN6390 [26], in contrast to our strains where transcription of sarX was low. In S. epidermidis, SarX, and SarZ are involved in biofilm formation [18, 20], while in S. aureus, SarX negatively regulates the Agr system [33], and SarZ induces hla expression [34]. Rbf represses SarX transcription in S. epidermidis [19].

Regarding SarR, S. aureus UAMS-1 has low transcription levels throughout all growth phases, but in other S. aureus strains, maximal transcription occurs during the exponential growth phase [26]. In our strains, transcription levels for sarR and sarV were consistently low. sarV transcription has been reported to be very low in S. aureus strain RN6390, and sarU and sarT genes are undetectable in some S. aureus strains. Moreover, the transcription of sarV and sarT genes is repressed by SarA and MgrA, while SarT can repress the transcription of sarU [26–29]. In S. epidermidis, SarR represses the ica operon for PIA production and biofilm formation [19].

Mutants of sarA, rot, mgrA, and sarZ in S. aureus have shown changes in the expression of several genes, indicating the importance of these Sar proteins in gene regulation. These same mutants have demonstrated their involvement in bacterial virulence using various infection models [13, 20, 34–36]. In S. epidermidis, little is known about their role in virulence at the in vivo level, in addition to the mechanism by which the Sar subfamily is regulating and how they induce target genes. In the study of S. epidermidis in vivo, it is plausible that the expression pattern of the Sar subfamily can change since the conditions are different than at the laboratory level, determining the role they play in the virulence of S. epidermidis.

Regarding the involvement of the Sar subfamily in biofilm formation, it has been documented that in S. aureus, SarA acts as a regulator of biofilm formation. SarA inhibits the production of proteases and nucleases, thereby increasing biofilm production, as these enzymes can degrade proteins involved in biofilm, such as AtlE, Aap, and eDNA [37]. Additionally, Rot is involved in this process, as it can repress the levels of secreted proteases, thus inducing biofilm formation [38]. SarX promotes biofilm production by increasing the expression of the ica operon and the production of polysaccharide intercellular adhesin (PIA) [39, 40]. On the other hand, SarZ acts as a repressor of factors involved in biofilm formation [41].

For S. epidermidis, SarA is a positive regulator of biofilm production by activating the transcription of the ica operon for PIA production. Additionally, SarA regulates virulence factors of this bacterium other than biofilm [8]. However, the work of Christner et al. 2012 suggests the opposite, indicating that SarA is a biofilm repressor [32], implying that SarA may have both activator and repressor functions in biofilm formation depending on environmental conditions. In a regulatory mechanism of the ica operon, it has been shown that the protein Rbf binds to the sarR gene promoter but not to the promoters of sarX, sarA, and sarZ. This binding represses sarR transcription and biofilm production, indicating that SarR is a biofilm repressor. Additionally, Rbf indirectly represses sarX expression [19]. SarX induces biofilm formation by specifically binding to the ica operon promoter to positively regulate its expression [18], and SarX expression may be controlled by Rbf [19]. Similarly, SarZ also induces biofilm formation by promoting the expression of ica genes, resulting in increased PIA production [20].

In conclusion, the relative expression of the sar gene subfamily in the S. epidermidis strains analyzed is homogeneous, and we did not find differences according to the origin of isolation or the genotype of each strain. The experimental conditions used in this work only allowed us to observe a weak relative expression of the sar genes. However, under in vivo conditions, the expression of the sar genes could be different, implying the need for more research in this area.

Supplementary Information

Below is the link to the electronic supplementary material.

Author Contribution

MECD: Investigation, methodology, formal analysis. FGC: Data curation, formal analysis, and resources. JCCD: Resources, funding acquisitions, writing—original draft.

Funding

This study has been supported by the Secretaria de Investigación y Posgrado (SIP) del Instituto Politécnico Nacional, Escuela Nacional de Ciencias Biológicas, Mexico City, Mexico (No. SIP-20230967).

Data Availability

All data could be obtained by contacting the corresponding author.

Declarations

Conflict of interest

All authors declare that there is no commercial interest in this study.

Ethics Approval

Not applicable.