Abstract
Simian immunodeficiency viruses (SIV) harbor primer binding sites (PBS) matching tRNA
or tRNA
. To study determinants of primer usage in SIV, a SIVmac239-based vector was impaired by mutating the PBS to a sequence (PBS-X2) with no match to any tRNA. By cotransfection of a synthetic gene encoding a tRNAPro-like RNA with a match to PBS-X2, the activity of this vector could be restored to a transduction efficiency slightly lower than that of the wild-type vector. A vector with a PBS matching tRNAPro was functional at a level slightly below that of the wild-type vector, but higher transduction efficiency could be obtained by cotransfection of a gene for an engineered tRNAPro-tRNA
hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA
backbone, which led to three- to fourfold-higher titers than those observed for the x2 primer with the tRNAPro backbone. In summary, our results demonstrate flexibility in PBS and primer usage for SIVmac239, with PBS-primer complementarity being the major determinant, in analogy with previous findings for murine leukemia viruses and human immunodeficiency virus type 1.
Retroviruses replicate through reverse transcription of the viral RNA genome into a double-stranded DNA form that is integrated into the genome of the host. The virus-encoded reverse transcriptase (RT) enzyme mediates this process through the use of a host-encoded tRNA. The 3′-terminal 18-nucleotide (nt) segment of the tRNA primer molecule anneals to the RNA genome at a complementary sequence known as the primer binding site (PBS). In order to synthesize a double-stranded DNA copy, two template shifts are involved. In plus-strand synthesis, the 3′ 18-nt segment of the tRNA primer is reverse transcribed into a DNA copy, which mediates the second template shift by annealing to the minus-strand DNA copy of the PBS. Accordingly, the PBS sequence of the transduced provirus may originate from a copy of the genomic PBS RNA sequence or from copying of the 3′ 18 nt of the tRNA primer.
Different tRNA species are used as primers among retroviruses; however, for each group of viruses, the PBS is stably maintained during replication. Murine leukemia viruses (MLV) and human T-cell leukemia virus use a tRNAPro, the avian sarcoma-leukosis virus (ASLV) group uses a tRNATrp, and a tRNA
is used as a primer for reverse transcription in mouse mammary tumor virus and in human and simian immunodeficiency viruses (HIV and SIV, respectively) (reviewed in references 33 and 35).
Mechanisms of PBS maintenance during replication have been studied in a variety of viruses. MLV mutated in the PBS to match the 3′ end of other tRNAs are able to use noncognate primers in multiple rounds of replication (6, 30, 36). In contrast, PBS-mutated HIV-1 and ASLV may initially replicate, but in time revert to their cognate tRNA during serial transfer of PBS-mutated viruses (7, 25, 47, 49). The selective reversion and maintenance of the cognate primer in these viruses may be accomplished by non-PBS determinants.
The lentiviruses of the SIV group have attracted attention due to the development of animal models for the study of AIDS (9) and the development of lentivirus vectors for gene therapeutic purposes (34, 43). Although SIVs and HIV-1 share common features, the SIVmac239 isolate used in this study differs from HIV-1 in lacking an adenosine-rich loop situated in the U5 hairpin (3, 4), which has been implicated in determining primer specificity in HIV-1 (19–24, 27, 46, 52). To study the determinants for primer specificity in SIV, we have established a system in which the viral RNA genome as well as the tRNA primer may be manipulated. By using synthetic genes encoding tRNA-like molecules complementary to PBS-mutated SIV vectors, it is demonstrated that the PBS is the primary determinant for primer specificity in initiation of first-strand synthesis and plus-strand transfer resulting in the formation of a provirus. In this experimental setup, it is possible to study the effect on the transduction titers exerted by sequences outside the PBS-complementary 3′ 18 nt of the tRNA-like primer, because no endogenous competitor tRNA molecule is able to compete for binding to the mutant PBS.
Design of PBS-mutated vectors and engineered tRNA-like primers.
The PBS of a SIV-based green fluorescent protein (GFP) vector (SIVGFP) was mutated, and constructs encoding putative tRNA-like primers were designed. SIVGFP-Pro contains a PBS-Pro for which the corresponding tRNA proline is found in the cell. SIVGFP-X2, however, harbors a PBS-X2 for which no matching endogenous tRNA exists (Fig. 1). In the case of SIVGFP-Pro, a PBS for the tRNA proline was introduced into the PBS of SIVGFP by PCR-mediated site-directed mutagenesis (29) in which primer set A (primers 1 and 2) (Table 1) and primer set B (primers 3 and 4) generated two PCR products with SIVGFP as a template. The two PCR products were combined in an overlap extension reaction with primers 2 and 4. The resulting fragment was cloned into SIVGFP. For SIVGFP-X2, the PBS was mutated at 11 nt positions that were originally selected to give a minimal match to any known murine tRNA (28) with primer set A (primers 5 and 2) and primer set B (primers 6 and 4). The SIVGFP vector is an env deletion mutant of SIVmac239, in which the nef gene has been replaced by the enhanced GFP (EGFP) reporter gene (Fig. 1) (Δenvgfp in reference 43).
FIG. 1.
Vector structure. The SIVmac239-based vector SIVGFP is shown at the top. The sequences of the introduced PBS mutations are shown below. The mismatch marker mutation relative to the engineered corresponding tRNA-like primer is shown in boldface.
TABLE 1.
Oligonucleotides used in this study
| Primer | Sequence (5′→3′) |
|---|---|
| 1 | p-TTGGGGGCTCGTYCGGGATTTGAAGGAGAGTGAGAGACTCCTGA |
| 2 | CGGGCTTAATGGCAGGTGGACA |
| 3 | p-GTACTCAGGAGTCTCTCACTCTCCTTCAAATCCCGRACGAGGGGC |
| 4 | CGCTGAAACAGCAGGGACTT |
| 5 | p-TTGGTCAGYTGCAGGGGATTTGAAGGAGAGTGAGAGACTTCTGA |
| 6 | p-TTCAAATCCCCTGCARCTGACCAATCTGCTAGGGATTTTC |
| 7 | GGAAAGCTTAAAAAAGACATGC |
| 8 | CCGGAATTCAAAAAGTAAAGCTCTCGTGAAGACAGCTGCTAGCTCAGTCGGTAGAGCATCAGACTTTTAATCTGAGGGTCAGGGGTTCAAATCCCCTGCAGCTGAGCATGTCTTTTTTAAGCTTTCC |
| 9 | CCGGAATTCAAAAAGTAAAGCTCTCTCGTGAAGAGGCTTAGCTCAGTCGGTAGAGCATCAGACTTTTAATCTGAGGGTCCCGGGTTCAAATCCCGGACGAGCCCGCATGTCTTTTTTAAGCTTTCC |
| 10 | TGGTCAGCTGCAGGGGAT |
| 11 | Biotin-AAAAATTGGTCAGCTGCAGGGGAT |
| 12 | GGGGAATTCTGGAAGGGATTTATAAGAG |
| 13 | CCCCTTCCTGGATAAAAGACA |
The constructs designed to encode the synthetic tRNA-like primer molecules ptRNAx2pro, ptRNAx2lys-3, and ptRNAprolys-3 were constructed from deoxyoligonucleotides and cloned as described in reference 28. ptRNAx2pro is identical to ptRNAx2 in reference 28, whereas ptRNAx2lys-3 and ptRNAprolys-3 were constructed by annealing the 22-nt elongation primer 7 to the 127-nt primers 8 and 9, respectively. The sequences of primers 8 and 9 were based on that of tRNA
(GenBank accession no. K01797) (41). The predicted structures of ptRNAx2pro and ptRNAprolys-3 are shown in Fig. 2A. The 3′ 18-nt sequence of ptRNAx2pro matches that of PBS-X2, but otherwise it resembles the sequence of tRNAPro, whereas ptRNAprolys-3 matches PBS-Pro at the 3′ end, but resembles tRNA
. The synthetic tRNA-like primers were processed correctly with regard to trimming of the tRNA precursor at the 5′ and 3′ termini, because the transcript sizes correspond to the expected 75 and 76 nt for ptRNAx2pro and ptRNAx2lys-3, respectively (Fig. 2B), as shown by Northern hybridization after transfection into human BOSC 23 packaging cells (37), as described in reference 28. The addition of the nonencoded CCA sequence to the trimmed 3′ end of the synthetic tRNAs was verified by a tRNA tagging assay (31), in which the presence of the CCA tail was a designed prerequisite (Fig. 2C) for the synthesis of the radioactively labeled product seen in Fig. 2D.
FIG. 2.
(A) Structure of the murine tRNAPro (16) and tRNA
(38) and putative structures of synthetic tRNAs. Mutations relative to tRNAPro and tRNA
are boxed. (B) Northern hybridization. Ten micrograms of total RNA from human BOSC 23 cells transfected with ptRNAx2lys-3 (lane 2) or ptRNAx2pro (lane 3) was separated on an 8% polyacrylamide–urea gel, blotted, and hybridized to an X2-specific probe (primer 10). The DNA markers are shown in lane 1. (C) tRNA tagging assay. Total RNA from BOSC 23 cells was incubated with a biotinylated oligonucleotide complementary to the 3′ 18 nt of tRNAPro (31) or tRNAx2lys-3 (primer 11), respectively. Following magnetic separation, the annealed tRNA was extended in the presence of [32P]dATP and separated on an 8% polyacrylamide–urea gel. (D) tRNA tagging gel showing total RNA from BOSC 23 cells incubated with the tRNAPro-specific oligonucleotide (lane 2). In lane 3, total RNA from BOSC 23 cells transfected with ptRNAx2lys-3 was incubated with primer 11. Lane 1 shows DNA size markers.
A mismatch between vector PBS and primer was introduced by altering 1 nt in the PBS of SIVGFP-X2 and SIVGFP-Pro, yielding SIVGFP-X2m and SIVGFP-Prom, respectively (Fig. 1), to distinguish the PBS sequences of the primer and PBS origin during replication.
Complementation of PBS mutations by designed tRNA-like primers.
The effect of PBS mutations on the infectivity of SIVGFP was determined by transient transfections of 293T cells (293ts/A1609) (10) with the different mutants of SIVGFP together with the vesicular stomatitis virus glycoprotein G (VSV-G)-encoding pHIT-G plasmid (14) following calcium phosphate coprecipitation (44). Table 2 shows the SIVGFP vector titers in the supernatant of the transfected cells determined on 293A cells (Quantum Biotechnologies, Laval, Canada). 293A cells, a subclone of 293 cells, were used for titration since they show stronger adherence to plastic dishes than 293T cells. The transfection efficiency was monitored by determination of capsid antigen levels in the supernatant of the transfected cells by employing an HIV-1 capsid enzyme-linked immunosorbent assay kit (Innogenetics, Ghent, Belgium). The 293A target cells were seeded in 24-well plates at a density of 5 × 104 cells per well. The following day, the medium was removed and cells were incubated for 2 to 4 h with serial dilutions of 200 μl (per well) of the supernatant from the transfected cells. Two days after infection, the number of GFP-positive cells was counted. The infectivity of the vectors was calculated by dividing the vector titer by the amount of capsid antigen and is expressed relative to the infectivity of wild-type SIVGFP.
TABLE 2.
Vector transduction efficiencies
| Plasmid cotransfected with VSV-G
|
Results for:
|
||||
|---|---|---|---|---|---|
| PBS mutants | tRNA/mock | Expt 1
|
Expt 2
|
||
| Titer (GFU)/ng of p27CAa | % Infectivityb | Titer (GFU)/ng of p27CAa | % Infectivityb | ||
| SIVGFP | pBluescript | 5.5 × 105/2.7 | 100 | 1.5 × 105/9.2 | 100 |
| SIVGFP-X2 | pBluescript | <5/3.1 | <0.0008 | 5/11.4 | 0.0027 |
| SIVGFP-X2 | ptRNAx2pro | 8.5 × 104/2.6 | 16 | 2.4 × 104/6 | 25.9 |
| SIVGFP-X2m | pBluescript | <5/5.7 | <0.0004 | 20/14 | 0.0088 |
| SIVGFP-X2m | ptRNAx2pro | 9.8 × 104/2.7 | 18 | 8.7 × 104/6.1 | 87.5 |
| SIVGFP-Pro | pBluescript | 7.7 × 104/8.7 | 4.3 | 2.4 × 104/14.6 | 10 |
| SIVGFP-Pro | ptRNAprolys-3 | 2.8 × 105/8.7 | 16 | 9.2 × 104/15.8 | 36 |
| SIVGFP-Prom | pBluescript | 1.9 × 104/6.4 | 1.5 | 3.1 × 103/14.9 | 1.2 |
| SIVGFP-Prom | ptRNAprolys-3 | 1.8 × 105/7.7 | 11.5 | 2.1 × 104/11 | 11.9 |
Values are in green fluorescence-forming units (GFU) and nanograms of p27CA antigen per milliliter of supernatant of 293T cells transfected with the indicated plasmids.
Percentage of infectivity (titer of p27CA antigen) relative to wild-type SIVGFP. Of each plasmid DNA, 2.5 μg was used for transfection of a six-well plate.
Mutation of the PBS of SIVGFP to the X2 sequence reduced the titer by at least 4 orders of magnitude with essentially no background (Table 2). By the addition of a synthetic tRNA-like primer, ptRNAx2pro, matching PBS-X2, the infectivity of SIVGFP-X2 was increased by at least 4 orders of magnitude and was only fivefold lower than the infectivity of SIVGFP wild-type particles. The PBS-mutated vector could therefore be complemented by the synthetic ptRNA-like primer matching the 18 nt of the PBS-mutated vector.
Direct sequence evidence for ptRNAx2pro usage was obtained from amplification with primers 12 and 13 and sequencing the PBS region of a mixed pool of cell lysates originating from transductions with the supernatant of SIVGFP-X2m transfected cells. In the left panel of Fig. 3, the PBS sequence of the PBS-X2m origin is shown, whereas the panel to the right shows the PBS sequence, originating from a copy of ptRNAx2pro, thus providing the evidence for primer usage. According to the mechanism of reverse transcription, the PBS sequence of a transduced provirus originates from copying the genomic PBS RNA or the 3′ 18 nt of the tRNA primer. Consequently, it would be predicted that 50% of the clones would contain the primer sequence. It was demonstrated that 5 subclones out of 13 analyzed contained the artificial tRNA sequence.
FIG. 3.
Genetic evidence for tRNAx2pro usage. PCR products spanning the PBS region from lysates prepared from a mixed pool of transduced cells were cloned and sequenced. In the left and right panels are shown the PBS sequences resulting from a copy of the vector SIVGFP-X2m and primer tRNAx2pro, respectively. The mismatch positions are indicated by arrows.
Effect of using primers with a tRNA
-like backbone.
A comparison of the infectivity of SIVGFP-Pro in the presence or absence, respectively, of a hybrid primer, tRNAprolys-3, which had an acceptor stem matching PBS-Pro but otherwise resembled the tRNA
molecule (Fig. 2A), showed that cotransfection of ptRNAprolys-3 increased the infectivity fourfold (Table 2). This suggests that sequences or structures in the backbone of the cognate tRNA
compared to the endogenous tRNAPro are important for optimal initiation of reverse transcription or packaging. In these experiments, accurate quantification of the expression levels is difficult due to abundant expression of endogenous tRNAs closely homologous to the transfected tRNAs. However, primer selectivity by the retroviral machinery during primer packaging, placement, and utilization may be the determining factor rather than abundance of the tRNA. To compare the effects exerted by the tRNA sequences outside the PBS complementary region, ptRNAx2lys-3 was designed, containing a tRNA
backbone, but matching the PBS-X2 (Fig. 2A), and used in transient transfections. The infectivity of the SIVGFP-X2 obtained by cotransfection with ptRNAx2lys-3 resulted in three- to fourfold-higher transduction titers relative to cotransfection with ptRNAx2pro (Table 3).
TABLE 3.
Effect of tRNA backbone identity on vector transduction efficiencies
| Plasmid cotransfected with VSV-G
|
Results for:
|
||||||
|---|---|---|---|---|---|---|---|
| PBS mutants | tRNA mock | Expt 1
|
Expt 2
|
Expt 3
|
|||
| Titer (GFU)/ng of p27CAa | Infectivityb | Titer (GFU)/ng of p27CAa | Infectivityb | Titer (GFU)/ng of p27CAa | Infectivityb | ||
| SIVGFP-X2m | pBluescript | <5/131 | 10/95 | <5/86 | |||
| SIVGFP-X2m | ptRNAx2pro | 1.4 × 105/132 | 1 × 103 | 5.9 × 104/45 | 1.3 × 103 | 4.9 × 104/44 | 1.1 × 103 |
| SIVGFP-X2m | ptRNAx2lys-3 | 4.1 × 105/106 | 3.9 × 103 | 2.4 × 105/54 | 4.4 × 103 | 3.1 × 105/109 | 2.8 × 103 |
| x2lys3/x2pro ratio | 2.9 | 4 | 3.9 | 3.4 | 6.3 | 2.5 | |
Values are in green fluorescence-forming units (GFU) and nanograms of p27CA antigen per milliliter of supernatant of 293T cells transfected with the indicated plasmids on 293A cells.
Infectivity is given as the titer of p27CA antigen. ptRNA expression plasmid DNA (1.25 μg) was cotransfected with 2.5 μg of SIVGFP-X2 and 2.5 μg of pHITG. The total amount of DNA transfected was adjusted to 10 μg for a six-well plate.
While normalization of transfection efficiency by p27CA antigen levels within each experiment gave consistent results, normalization of transfection efficiency between different experiments was not found to be very useful. Although CA antigen levels differed largely between different experiments (compare Tables 2 and 3), vector titers did not seem to increase in a linear way with increasing p27CA antigen levels. Therefore, CA antigen levels might not be the limiting factor for vector titer, or increased toxicities at higher transfection rates might lead to stronger inhibition of formation of infectious vector particles than protein expression. To confirm that the vector titer depends on the amount and type of tRNA, two independent titration experiments were performed with cotransfection of increasing amounts of ptRNAx2pro and ptRNAx2lys-3, respectively, in cotransfections with SIVGFP-X2 (Fig. 4A). For amounts of tRNA expression plasmid up to 1 μg, the transduction titer increases for a given amount of vector DNA. Increasing the amount of ptRNA above the saturating level seems to have an inhibitory effect on transduction efficiency. Throughout the entire range of DNA concentrations, the cotransfection of ptRNAx2lys-3 results in higher transduction titers than those of ptRNAx2pro, with the exception of the experiment using 2.5 μg of ptRNAx2pro. Such a preference for ptRNAx2lys-3 was not observed in an MLV system using PBS-mutated Akv-based vectors in which the addition of tRNAx2pro results in slightly higher titers than those used for addition of the ptRNAx2lys-3 (Fig. 4B). Construction of MLV-based vectors and the titer assay was described previously in reference 28. Thus, it seems that SIV shows a weak preference for synthetic tRNA-like primers with a tRNA
backbone.
FIG. 4.
Titration of engineered tRNA-like DNAs differing in their tRNA backbone compositions. Dose-response curves of the effects of increasing amounts of engineered tRNA-like primer DNA ptRNAx2pro and ptRNAx2lys-3 on the infectivity of an SIV-based vector (A) and the titer of an MLV-based vector (B) are shown. (A) Engineered tRNA-like primers were cotransfected in the indicated amounts with SIVGFP-X2 and pHITG into 293T cells. The infectivity (green fluorescence-forming units [GFU] per nanogram of p27CA) in the supernatant of the transfected cells was determined on 293A cells. (B) Engineered tRNA-like primers were cotransfected in the indicated amounts with the MLV-based vector pPBS-X2 (28) into the packaging cell line BOSC 23. Vector titers in the supernatant of the transfected cells were determined on NIH 3T3 cells. Black and grey bars represent cotransfections with ptRNAx2pro and ptRNAx2lys-3, respectively. Replica experiments are shown for each amount of ptRNA added.
Our data demonstrate that complementarity between the PBS and a matching synthetic tRNA-like primer is the primary determinant for selection and use of the tRNA species in initiation of reverse transcription in SIV. However, we note that the transduction titers are lower than for the wild-type vector. An MLV Akv-based vector carrying PBS-X2 was greatly impaired in its ability to replicate in single-round transfections, but could be rescued by the addition of the designed complementary tRNAx2pro, resulting in a complete provirus (28). Similarly, an HIV-1 provirus with a PBS complementary to the yeast tRNAPhe relied on the transfection of a yeast tRNAPhe, using a single-round transfection system (51). Thus, SIVmac239 seems to be similar to MLV, ASLV, and HIV-1, in which the PBS and tRNA complementarity is the primary determinant for selection of the tRNA primer for initiation of reverse transcription and the ability to proceed through a complete replication cycle.
Northern analysis of the expression levels of the synthetic tRNAs relative to a control U2 small nuclear RNA probe (48) has shown that ptRNAx2lys-3 is expressed at higher levels than ptRNAx2pro in the producer cells used (data not shown). However, it is not clear whether the level of tRNA abundance per se has any effect on transduction efficiency, because the amount of synthetic tRNA DNA added in the transfections seems to be saturating (Fig. 4). Secondary determinants such as non-PBS interactions may be responsible for the apparent preference for the tRNA
backbone, as has been demonstrated for HIV-1. Viral genomic RNA sequences other than the A-rich loop may interact with the primer in SIVmac239, although interactions between tRNAPro and the Moloney MLV RNA have been found to be restricted to the PBS (13). In HIV-1, primer placement on the viral genome and primer packaging may depend on destabilization of the secondary structure of the tRNA and the viral RNA template by the p55gag precursor (1, 5, 8, 12, 17, 18, 26, 32, 39, 40), which also seems to be the case for avian leukosis virus, but not for MLV (15). Primer and RT interaction may also be necessary for initiation of reverse transcription (1, 2, 11, 42, 50), although RT may recognize the overall L-shaped tRNA rather than specific features of its cognate tRNA primer (45). Thus, we cannot exclude that one or several of the possible non-PBS interactions may contribute to the observed higher titers in SIV for the tRNA
backbone in this study; however, the primary determinant for primer specificity is the complementarity between the viral PBS and the tRNA primer in SIVmac239.
Acknowledgments
The first two authors contributed equally to this work and should both be considered the first author.
The technical assistance of Ane Kjeldsen and Katrin Bräutigam is gratefully acknowledged.
A. Schmitz acknowledges support by the German Academic Exchange Service (DAAD/HSPIII) Program. This work was supported by Bavarian Nordic Research Institute A/S, the Karen Elise Jensen Foundation, the Danish Cancer Society, the German Research Foundation (Ue45–3/1), and the Danish Natural Science and Health Science Research Councils.
REFERENCES
- 1.Barat C, Lullien V, Schatz O, Keith G, Nugeyre M T, Gruninger-Leitch F, Barre-Sinoussi F, LeGrice S F, Darlix J-L. HIV-1 reverse transcriptase specifically interacts with the anticodon domain of its cognate primer tRNA. EMBO J. 1989;8:3279–3285. doi: 10.1002/j.1460-2075.1989.tb08488.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Barat C, Schatz O, Le Grice S, Darlix J-L. Analysis of the interactions of HIV-1 replication primer tRNALys, 3 with nucleocapsid protein and reverse transcriptase. J Mol Biol. 1993;23:185–190. doi: 10.1006/jmbi.1993.1273. [DOI] [PubMed] [Google Scholar]
- 3.Berkhout B. The primer binding site on the RNA genome of human and simian immunodeficiency viruses is flanked by an upstream hairpin structure. Nucleic Acids Res. 1997;25:4013–4017. doi: 10.1093/nar/25.20.4013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Berkhout B, Schoneveld I. Secondary structure of the HIV-2 leader RNA comprising the tRNA-primer binding site. Nucleic Acids Res. 1993;21:1171–1178. doi: 10.1093/nar/21.5.1171. [DOI] [PMC free article] [PubMed] [Google Scholar]
-
5.Cen S, Huang Y, Khorchid A, Darlix J-L, Wainberg M A, Kleiman L. The role of Pr55gag in the annealing of tRNA
to human immunodeficiency virus type 1 genomic RNA. J Virol. 1999;73:4485–4488. doi: 10.1128/jvi.73.5.4485-4488.1999. [DOI] [PMC free article] [PubMed] [Google Scholar] - 6.Colicelli J, Goff S P. Isolation of a recombinant murine leukemia virus utilizing a new primer tRNA. J Virol. 1987;57:37–45. doi: 10.1128/jvi.57.1.37-45.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
-
7.Das A T, Klaver B, Berkhout B. Reduced replication of human immunodeficiency virus type 1 mutants that use reverse transcription primers other than the natural tRNA
J Virol. 1995;69:3090–3097. doi: 10.1128/jvi.69.5.3090-3097.1995. [DOI] [PMC free article] [PubMed] [Google Scholar] - 8.De Rocquigny H, Gabus C, Vincent A, Fournie-Zaluski M C, Roques B, Darlix J-L. Viral RNA annealing activities of human immunodeficiency virus type 1 nucleocapsid protein require only peptide domains outside the zinc fingers. Proc Natl Acad Sci USA. 1992;89:6472–6476. doi: 10.1073/pnas.89.14.6472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Desrosiers R C. The simian immunodeficiency viruses. Annu Rev Immunol. 1990;8:557–578. doi: 10.1146/annurev.iy.08.040190.003013. [DOI] [PubMed] [Google Scholar]
- 10.DuBridge R B, Tang P, Hsia H C, Leong P-M, Miller J H, Calos M P. Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system. Mol Cell Biol. 1987;7:379–387. doi: 10.1128/mcb.7.1.379-387.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Dufour E, Reinbolt J, Castroviejo M, Ehresmann B, Litvak S, Tarrago-Litvak L, Andreola M L. Cross-linking localization of a HIV-1 reverse transcriptase peptide involved in the binding of primer tRNALys3. J Mol Biol. 1999;285:1339–1346. doi: 10.1006/jmbi.1998.2430. [DOI] [PubMed] [Google Scholar]
- 12.Feng Y X, Campbell S, Harvin D, Ehresmann B, Ehresmann C, Rein A. The human immunodeficiency virus type 1 Gag polyprotein has nucleic acid chaperone activity: possible role in dimerization of genomic RNA and placement of tRNA on the primer binding site. J Virol. 1999;73:4251–4256. doi: 10.1128/jvi.73.5.4251-4256.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Fosse P, Mougel M, Keith G, Westhof E, Ehresmann B, Ehresmann C. Modified nucleotides of tRNAPro restrict interactions in the binary primer/template complex of M-MuLV. J Mol Biol. 1998;275:731–746. doi: 10.1006/jmbi.1997.1487. [DOI] [PubMed] [Google Scholar]
- 14.Fouchier R A, Meyer B E, Simon J H, Fischer U, Malim M H. HIV-1 infection of non-dividing cells: evidence that the amino-terminal basic region of the viral matrix protein is important for Gag processing but not for post-entry nuclear import. EMBO J. 1997;16:4531–4539. doi: 10.1093/emboj/16.15.4531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Fu W, Ortiz-Conde B A, Gorelick R J, Hughes S H, Rein A. Placement of tRNA primer on the primer-binding site requires pol gene expression in avian but not murine retroviruses. J Virol. 1997;71:6940–6946. doi: 10.1128/jvi.71.9.6940-6946.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Harada F, Peters G G, Dahlberg J E. The primer tRNA for Moloney murine leukemia virus DNA synthesis. Nucleotide sequence and aminoacylation of tRNAPro. J Biol Chem. 1979;254:10979–10985. [PubMed] [Google Scholar]
-
17.Huang Y, Khorchid A, Gabor J, Wang J, Li X, Darlix J-L, Wainberg M A, Kleiman L. The role of nucleocapsid and U5 stem/A-rich loop sequences in tRNA
genomic placement and initiation of reverse transcription in human immunodeficiency virus type 1. J Virol. 1998;72:3907–3915. doi: 10.1128/jvi.72.5.3907-3915.1998. [DOI] [PMC free article] [PubMed] [Google Scholar] - 18.Huang Y, Khorchid A, Wang J, Parniak M A, Darlix J-L, Wainberg M A, Kleiman L. Effect of mutations in the nucleocapsid protein (NCp7) upon Pr160gag-pol and tRNALys incorporation into human immunodeficiency virus type 1. J Virol. 1997;71:4378–4384. doi: 10.1128/jvi.71.6.4378-4384.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
-
19.Huang Y, Shalom A, Li Z, Wang J, Mak J, Wainberg M A, Kleiman L. Effects of modifying the tRNA
anticodon on the initiation of human immunodeficiency virus type 1 reverse transcription. J Virol. 1996;70:4700–4706. doi: 10.1128/jvi.70.7.4700-4706.1996. [DOI] [PMC free article] [PubMed] [Google Scholar] -
20.Isel C, Ehresmann C, Keith G, Ehresmann B, Marquet R. Initiation of reverse transcription of HIV-1: secondary structure of the HIV-1 RNA/tRNA
(template/primer) J Mol Biol. 1995;247:236–250. doi: 10.1006/jmbi.1994.0136. [DOI] [PubMed] [Google Scholar] -
21.Isel C, Marquet R, Keith G, Ehresmann C, Ehresmann B. Modified nucleotides of tRNA
modulate primer/template loop-loop interaction in the initiation complex of HIV-1 reverse transcription. J Biol Chem. 1993;268:25269–25272. [PubMed] [Google Scholar] - 22.Isel C, Westhof E, Massire C, Le Grice S F, Ehresmann B, Ehresmann C, Marquet R. Structural basis for the specificity of the initiation of HIV-1 reverse transcription. EMBO J. 1999;18:1038–1048. doi: 10.1093/emboj/18.4.1038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kang S M, Zhang Z, Morrow C D. Identification of a human immunodeficiency virus type 1 that stably uses tRNALys1,2 rather than tRNALys,3 for initiation of reverse transcription. Virology. 1999;257:95–105. doi: 10.1006/viro.1999.9615. [DOI] [PubMed] [Google Scholar]
- 24.Kang S-M, Zhang Z, Morrow C D. Identification of a sequence within U5 required for human immunodeficiency virus type 1 to stably maintain a primer binding site complementary to tRNAMet. J Virol. 1997;71:207–217. doi: 10.1128/jvi.71.1.207-217.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Li X, Mak J, Arts E J, Gu Z, Kleiman L, Wainberg M A, Parniak M A. Effects of alterations of primer-binding site sequences on human immunodeficiency virus type 1 replication. J Virol. 1994;68:6198–6206. doi: 10.1128/jvi.68.10.6198-6206.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
-
26.Li X, Quan Y, Arts E J, Li Z, Preston B D, de Rocquigny H, Roques B P, Darlix J-L, Kleiman L, Parniak M A, Wainberg M A. Human immunodeficiency virus type 1 nucleocapsid protein (NCp7) directs specific initiation of minus-strand DNA synthesis primed by human tRNA
in vitro: studies of viral RNA molecules mutated in regions that flank the primer binding site. J Virol. 1996;70:4996–5004. doi: 10.1128/jvi.70.8.4996-5004.1996. [DOI] [PMC free article] [PubMed] [Google Scholar] - 27.Liang C, Li X, Rong L, Inouye P, Quan Y, Kleiman L, Wainberg M A. The importance of the A-rich loop in human immunodeficiency virus type 1 reverse transcription and infectivity. J Virol. 1997;71:5750–5757. doi: 10.1128/jvi.71.8.5750-5757.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lund A H, Duch M, Lovmand J, Jörgensen P, Pedersen F S. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer. J Virol. 1997;71:1191–1195. doi: 10.1128/jvi.71.2.1191-1195.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Lund A H, Duch M, Lovmand J, Jörgensen P, Pedersen F S. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication. J Virol. 1993;67:7125–7130. doi: 10.1128/jvi.67.12.7125-7130.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Lund A H, Schmidt J, Luz A, Sörensen A B, Duch M, Pedersen F S. Replication and pathogenicity of primer binding site mutants of SL3–3 murine leukemia viruses. J Virol. 1999;73:6117–6122. doi: 10.1128/jvi.73.7.6117-6122.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Lund A H, Schmitz A, Pedersen F S, Duch M. Identification of a novel human tRNASer(CGA) functional in murine leukemia virus replication. Biochim Biophys Acta. 2000;1492:264–268. doi: 10.1016/s0167-4781(00)00095-6. [DOI] [PubMed] [Google Scholar]
- 32.Mak J, Jiang M, Wainberg M A, Hammarskjold M L, Rekosh D, Kleiman L. Role of Pr160gag-pol in mediating the selective incorporation of tRNALys into human immunodeficiency virus type 1 particles. J Virol. 1994;68:2065–2072. doi: 10.1128/jvi.68.4.2065-2072.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Mak J, Kleiman L. Primer tRNAs for reverse transcription. J Virol. 1997;71:8087–8095. doi: 10.1128/jvi.71.11.8087-8095.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Mangeot P E, Negre D, Dubois B, Winter A J, Leissner P, Mehtali M, Kaiserlian D, Cosset F L, Darlix J-L. Development of minimal lentivirus vectors derived from simian immunodeficiency virus (SIVmac251) and their use for gene transfer into human dendritic cells. J Virol. 2000;74:8307–8315. doi: 10.1128/jvi.74.18.8307-8315.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Marquet R, Isel C, Ehresmann C, Ehresmann B. tRNAs as primer of reverse transcriptases. Biochimie. 1995;77:113–124. doi: 10.1016/0300-9084(96)88114-4. [DOI] [PubMed] [Google Scholar]
- 36.Nikbakht K N, Ou C Y, Boone L R, Glover P L, Yang W K. Nucleotide sequence analysis of endogenous murine leukemia virus-related proviral clones reveals primer-binding sites for glutamine tRNA. J Virol. 1985;54:889–893. doi: 10.1128/jvi.54.3.889-893.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Pear W S, Nolan G P, Scott M L, Baltimore D. Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci USA. 1993;90:8392–8396. doi: 10.1073/pnas.90.18.8392. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Raba M, Limburg K, Burghagen M, Katze J R, Simsek M, Heckman J E, Rajbhandary U L, Gross H J. Nucleotide sequence of three isoaccepting lysine tRNAs from rabbit liver and SV40-transformed mouse fibroblasts. Eur J Biochem. 1979;97:305–318. doi: 10.1111/j.1432-1033.1979.tb13115.x. [DOI] [PubMed] [Google Scholar]
-
39.Remy E, de Rocquigny H, Petitjean P, Muriaux D, Theilleux V, Paoletti J, Roques B P. The annealing of tRNA
to human immunodeficiency virus type 1 primer binding site is critically dependent on the NCp7 zinc fingers structure. J Biol Chem. 1998;273:4819–4822. doi: 10.1074/jbc.273.9.4819. [DOI] [PubMed] [Google Scholar] - 40.Rong L, Liang C, Hsu M, Kleiman L, Petitjean P, de Rocquigny H, Roques B P, Wainberg M A. Roles of the human immunodeficiency virus type 1 nucleocapsid protein in annealing and initiation versus elongation in reverse transcription of viral negative-strand strong-stop DNA. J Virol. 1998;72:9353–9358. doi: 10.1128/jvi.72.11.9353-9358.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Roy K L, Cooke H, Buckland R. Nucleotide sequence of a segment of human DNA containing the three tRNA genes. Nucleic Acids Res. 1982;10:7313–7322. doi: 10.1093/nar/10.22.7313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Sarih-Cottin L, Bordier B, Musier-Forsyth K, Andreola M L, Barr P J, Litvak S. Preferential interaction of human immunodeficiency virus reverse transcriptase with two regions of primer tRNALys as evidenced by footprinting studies and inhibition with synthetic oligoribonucleotides. J Mol Biol. 1992;226:1–6. doi: 10.1016/0022-2836(92)90117-3. [DOI] [PubMed] [Google Scholar]
- 43.Schnell T, Foley P, Wirth M, Münch J, Überla K. Development of a self-inactivating, minimal lentivirus vector based on simian immunodeficiency virus. Hum Gene Ther. 2000;11:439–447. doi: 10.1089/10430340050015905. [DOI] [PubMed] [Google Scholar]
- 44.Soneoka Y, Cannon P M, Ramsdale E E, Griffiths J C, Romano G, Kingsman S M, Kingsman A J. A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res. 1995;23:628–633. doi: 10.1093/nar/23.4.628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Thrall S H, Reinstein J, Wohrl B M, Goody R S. Evaluation of human immunodeficiency virus type 1 reverse transcriptase primer tRNA binding by fluorescence spectroscopy: specificity and comparison to primer/template binding. Biochemistry. 1996;35:4609–4618. doi: 10.1021/bi9526387. [DOI] [PubMed] [Google Scholar]
- 46.Wakefield J K, Kang S-M, Morrow C D. Construction of a type 1 human immunodeficiency virus that maintains a primer binding site complementary to tRNAHis. J Virol. 1996;70:966–975. doi: 10.1128/jvi.70.2.966-975.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
-
47.Wakefield J K, Wolf A G, Morrow C D. Human immunodeficiency virus type 1 can use different tRNAs as primers for reverse transcription but selectively maintains a primer binding site complementary to tRNA
J Virol. 1995;69:6021–6029. doi: 10.1128/jvi.69.10.6021-6029.1995. [DOI] [PMC free article] [PubMed] [Google Scholar] - 48.Westin G, Zabielski J, Hammarstrom K, Monstein H J, Bark C, Pettersson U. Clustered genes for human U2 RNA. Proc Natl Acad Sci USA. 1984;81:3811–3815. doi: 10.1073/pnas.81.12.3811. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Whitcomb J M, Ortiz-Conde B A, Hughes S H. Replication of avian leukosis viruses with mutations at the primer binding site: use of alternative tRNAs as primers. J Virol. 1995;69:6228–6238. doi: 10.1128/jvi.69.10.6228-6238.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Wöhrl B M, Ehresmann B, Keith G, Le Grice S F. Nuclease footprinting of human immunodeficiency virus reverse transcriptase/tRNALys-3 complexes. J Biol Chem. 1993;268:13617–13624. [PubMed] [Google Scholar]
- 51.Yu Q, Morrow C D. Complementarity between 3′ terminal nucleotides of tRNA and primer binding site is a major determinant for selection of the tRNA primer used for initiation of HIV-1 reverse transcription. Virology. 1999;254:160–168. doi: 10.1006/viro.1998.9542. [DOI] [PubMed] [Google Scholar]
- 52.Zhang Z, Kang S M, LeBlanc A, Hajduk S L, Morrow C D. Nucleotide sequences within the U5 region of the viral RNA genome are the major determinants for a human immunodeficiency virus type 1 to maintain a primer binding site complementary to tRNAHis. Virology. 1996;226:306–317. doi: 10.1006/viro.1996.0658. [DOI] [PubMed] [Google Scholar]




