Skeletal muscle adaptations following eccentric contractions are not mediated by keratin 18

Abstract

The molecular mechanisms that drive muscle adaptations after eccentric exercise training are multifaceted and likely impacted by age. Previous studies have reported that many genes and proteins respond differently in young and older muscles following training. Keratin 18 (Krt18), a cytoskeletal protein involved in force transduction and organization, was found to be upregulated after muscles performed repeated bouts of eccentric contractions, with higher levels observed in young muscle compared with older muscle. Therefore, the purpose of this study was to determine if Krt18 mediates skeletal muscle adaptations following eccentric exercise training. The anterior crural muscles of Krt18 knockout (KO) and wild-type (WT) mice were subjected to either a single bout or repeated bouts of eccentric contractions, with isometric torque assessed across the initial and final bouts. Functionally, Krt18 KO and WT mice did not differ prior to performing any eccentric contractions (P ≥ 0.100). Muscle strength (tetanic isometric torques) and the ability to adapt to eccentric exercise training were also consistent across strains at all time points (P ≥ 0.169). Stated differently, immediate strength deficits and the recovery of strength following a single bout or multiple bouts of eccentric contractions were similar between Krt18 KO and WT mice. In summary, the absence of Krt18 does not impede the muscle’s ability to adapt to repeated eccentric contractions, suggesting it is not essential for exercise-induced remodeling.

NEW & NOTEWORTHY The molecular processes that underlie the changes in skeletal muscle following eccentric exercise training are complex and involve multiple factors. Our findings indicate that Krt18 may not play a significant role in muscle adaptations following eccentric exercise training, likely due to its low expression in skeletal muscle. These results underscore the complexity of the molecular mechanisms that contribute to muscle plasticity and highlight the need for further research in this area.

INTRODUCTION

Resistance training regimens, particularly those involving eccentric contractions, lead to functional adaptations such as reduced strength loss, quicker strength recovery, and increased baseline strength (1–4). Despite this, adaptations can vary widely among individuals following the same program (5, 6), with age being a significant factor. In older adults, resistance training enhances muscle function and mobility (7–10), but older muscles are less responsive than younger muscles (11–17). Our research has shown that, while eccentric exercise training induces common transcriptional changes in young and older female mouse muscles, distinct age-dependent gene expression differences exist (18). These differences may partly explain the reduced adaptability of older muscles to training. Specifically, the gene encoding keratin 18 (Krt18) was found to be more upregulated in the trained muscles of young mice than in older mice.

Keratins are intermediate filaments that form noncovalent heteropolymers and are primarily localized around the sarcomere Z-disks and within the Z-disk domains of costameres (19–23). Muriel et al. (20) reported that Krt18 organizes with Krt19 and desmin in the myoplasm and that together with Krt19 contributes to force transduction and cytoskeletal organization. Given the structural role of keratins and their age-influenced expressional changes after eccentric contractions (18), we asked if Krt18 mediates skeletal muscle adaptations to in vivo eccentric contractions by studying young Krt18 knockout (KO) mice. We proposed that the lack of Krt18 would hinder the muscle’s ability to adapt after eccentric exercise training, resulting in weakness. If so, it would suggest that the reduced expression of Krt18 in older muscles following eccentric exercise training may contribute to a diminished or impaired adaptive response.

METHODS

Ethical Approval and Animal Models

Krt18^tm1Tmm/J mice on the FVB strain (24) were from JAX (stock #007029; The Jackson Laboratory) and bred locally to achieve Krt18 global knockout (Krt18 KO) or wild-type (WT) mice. Both males (n = 24) and females (n = 21) were studied. Mice were anesthetized in an induction chamber using isoflurane and then maintained by inhalation of 1–2% isoflurane mixed with oxygen. Mice were euthanized by exsanguination while under anesthesia (3–5% isoflurane), followed by cervical dislocation. All procedures involving mice were approved by Ohio University’s Animal Care and Use Committee.

Experimental Design

Male and female Krt18 KO and WT mice were subjected to a single bout (untrained) or repeated bouts of eccentric contractions (trained). Training involved five repeated bouts with 2 wk separating each bout. During each bout, the anterior crural muscles [tibialis anterior (TA), extensor digitorum longus (EDL), and extensor hallucis] from the left hindlimb, responsible for dorsiflexion, performed 150 maximal eccentric contractions in vivo. We tested in vivo tetanic isometric torque of the left dorsiflexors immediately before (pre) and after (post) each bout. In vivo isometric torque was also assessed on days 2 and 7, which for the trained groups, occurred after bout 5. Left and right leg TA and EDL muscles were dissected on day 7 (i.e., 1 bout plus 7 days or 5 bouts plus 7 days) and used to analyze Krt18 mRNA expression in WT muscles. The unstimulated right leg muscles served as controls. Mice that performed a single bout were age-matched to the trained groups that completed five bouts. All mice were between 17 and 20 wk old when euthanized.

Experimental methodology.

Tetanic isometric torque.

Isometric torque of the left anterior crural muscles was assessed in vivo (25, 26). Briefly, the anesthetized mouse was placed on a temperature-controlled platform. The left knee was clamped, and the left foot was secured to a footplate attached to the shaft of the servomotor system (Model 300 C-LR; Aurora Scientific) with the foot perpendicular to the tibia (defined as 0°). Sterilized needle electrodes were inserted through the skin to stimulate the left common peroneal nerve (701C; Aurora Scientific).

Eccentric contractions.

Following the tetanic isometric torque measurement (pre), muscles were injured by performing 150 maximal eccentric contractions (25, 26). During each eccentric contraction, the foot was passively moved from 0° to 19.5° of dorsiflexion, where the anterior crural muscles performed a 100-ms isometric contraction. This movement was followed by an additional ∼20 ms of stimulation while the foot was then moved to 19.5° of plantarflexion at ∼2,000°·s⁻¹. Ten seconds separated each eccentric contraction. A 5-min rest was given after the last eccentric contraction before reassessing tetanic isometric torque (post).

Genotyping.

Genomic DNA was isolated from mouse tails and incubated for 30 min in 100 μL of 0.5 M NaOH at 95°C, followed by neutralization with 30 µL of 1 M Tris-HCl, pH 8. One microliter was used as template DNA for PCR amplification of the Krt18 gene, using these primers: WT forward (oIMR7165, AAGGAATCCAGGAAGGGAGA), common (oIMR7166, AGCCCCGGACTTACTTGACT), and mutant (oIMR7415, GCCAGAGGCCACTTGTGTAG). PCR conditions included an initial denaturation of 3 min at 95°C, denaturation, 15 s at 95°C, annealing at 15 s at 58°C, extension 2 s/kb at 72°C (35 cycles), and final extension (optional) 7 min at 72°C. PCR products were visualized on 2% Agarose gels stained with ethidium bromide.

Reverse transcription quantitative PCR.

TA/EDL muscles were processed for reverse transcription quantitative PCR (RT-qPCR) analyses as described (27, 28). Briefly, total RNA was extracted with TRIzol and purity was assessed by NanoDrop. cDNA was synthesized with a High-Capacity cDNA Reverse Transcription Kit (Applied biosystem, LT-02241 #4368814). The resulting cDNA served as the template for qPCR amplification using SYBR green. Primers were as following: Krt18, 5′- GGCCAGCTACCTAGACAAGGTGAAG-3′ & 5′- GGATGTCCGCCATGATCTTGCTGAG-3′; GAPDH, 5′- ACGACCCCTTCATTGACC-3′ & 5′- ATCACGCCACAGCTTTCC-3′. Thermal cycling conditions included an initial denaturation at 95°C for 2 min, followed by 39 cycles of denaturation 95°C for 20 s, annealing 60°C for 15 s, and extension at 72°C. All reactions were performed in duplicates. The ΔΔCt method was used to analyze alterations in gene expression and values were expressed as fold changes relative to control.

Immunoblotting.

Muscle was homogenized in ice-cold laboratory lysis buffer supplemented with a protease inhibitor cocktail (Thermo Fisher Scientific). Total protein content was quantified by the A280 method on a NanoDrop spectrophotometer. Equal amounts of protein were analyzed on 10% SDS polyacrylamide gels, transferred to PVDF membranes using a trans-blot semidry transfer system at a constant voltage (Bio-Rad), and blocked in 5% nonfat dried milk in tris-buffered saline, 0.1% Tween-20 (TBS-T). Membranes were incubated with primary antibodies (anti-Krt18; Abcam #181597; anti-GAPDH; cell signaling #2118) overnight at 4°C with orbital rocking, washed with TBS-T, and probed with DyLight secondary antibodies for 1 h at room temperature with orbital rocking. After washing, bands were visualized on LI-COR’s Odyssey Infrared Imaging System.

Statistical analyses.

Independent t tests and two-way factorial ANOVAs assessed differences across variables. When significant ANOVAs were discovered, Tukey’s post hoc test was performed. An α level of 0.05 was used for all analyses. Values are presented as means ± SD. All statistical testing used Prism (GraphPad Software Inc.).

RESULTS

Krt18 Expression following Eccentric Contractions

Krt18 mRNA levels in TA and EDL muscles of WT mice were measured by RT-qPCR (Fig. 1, A–C). Compared with controls that did not undergo eccentric contractions, there was a tendency for increased Krt18 mRNA expression in both male and female muscles 7 days after a single bout (Fig. 1, A and B), which reached significance when data from both sexes were combined (P = 0.018; Fig. 1C). In addition, Krt18 expression was lower 7 days after the fifth bout relative to the first bout, yet the combined data for both sexes trended higher than controls (P = 0.108).

Figure 1.

Krt18 mRNA expression in skeletal muscle following eccentric contractions. Expression of Krt18 mRNA was assessed in control (nonstimulated) TA and EDL muscles, and 7 days after muscle either performed 1 or 5 bouts of 150 eccentric contractions (A–C). Krt18 mRNA was normalized to GAPDH mRNA. Data are expressed as fold changes relative to the control group. n = 5 muscles per timepoint/sex. “Combined” is male and female pooled data. EDL, extensor digitorum longus; TA, tibialis anterior. #Significantly different than day 0 (i.e., pre; P < 0.05).

Validation of Global Krt18 Knockout

Krt18 KO and WT mice were identified by PCR of tail snips (Fig. 2A). Validation was further confirmed by immunoblots using three different tissues with different Krt18 content. Tissues ranged from low abundance in nonexercised TA/EDL muscle (undetectable) to medium and high abundance in kidney and liver, respectively (Fig. 2B).

Figure 2.

Krt18 protein in skeletal muscle kidney and liver. Global Krt18 knockout was confirmed via genotyping (A) and immunoblotting of various tissues (B). Krt18 was undetectable in muscle. EDL, extensor digitorum longus; KO, knockout; TA, tibialis anterior; WT, wild-type.

Skeletal Muscle Characteristics in Nonexercised Mice

Global Krt18 depletion was reported to result in an ∼15% reduction in specific tension (g/mm²) in 12-wk-old mouse TA muscles (20). In our hands, however, the torque of the anterior crural muscles in Krt18 KO and WT mice was indistinguishable. At 17–20 wk, Krt18 KO and WT mice did not differ in body mass, absolute or relative (to body mass) dorsiflexor isometric torque, or wet mass of the TA/EDL muscles (P ≥ 0.100; Fig. 3, A–L). Younger mice (8–10 wk) also failed to show differences in these measures (P ≥ 0.296).

Figure 3.

Baseline strength in young Krt18 KO and WT mice. Characteristics of nonexercised muscles in Krt18 KO and WT mice were assessed between 17 and 20 wk of age: body mass (A, E, and I), absolute isometric torque (B, F, and J), isometric normalized to body mass (C, G, and K), muscle wet mass of the TA/EDL muscles (D, H, and L). n = 5 or 6 per strain/sex. “Combined” is male and female pooled data. EDL, extensor digitorum longus; KO, knockout; TA, tibialis anterior; WT, wild-type.

Adaptations to Eccentric Exercise Training

To assess how the left anterior crural muscles responded to training, tetanic isometric torques produced during the final exercise session (5th bout; trained) were compared with values obtained from age-matched mice that only performed a single bout (untrained). Timepoints included immediately pre and post the eccentric contractions, and 2 and 7 days into recovery. Regardless of number of bouts completed (1 or 5 bouts) or sex of the mice, no differences were observed in tetanic isometric torques between the Krt18 KO and WT groups at any timepoint (P ≥ 0.268; Fig. 4, A, B, D, E, G, and H). Thus, mice lacking Krt18 produced the same amount of tetanic isometric torque as WT mice before and after performing eccentric contractions, with or without training. Despite no effects of strain (or interactions; P ≥ 0.497) being detected, eccentric contractions caused prolonged reductions of tetanic isometric torque (P < 0.001). In untrained male and female mice, tetanic isometric torque decreased ∼44% (P < 0.001) and remained ∼14% down by day 7 (P ≤ 0.003) compared with torque values obtained before the eccentric contractions. Eccentric exercise training attenuated immediate torque deficits yet did not protect the muscle completely, as tetanic isometric torque still decreased ∼20% (P ≤ 0.002). By day 7, the tetanic isometric torque of the trained muscle group was similar to the baseline torque measured before bout 5 (P ≥ 0.599; Fig. 4, B, E, and H). We did detect strain differences in maximal torque produced over the eccentric protocol, particularly in trained females (data not presented). However, as reported, these observed differences in eccentric torque did not translate into changes in isometric torque loss or recovery (Fig. 4, A, B, D, E, G, and H).

Figure 4.

Skeletal muscle adaptations to eccentric exercise training. In vivo tetanic isometric torques of the dorsiflexors in untrained (A, D, and G) and trained (B, E, and H) muscles. Adaptive potential was measured as a percent change from torque values of untrained and trained muscle at pre (i.e., day 0), post, day 2, and day 7 (C, F, and I). Pre and post represent torques obtained immediately prior to and following the eccentric contractions while days 2 and 7 are torques recorded days after the eccentric contractions. A score of “0” for adaptive potential would imply no change in torque due to training while a positive score would indicate the muscle adapted from eccentric exercise training. n = 5 or 6 per strain/sex. “Combined” is male and female pooled data pooled. *Significantly different than day 0 (i.e., pre; P < 0.05). KO, knockout; WT, wild-type.

We calculated adaptive potential by comparing tetanic isometric torques generated during the last (5th) bout from the trained groups to age-matched groups that only completed a single bout (i.e., untrained), at all timepoints. As with the absolute torque values, adaptive potential did not differ between Krt18 KO and WT mice (P ≥ 0.169; Fig. 4, C, F, and I). Regardless of strain or sex, adaptations to eccentric exercise training were greatest immediately post the contractions, with tetanic isometric torque increasing over 40% when compared with values obtained in trained versus untrained muscles.

DISCUSSION

Keratins are among the most upregulated genes in mouse skeletal muscle following eccentric exercise training, particularly the Krt18 gene, which shows a higher upregulation in young compared with older muscle (18). The function of keratins in muscle remodeling is not well understood, but the age-dependent increase in keratin gene expression post-training suggests a potential role for Krt18 in muscle plasticity. This study investigated Krt18’s role in the muscle adaptation to eccentric exercise training. Experiments using Krt18 KO mice revealed that Krt18’s absence does not impact immediate strength deficits or strength recovery after a single bout or multiple bouts of eccentric contractions, nor does it impede the muscle’s ability to adapt (i.e., the repeated bout effect).

In our studies, the absence of Krt18 had no functional effects on skeletal muscle of young mice. Indeed, Krt18 KO and WT mice were equally strong as measured by absolute or relative in vivo isometric torque (Fig. 3). More surprising, given the changes we previously reported (18), was that skeletal muscle of Krt18 KO mice exhibited nearly identical isometric torque values when compared with WT mice over 5 individual bouts of 150 maximal eccentric contractions. Moreover, the response of Krt18-deficient mice to eccentric exercise training, measured as torque produced after the first and fifth bouts, was identical to controls (Fig. 4). These results indicate that Krt18 is not an essential protein for skeletal muscle adaptations or remodeling following eccentric exercise training in young muscle.

Several factors could explain why deficiency of Krt18 did not affect the muscle’s response, recovery, and adaptation to eccentric exercise training. Foremost would be the low levels of Krt18 mRNA and protein in skeletal muscle. Using quantitative RT-PCR, Muriel et al. (20) estimated that Krt18 mRNA levels are 1,000-fold less than that of desmin mRNA, which is the most abundant intermediate filament in skeletal muscle (29). Although Krt18 was reported in developing but not mature muscle (30), Muriel et al. (20) detected it in immunoblots of mature TA muscles and showed that knockdown with siRNA had significant physiological consequences. Our results show that Krt18 is present at extremely low levels in muscle, particularly when contrasted with liver (Fig. 2B). We previously published that Krt18 expression increased 7.2-fold in muscle following eccentric exercise training using RNA-sequencing (18). Here, we report an approximately twofold increase in Krt18 mRNA after a single bout of eccentric contractions (Fig. 1C). Considering its extremely low baseline levels, even a significant fold increase in Krt18 might not be physiologically significant. Our present results indicate that blocking the increase in Krt18 expression through Krt18 knockout does not influence the muscle’s capacity to adapt to eccentric exercise training.

Skeletal muscle likely compensates for the lack of Krt18 by expressing other keratins. For instance, Krt19, along with Krt18 and desmin, contribute to force transduction and cytoskeletal organization (20). Krt18 is thought to support Krt19 in skeletal muscle, aiding in keratin filament formation and contractile force transduction. However, Krt19’s expression in skeletal muscle is also low, with mRNA levels ∼500-fold lower than desmin’s (20). Although this study did not explore Krt19’s compensatory role, other research indicates significant effects when Krt18 and Krt19 levels are reduced or depleted in TA skeletal muscle (20). Specifically, introducing siRNA targeting Krt19 into Krt18 KO mice, or targeting Krt18 in Krt19 KO mice, resulted in more pronounced strength deficits after 15 maximal eccentric contractions compared with WT mice. This implies that studying the combined effects of Krt18, Krt19, and possibly other keratins may provide deeper insights into the role of keratin filaments in skeletal muscle.

The differences between our current findings and those of Muriel et al. (20) can be attributed to methodological issues. The TA muscle, despite generating 90% of the force of the anterior crural muscles (25), may not be the ideal benchmark for comparing torque, which remains unchanged in our Krt18 knockout model when compared with the specific tension of isolated TA muscles (20). In addition, the modest reduction in baseline specific tension they observed, ∼15%, may not be detectable in our strength measurements due to the inherent experimental variability in the present study. Muriel et al. (20) also did not present pre- or post-injury absolute or relative torque data for Krt18 KO or WT mice, and their eccentric contraction protocol involved fewer contractions, though at much higher strain, than our regimen. It is, therefore, difficult to directly compare our findings.

A thorough appreciation of the mechanisms that drive skeletal muscle adaptations to exercise is essential for understanding the diverse functional changes seen in individuals who undergo the same training programs. The variability, particularly with age, may stem from a diminished or absent response in these mechanisms within older muscles. Our research has shown that Krt18 is not vital for the skeletal muscle of young mice to respond, recover, or adapt to our regimen of eccentric exercise training. This was unexpected, considering the notable increase in Krt18 expression following eccentric contractions, as well as its minor yet significant role in specific tension and susceptibility to contraction-induced injury previously reported (20). Although Krt18 is upregulated after eccentric contractions and thought to contribute to muscular force, our study reveals that it is not crucial for young (and likely old) skeletal muscle to adapt after eccentric injury. These findings emphasize the necessity for additional research to unravel the complex network of factors that influence skeletal muscle adaptations.

DATA AVAILABILITY

Data will be made available upon reasonable request.

GRANTS

This work was supported by a Glenn Foundation for Medical Research and AFAR Grant for Junior Faculty Award (to C.W.B., A23006) and a National Institute of Health Grant (to C.W.B., R03AG081950). C.W.B acknowledges the support of the Osteopathic Heritage Foundation through funding for the Ralph S. Licklider, D.O., Endowed Faculty Fellowship in the Heritage College of Osteopathic Medicine and the Diabetes Institute Summer Interprofessional Research Experience for Undergraduates (R25DK122952).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

R.J.B. and C.W.B. conceived and designed research; M.S.G., S.W.F., T.A.K., M.L.Y., and C.W.B. performed experiments; M.S.G., R.J.B., and C.W.B. analyzed data; M.S.G., R.J.B., and C.W.B. interpreted results of experiments; M.S.G. and C.W.B. prepared figures; M.S.G. and C.W.B. drafted manuscript; M.S.G., S.W.F., T.A.K., M.L.Y., R.J.B., and C.W.B. edited and revised manuscript; M.S.G., S.W.F., T.A.K., M.L.Y., R.J.B., and C.W.B. approved final version of manuscript.