Skip to main content
Microbiology Spectrum logoLink to Microbiology Spectrum
. 2024 Sep 18;12(11):e00611-24. doi: 10.1128/spectrum.00611-24

Effects of antibiotic and disinfectant exposure on the mouse gut microbiome and immune function

Wen-Bo Xu 1,2, Yun-Fan Wang 1,2, Si-Yu Meng 1,2, Xiao-Tong Zhang 1,2, Yi-Rong Wang 1,2, Zhao-Ying Liu 1,2,✉
Editor: Pei-Yuan Qian3
PMCID: PMC11536992  PMID: 39292002

ABSTRACT

This study explores the effects of disinfectant and antibiotic exposure on gut health, focusing on gut microbiota balance and gut immune function. Our analysis indicates that disinfectants increase the proportion of Gram-positive bacteria, particularly increasing Staphylococcus levels, while antibiotics increase the proportion of Gram-negative bacteria, especially Bacteroides levels. These changes disrupt microbial harmony and affect the gut microbiome’s functional capacity. Additionally, our research reveals that both disinfectants and antibiotics reduce colon length and cause mucosal damage. A significant finding is the downregulation of NLRC4, a key immune system regulator in the gut, accompanied by changes in immune factor expression. This interaction between chemical exposure and immune system dysfunction increases susceptibility to inflammatory bowel disease and other gut conditions. Given the importance of disinfectants in disease prevention, this study advocates for a balanced approach to their use, aiming to protect public health while minimizing adverse effects on the gut microbiome and immune function.

IMPORTANCE

Disinfectants are extensively employed across various sectors, such as the food sector. Disinfectants are widely used in various sectors, including the food processing industry, animal husbandry, households, and pharmaceuticals. Their extensive application risks environmental contamination, impacting water and soil quality. However, the effect of disinfectant exposure on the gut microbiome and the immune function of animals remains a significant, unresolved issue with profound public health implications. This highlights the need for increased scrutiny and more regulated use of disinfectants to mitigate unintended consequences on gut health and maintain immune system integrity.

KEYWORDS: disinfectant, antibiotic, NLRC4, gut healthy, immunity response

INTRODUCTION

The gut functions not only as a digestive organ but also plays a crucial role in maintaining overall health and immune system balance (1). The symbiotic relationship between the host and the gut’s extensive microbial ecosystem is vital for the immune system’s development and functionality (2, 3). These microorganisms are essential for food digestion, nutrient synthesis, and immune defense modulation against pathogens (4). Disruptions in gut microbiota equilibrium are closely linked to various diseases, including inflammatory bowel diseases (IBDs) like Crohn’s disease and ulcerative colitis, as well as obesity and cardiovascular diseases (5–7). Moreover, the significance of the gut extends beyond nutrient absorption and immunological defense to the profound impact of its complex microbial ecosystem—known as the gut microbiota—on overall health (8–10). Maintaining a healthy balance within the gut microbiota is crucial for promoting wellbeing and preventing the imbalances that can lead to diverse health challenges (11).

Current research indicates that antibiotics, while beneficial, can also be harmful, with increasing evidence linking their overuse to various disorders related to alterations in gut microbiota (12–14). Studies show that prolonged antibiotic use can reduced beneficial gut microbiota and increase the proportion of harmful organisms (15). Additionally, antibiotics facilitate the horizontal transfer of antibiotic resistance genes, enhancing bacterial resistance (16, 17). The imbalances caused by antibiotics in gut microbiota extend beyond gastrointestinal issues to broader health concerns, including immune system effectiveness, obesity, and inflammatory conditions (12, 18–20). Bactericidal antibiotics may also disrupt the metabolic activities of myeloid cells, diminishing their ability to eliminate bacterial pathogens (21, 22), thus increasing vulnerability to secondary infections.

Recently, disinfectant use has surged in animal husbandry, the food processing industry, homes, and hospitals (23, 24). This widespread application has led to environmental contamination, affecting water and soil quality and promoting bacterial resistance (25, 26). Such developments pose a risk of cross-infection and exacerbate antibiotic resistance, highlighting the growing threat that disinfectants pose to human health (27–29). Despite these concerns, research on the impact of disinfectants on the gut microbiome remains unclear.

To address this issue, a model was constructed to determine whether disinfectants affect the gut microbiome and immune function. Benzalkonium chloride (BAC), a widely used quaternary ammonium disinfectant, has broad-spectrum biocidal activity against bacteria, algae, fungi, and viruses (30). BAC was chosen to study the effect of disinfectant exposure on microbial antibiotic resistance (31). This model aims to understand how disinfectants disrupt the gut ecosystem and affect immune regulation. Oxytetracycline (OTC), a broad-spectrum tetracycline antibiotic, was selected as the antibiotic group (32, 33). Widely used in medicine, veterinary medicine, and agriculture, OTC serves as a model for assessing the impact of antibiotics on gut health (34–37). This study assesses the differences in the impact of disinfectants versus antibiotics on the gut, offering insights into their distinct mechanisms of action and potential health implications.

MATERIALS AND METHODS

Animals and experimental design

All experimental procedures were approved by the Hunan Experimental Animal Center and Hunan Drug Safety Evaluation and Research Center (Changsha, China) and were conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health (Batch Number: 2023–022). Female ICR mice weighing 18–22 g obtained from Hunan SJA Laboratory Animal Co., Ltd. were acclimated to the experimental environment for at least 7 days with ad libitum access to food and water. After 7 days of acclimation, the mice of each breed were randomized into two groups administered with the following for 8 weeks: Control (control and sterile saline), OTC (oxytetracycline 0.1 mg/mL) (38), and BAC (benzalkonium chloride 0.005%) (39). Solutions were delivered via drinking water and refreshed twice weekly (12). After 8 weeks, animals were euthanized by carbon dioxide inhalation. Samples were collected and stored immediately at −80°C for further analysis.

Determination of organ bacterial burdens

After 8 weeks of treatment, the animals were euthanized, and their organs were weighed. Gastrointestinal tissues were extracted aseptically, longitudinally opened into thin sections, and submerged in 10 mL of sterile phosphate-buffered saline (PBS). The tissues were vigorously shaken to remove the contents. The washed tissues were then added to 5 mL of Hank’s Balanced Salt solution (HBSS) supplemented with 5% fetal bovine serum (FBS) and 25 mM 4-(2-hydroxyethyl)−1-piperazineethanesulfonic acid (HEPES), shaken vigorously, and the supernatant is stored in fresh tubes (designated as the “mucus layer’). This step is repeated to produce 10 mL of the “mucus layer,” which is then centrifuged at 4,000 rpm for 4 minutes. The pellet is resuspended in 1 mL of sterile PBS. The tissues are finally washed twice in sterile PBS (each time shaken in 5 mL), and the remaining tissue is homogenized in 1 mL of sterile PBS before plating (designated as “deep tissue layer”). Plate culture was performed on MacConkey (Solarbio, China) for Gram-negative bacteria and Columbia nalidixic acid (CNA) selective agar (Hopebio, China) for Gram-positive bacteria to determine the bacterial load (40). Colony counts were performed after incubation at 37°C for 24–48 hours according to the method described by Drummond (12, 41).

Preparation of genomic DNA from murine fecal samples

Microbiome analysis was performed on fecal samples collected using sterilized forceps from mice housed in sterilized empty cages. Samples were stored at −80℃ until DNA extraction. Total genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) method, and its concentration and purity were monitored on 1% agarose gels (42). The DNA was diluted to 1 ng/µL using sterile water based on its concentration.

16S amplicon sequencing and analysis

The preparation of 16S rRNA sequencing libraries was carried out accordance to Novogene (China) protocols. The V3–V4 hypervariable region of the bacterial 16S rRNA gene was universal bacterial primers (515F: GTGCCAGCMGCCGCGGTAA, 806R : GGACTACHVGGGTWTCTAAT) (designed by Novogene). Sequencing libraries were generated using the Illumina TruSeq DNA PCR-Free Library Preparation Kit (Illumina, USA), and index codes were added. Library quality was assessed using the Qubit@ 2.0 Fluorometer (Thermo Scientific, USA) and Agilent Bioanalyzer 2100 system. The library was sequenced on an Illumina NovaSeq platform to generate 250-bp paired-end reads.

Bioinformatics analyses

Paired-end reads were merged using fast length adjustment of short reads (FLASH) and assigned them to each sample based on unique barcodes. Sequences were analyzed using quantitative insights into microbial ecology (QIIME) and in-house Perl scripts to assess α-diversity and β-diversity. Quality-filtered reads were processed using pick_de_novo_otus.py to generate operational taxonomic units (OTUs) with a 97% similarity threshold. Representative sequences were selected for each OTU, and taxonomic information was annotated using the RDP classifier (43). We computed α-diversity metrics by rarifying the OTU table and calculating Chao1, observed species, and Shannon indices. Rarefaction curves were generated based on these metrics.

For β-diversity, weighted UniFrac was used as a phylogenetic measure, with principal coordinate analysis (PCoA) and unweighted pair group method with arithmetic mean (UPGMA) clustering. PCoA transformed the distance matrix into orthogonal axes, visualizing the maximum variation with the first principal coordinate and the second maximum with the second principal coordinate. UPGMA clustering used average linkage to interpret the distance matrix (44).

To further analyze microbial diversity differences between samples, we conducted significance tests using statistical analysis methods such as t-test and linear discriminant analysis effect size (LEfSe), which were used to analyze microbial diversity differences, with LEfSe indicating significant differences by an LDA score >2 and P-value < 0.05.

Histopathology

Colon samples were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned and stained with haematoxylin and eosin (H&E) for histological examination to determine the severity of inflammation and the extent of mucosal and crypt damage (45, 46).

RT-qPCR analysis of gene expression

Total RNA was isolated using TRIzol reagent (Accurate Biotechnology, China) and reverse-transcribed into cDNA using the ABScript Neo RT Master Mix for qPCR with gDNA Remover (ABclonal, China). RT-qPCR was performed using a LightCycler 480 Instrument II (Roche Diagnostics) with BlasTaq 2 × qPCR MasterMix (abm, Canada) to measure the mRNA expression, with GAPDH as a reference gene. Relative mRNA expression was normalized to GAPDH and determined using the 2−ΔΔCt method (47). All primer sequences are listed in Table 1.

TABLE 1.

Primer sequence (designed by this study)

Gene Primer F (5’−3’) Primer R (5’−3’) Product (bp)
NLRC4 TGTGTGAGCAGTGACGGATG CAGTGCTGCATCCGGTAAGA 136
AIM2 ACCCGCAGTGACAATGACTT CAGCACCGTGACAACAAGTG 118
Caspase-1 ACTGACTGGGACCCTCAAGT GCAAGACGTGTACGAGTGGT 111
Caspase-11 ACTGAGGTATGGGGCTAAC CTTTCACCACCACATCGT 145
IL-18 TCAGACAACTTTGGCCGACT GGTGGATCCATTTCCACTTTGA 122
IL-1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT 138
TNF-α CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG 133
ASC CTCGCTGACATCATCCTCGC GCGTTTTGTTGCCGTAGCAG 172
NLRP3 AGCTGGGATTAGACAACTGC CATTGTTGCCCAGGTTCAGC 192
GAPDH TGGAGATTGTTGCCATCAACG TGCCGTGAGTGGAGTCATAC 113

Enzyme-linked immunosorbent assay

The quantification of interleukin-1β (IL-1β), interleukin-18 (IL-18), and apoptosis-associated speck-like protein containing CARD (ASC) levels in mouse colon tissue was performed using an enzyme-linked immunosorbent assay (ELISA) kit supplied by AiFang (Changsha, China). This analysis adhered strictly to the protocol provided by the manufacturer.

Statistical analysis

Phenotypic clinical evaluation and colonic key immune factor content data were analyzed using SPSS statistical software with the t-test. Statistical significance was based on a P-value < 0.05 (*P < 0.05; **P < 0.01).

RESULTS

Changes in the gut microbiota caused by disinfectants and antibiotics

To determine the impact of antibiotics and disinfectants on gut microbiota stability, we studied the effects of long-term exposure to OTC and BAC on the gut microbiota of mice. The results indicated significant alterations in the microbial communities within the gut tissues of mice subjected to prolonged exposure to these substances.

Mice exposed to OTC exhibited an increase in the proportion of Gram-negative bacteria in the mucosal layer of the stomach and sections of the small intestine, with a decrease in bacterial content in the cecum and colon (Fig. 1A). Conversely, there was a decrease in Gram-positive bacteria in the stomach, while an increase was noted in parts of the small intestine and colon, and no significant change was observed in the cecum (Fig. 1C). In the deeper tissue layers, an increase in Gram-negative bacteria was observed in the stomach, parts of the small intestine, and cecum, while a decrease was noted in the colon (Fig. 1B). Gram-positive bacteria showed an increase in proportion across the stomach, small intestine, cecum, and colon (Fig. 1D).

Fig 1.

Bar graphs of bacterial CFU/mL in mucus and deep tissue across the stomach, small intestine, cecum, and colon for Gram-negative and Gram-positive bacteria, comparing Control, OTC, and BAC groups. Statistical significance is marked with asterisks.

OTC and BAC induce dysbiosis in the mouse gut microbiota. (A) Gram-negative bacterial load in the gut mucosal layer of the control group (n = 10), OTC group (n = 10), and BAC group (n = 10) mice. (B) Gram-negative bacterial load in the deep tissue layer of the gut tract in mice. (C) Gram-positive bacterial load in the gut mucosal layer in mice. (D) Gram-positive bacterial load in the deep tissue layer of the gut tract in mice. Data were collected from three independent experiments and analyzed by t-test. *P < 0.05; **P < 0.01.

On the other hand, mice exposed to BAC showed a decrease in Gram-negative bacteria in the mucosal layer of the stomach, small intestine, cecum, and colon (Fig. 1A). There was also a decrease in Gram-positive bacteria in the stomach, small intestine, and cecum, with an increase in the colon (Fig. 1C). In the deeper tissue layers, a decrease in Gram-negative bacteria was observed in the stomach, small intestine, and colon, while an increase was found in the cecum (Fig. 1B). Gram-positive bacteria increased in the stomach, cecum, and colon, but decreased in the small intestine (Fig. 1D).

These findings illustrate significant shifts in the gut microbial communities under the long-term influence of OTC and BAC. Notably, the effects varied between mice exposed to OTC and those exposed to BAC, underscoring the differential impact these substances have on gut microbiota.

16S amplicon sequencing analysis of the impact of disinfectants and antibiotics on the gut microbiome

We used richness and Shannon index as indicators of species diversity within the sample to measure the α-diversity and used the t-test method for statistical analysis. The α-diversity between the BAC group and the control group showed no significant difference, whereas the OTC group has significantly lower α-diversity when compared to the control group (Fig. 2A).

Fig 2.

Multiple analyses compare control, OTC, and BAC groups: box plots of alpha diversity indices, PCoA plot depicting beta diversity, bar chart of relative microbial abundance, and heatmap of genus-level bacterial composition.

Changes in the gut colon microbiota composition of mice after exposure to OTC and BAC. (A) Comparison of observed gut microbiota OTUs and Shannon, Simpson, and Chao1 indices between the control group, OTC group, and BAC group (n = 6 samples/group). (B) Principal coordinate analysis (PCoA) plot of microbiota composition spectra among control, OTC, and BAC groups (n = 6 samples/group). (C) Genus-level relative abundance bar charts for control, OTC, and BAC groups (n = 6 samples/group). (D) Genus-level species abundance cluster heatmap for control, OTC, and BAC groups (n = 6 samples/group).

Using the Bray–Curtis distance algorithm and analyzed using the Tukey statistical method, significant differences in β-diversity were observed between the control group and both the OTC and BAC groups, with notable differences also between the OTC and BAC groups (Table 2). This indicates that both OTC and BAC induce distinct alterations in the gut microbiota (Fig. 2B).

TABLE 2.

Diversity calculation

Group 1 Group 2 Sample size P-value
BAC Control 12 0.00995
Control OTC 12 0.004975
BAC OTC 12 0.014925

Microbial composition analysis revealed diversified communities of different bacterial genera in both the BAC and OTC groups, as shown by relative abundance bar graphs and species abundance cluster heatmaps (Fig. 2C and D). In the OTC group, the proportion of Bacteroides significantly increased, while unclassified_Muribaculaceae (48) decreased compared to the control group. In the BAC group, Staphylococcus significantly increased. Additionally, Bacteroides and Escherichia-Shigella (belonging to Bacteroidota and Proteobacteria, respectively) significantly increased in the OTC group. In the BAC group, Staphylococcus and Dubosiella (both belonging to Firmicutes) significantly increased (Fig. 2C).

Each column of the heatmap was normalized and analyzed, revealing three bacterial categories. Bacteria in the control group were mainly specialized gut bacteria, closely associated with host health, and mostly anerobic or microaerophilic. Probiotics like Lactobacillus play a crucial role in maintaining gut health and balance (49). The OTC group primarily contained common gut symbionts involved in food digestion and nutrient absorption, such as Bacteroides and Bifidobacterium, which are mostly anerobic or facultatively anerobic (50). The BAC group included bacteria from various environments, including opportunistic pathogens like Staphylococcus and Corynebacterium, which can cause infections under certain conditions (51, 52)(Fig. 2D).

To identify specific bacterial genera unique to different groups, we employed linear discriminant analysis effect size (LEFSe) (Fig. 3A). Our data indicate that in the OTC group, there was a significant enrichment of the genera Bacteroides and Escherichia-Shigella, which are typical Gram-negative bacteria from the phyla Bacteroidetes and Proteobacteria, respectively. In the BAC group, typical Gram-positive bacterial genera such as Staphylococcus and Lachnospiraceae_NK4A136_group were significantly enriched, consistent with previous findings (Fig. 3B).

Fig 3.

Cladogram and LDA score bar chart identifying differentially abundant taxa between BAC, control, and OTC groups. The cladogram highlights taxa with significant differences, while the LDA scores quantify the effect size of each taxon across groups.

Differences in microbial abundance between control, OTC, and BAC groups (n = 6 samples/group). (A) Cladogram. (B) LDA distribution. Linear discriminant analysis effect size (LEfSe) was used to analyze differences in the microbial abundance across the three groups.

Damage to gut immune function by disinfectants and antibiotics

H&E staining results

Both OTC and BAC pre-exposed mice exhibited a reduction in colon length, with the reduction being more pronounced in the BAC pre-exposed group (Fig. 4A). H&E staining revealed that the colonic mucosal epithelium in the control group and OTC pre-exposed group was intact and clearly visible, with orderly arranged epithelial cells. In contrast, the BAC pre-exposed group showed signs of mild degenerative necrosis and epithelial shedding in the colonic mucosal epithelium (Fig. 4B).

Fig 4.

Gross and histological features of control, OTC, and BAC-treated groups depict gross tissue samples and histological sections at 50 and 20 micrometer magnification, highlighting differences in the tissue structure between the groups.

Histopathology of the mouse colon tissue after treatment with OTC and BAC. (A) Colon length in control, OTC, and BAC groups. (B) H&E staining of the colon tissue in control, OTC, and BAC groups.

RT-qPCR analysis of gene expression and ELISA results

RT-qPCR analysis revealed a significant decrease in the expression of inflammasome components, including NLRC4, caspase-1, caspase-11, AIM2, ASC, and NLRP3, as well as proinflammatory cytokines IL-18, IL-1β, and TNF-α (Fig. 5A). ELISA results corroborated these findings, showing significantly reduced levels of ASC, IL-18, and IL-1β in protein extracts from the colon (Fig. 5B).

Fig 5.

Relative mRNA expression levels and protein concentrations for inflammatory markers. It compares NLRC4, caspase-1, caspase-11, AIM2, ASC, NLRP3, IL-18, IL-1β, and TNF-α among control, OTC, and BAC-treated groups.

mRNA and protein detection in the mouse colon after exposure to OTC and BAC. (A) qPCR detection of mRNA expression levels of NLRC4, caspase-1, caspase-11, AIM2, NLRP3, IL-18, IL-1β, and TNF-α in the colon of mice from control, OTC, and BAC groups. (B) ELISA detection of ASC, IL-1β, and IL-18 protein expression levels in the colon of mice from control, OTC, and BAC groups. Data were collected from three independent experiments and analyzed by t-test. *P < 0.05; **P < 0.01.

These results strongly suggest that both BAC and OTC can impact gut immunity by modulating the production of gut cytokines. The mechanism through which BAC exerts its effects may involve the disruption of cell membranes. While this characteristic is essential for its antimicrobial action, it can also cause damage to host cells, including those in the gut mucosa. This cellular damage could impair the gut barrier function and immune response, highlighting the need for careful consideration when using disinfectants like BAC, particularly in contexts where they might impart gut microbiome and overall gut health.

DISCUSSION

The impact of disinfectant exposure on the gut microbiome and immune function of animals remains a significant, unresolved question with profound implications for public health. Few studies have examined the long-term effects of disinfectants on animals. Our findings show that disinfectant exposure disrupts the gut microbiome, leading to a significant increase in Gram-negative bacteria. In contrast, antibiotic exposure results in a higher presence of Gram-positive bacteria. These results demonstrate that disinfectants and antibiotics affect the gut microbial through different mechanisms.

BAC is known to effectively destroy lipopolysaccharides, a key component of the outer membrane of Gram-negative bacteria (39). This makes Gram-negative bacteria more susceptible to BAC, particularly in regions where BAC concentrations are higher. As a result, there is a reduction in Gram-negative bacteria in various parts of the gut. The decrease in Gram-negative bacteria typically leads to reduced competition for Gram-positive bacteria (53). Consequently, Gram-positive bacteria can proliferate in certain gut sections. This shift in bacterial populations disrupts the overall gut environment, highlighting the complex and profound effects of disinfectant exposure on gut microbiome stability and immune function. Meanwhile, OTC can increase both Gram-negative and Gram-positive bacteria in the gut. This suggests that OTC may disrupt the microbial balance by inhibiting the growth of specific bacteria and promoting the growth of resistant strains. Additionally, the dynamic interactions among gut microbiota, such as competition and cooperation, along with the host’s immune response and mucosal secretions, further influence the relative abundance and distribution of different bacterial groups (54). These combined factors explain the complex effects of OTC on the changes in Gram-negative and Gram-positive bacteria levels in various gut regions.

OTC can effectively kill tetracycline-resistant Escherichia coli and inhibit Actinobacillus pleuropneumoniae, a pathogen responsible for swine pneumonia (55, 56). Additionally, BAC has demonstrated significant bactericidal effects on Listeria monocytogenes (57). Numerous studies have documented the impact of antibiotics on intestinal microbes (58–60), and our findings corroborate these studies. Specifically, OTC administration elevates the presence of Gram-negative bacteria in the gut microbiome, such as Bacteroides and Escherichia-Shigella, aligning with previous reports (61). Interestingly, our study reveals that disinfectants exert an effect on the gut microbiota, which contrasts with that of antibiotics. BAC exposure results in a heightened abundance of Gram-positive bacteria, such as Staphylococcus, in the gut. Infections with Staphylococcus species can lead to a range of adverse outcomes in animals, including increased inflammatory responses, compromised gut barrier integrity, and immune system disruption, resulting in difficult-to-manage conditions (62–64). This finding introduces a novel perspective on how disinfectants interact with the gut ecosystem, significantly contrasting with the well-documented influence of antibiotics. Throughout the experiment, we monitored the mice’s weight and found no significant changes. However, the feces of the mice in the BAC group were looser and softer than those in the control group. The precise mechanisms underlying these effects remain elusive, necessitating further investigation to elucidate the detailed pathways through which disinfectants distinctly influence the gut microbiota.

NLRC4 is a critical protein within the NOD-like receptor (NLR) family, playing a vital role in regulating the cellular immune response (65). It recognizes specific pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) from host cells, thereby activating the immune system (66–70). NLRC4 is notably triggered by the bacterial type III secretion system (T3SS), stimulating the production of pro-inflammatory cytokine and inflammatory responses to counteract pathogens (71–73). Additionally, alterations in the NLRC4 gene are linked to autoimmune diseases, activating the inflammasome and leading to gut inflammation (74–76). A decrease in NLRC4 expression can heighten infection risks, disrupt gut microbiota balance, and lead to inflammatory response dysregulation and immune system impairment. Pathological findings have revealed that extended exposure to both antibiotics and disinfectants results in a reduction in colon length, with disinfectants additionally causing damage to the colonic mucosa. Such alterations could disrupt normal gut functions, impairing nutrient absorption and digestion. Disinfectant exposure increases Staphylococcus levels, while antibiotics elevate Bacteroides concentrations—both types of bacteria lack T3SS, contributing to reduced NLRC4 activation (77). Disinfectant exposure has also been observed to damage intestinal integrity in mice, further influencing NLRC4 expression. Consequently, mice subjected to long-term exposure to disinfectants or antibiotics exhibit compromised gut immune functions. Despite distinct alterations in their microbiota, these changes negatively affect their healthy development.

Research has demonstrated that a reduction in NLRC4 expression can significantly influence subsequent immune pathways. Reduced levels of NLRC4 may lead to a decline in the production of critical proinflammatory cytokines, including IL-1β and IL-18 (78–81), potentially weakening inflammatory responses and impairing the body’s capacity to eliminate pathogens. Beyond its direct in inflammatory mechanisms, NLRC4 engages with various immune regulatory pathways, including the activation of the NLRP3 inflammasome and the stimulation of caspase-1 and caspase-11 (82, 83). A diminished expression of NLRC4 could result in dysregulation of these pathways, adversely affecting cellular responses to infections and pathogen clearance. Within the intestinal environment, NLRC4 is instrumental in maintaining the equilibrium of the microbial community and preventing the proliferation of pathogens. It regulates inflammatory reactions, safeguarding the integrity of the intestinal mucosal barrier and preventing the intrusion of detrimental microbes (84). A reduction in NLRC4 expression might lead to dysbiosis of the gut microbiome, increasing the risk for gastrointestinal disorders (84). The chemical constituents of disinfectants may disrupt the equilibrium of gut microbiota and perturb the gut immune environment, notably impacting the expression of critical immune regulatory proteins such as NLRC4. The suppression of NLRC4 expression affects more than just direct pathogen defense; it also alters the expression of subsequent immune mediators, including IL-18, IL-1β, NLRP3, caspase-1, and caspase-11. These elements are crucial for sustaining intestinal immune responses and managing inflammation. The disturbance of these immune components can precipitate immune system dysfunction, heightening the risk for inflammatory bowel disease and other gut disorders. However, the specific mechanisms underlying these effects remain unclear and require further research.

In conclusion, our findings suggest that while the widespread use of disinfectants is essential for pathogen control, it may inadvertently lead to disorders within the gut microbiome and a weakened immune response. Disinfectants can disrupt the delicate balance of the gut ecosystem, causing an increase in gut Staphylococcus, which impairs overall gut function and can trigger a range of immune disorders. Additionally, disinfectants decrease gut NLRC4 expression. This reduction in NLRC4, which is pivotal for producing crucial proinflammatory cytokines and the activation of various immune regulatory pathways, weakens the body’s defenses against pathogens. Furthermore, NLRC4 plays a crucial role in maintaining the microbial community balance and safeguarding the intestinal mucosal barrier, preventing the overgrowth of harmful microbes and the onset of gastrointestinal diseases such as inflammatory bowel disease. Therefore, this research highlights the critical need for a balanced approach to disinfectant use, advocating for strategies that mitigate potential adverse effects on gut health and the broader immune system.

ACKNOWLEDGMENTS

The research presented in this article was made possible through the generous support of the Aid program for Science and Technology Innovative Research Team in Higher Educational Institutions of Hunan Province.

W-B. and Z-Y.L. were in charge of experimental design and data analysis. W-B.X., Y-F.W., S-Y.M., X-T.Z., and Y-R.W. were responsible for experimental implementation. W-B. plotted the figures and tables and drafted the manuscript; Z-Y.L. revised and approved the final version. All authors reviewed the manuscript.

Contributor Information

Zhao-Ying Liu, Email: liu_zhaoying@hunau.edu.cn.

Pei-Yuan Qian, Hong Kong University of Science and Technology, Hong Kong, Hong Kong.

ETHICS APPROVAL

The animals' experiments were approved by the Ethics Committee of Hunan Agricultural University (Number:2023-022).

REFERENCES

  • 1. Ahluwalia B, Magnusson MK, Öhman L. 2017. Mucosal immune system of the gastrointestinal tract: maintaining balance between the good and the bad. Scand J Gastroenterol 52:1185–1193. doi: 10.1080/00365521.2017.1349173 [DOI] [PubMed] [Google Scholar]
  • 2. Chen L, Wang D, Garmaeva S, Kurilshikov A, Vich Vila A, Gacesa R, Sinha T, Segal E, Weersma RK, Wijmenga C, Zhernakova A, Fu J. 2021. The long-term genetic stability and individual specificity of the human gut microbiome. Cell 184:2302–2315. doi: 10.1016/j.cell.2021.03.024 [DOI] [PubMed] [Google Scholar]
  • 3. Maier L, Goemans CV, Wirbel J, Kuhn M, Eberl C, Pruteanu M, Müller P, Garcia-Santamarina S, Cacace E, Zhang B, Gekeler C, Banerjee T, Anderson EE, Milanese A, Löber U, Forslund SK, Patil KR, Zimmermann M, Stecher B, Zeller G, Bork P, Typas A. 2021. Unravelling the collateral damage of antibiotics on gut bacteria. Nature 599:120–124. doi: 10.1038/s41586-021-03986-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Hou K, Wu Z-X, Chen X-Y, Wang J-Q, Zhang D, Xiao C, Zhu D, Koya JB, Wei L, Li J, Chen Z-S. 2022. Microbiota in health and diseases. Signal Transduct Target Ther 7:135. doi: 10.1038/s41392-022-00974-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Yano JM, Yu K, Donaldson GP, Shastri GG, Ann P, Ma L, Nagler CR, Ismagilov RF, Mazmanian SK, Hsiao EY. 2015. Indigenous bacteria from the gut microbiota regulate host serotonin biosynthesis. Cell 161:264–276. doi: 10.1016/j.cell.2015.02.047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Ijssennagger N, Belzer C, Hooiveld GJ, Dekker J, van Mil SWC, Müller M, Kleerebezem M, van der Meer R. 2015. Gut microbiota facilitates dietary heme-induced epithelial hyperproliferation by opening the mucus barrier in colon. Proc Natl Acad Sci U S A 112:10038–10043. doi: 10.1073/pnas.1507645112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Schirmer M, Garner A, Vlamakis H, Xavier RJ. 2019. Microbial genes and pathways in inflammatory bowel disease. Nat Rev Microbiol 17:497–511. doi: 10.1038/s41579-019-0213-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Adak A, Khan MR. 2019. An insight into gut microbiota and its functionalities. Cell Mol Life Sci 76:473–493. doi: 10.1007/s00018-018-2943-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Rinninella E, Raoul P, Cintoni M, Franceschi F, Miggiano GAD, Gasbarrini A, Mele MC. 2019. What is the healthy gut microbiota composition? A changing ecosystem across age, environment, diet, and diseases. Microorganisms 7:14. doi: 10.3390/microorganisms7010014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Das B, Nair GB. 2019. Homeostasis and dysbiosis of the gut microbiome in health and disease. J Biosci 44:117. doi: 10.1007/s12038-019-9926-y [DOI] [PubMed] [Google Scholar]
  • 11. de Vos WM, Tilg H, Van Hul M, Cani PD. 2022. Gut microbiome and health: mechanistic insights. Gut 71:1020–1032. doi: 10.1136/gutjnl-2021-326789 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Drummond RA, Desai JV, Ricotta EE, Swamydas M, Deming C, Conlan S, Quinones M, Matei-Rascu V, Sherif L, Lecky D, Lee C-CR, Green NM, Collins N, Zelazny AM, Prevots DR, Bending D, Withers D, Belkaid Y, Segre JA, Lionakis MS. 2022. Long-term antibiotic exposure promotes mortality after systemic fungal infection by driving lymphocyte dysfunction and systemic escape of commensal bacteria. Cell Host Microbe 30:1020–1033. doi: 10.1016/j.chom.2022.04.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Ianiro G, Tilg H, Gasbarrini A. 2016. Antibiotics as deep modulators of gut microbiota: between good and evil. Gut 65:1906–1915. doi: 10.1136/gutjnl-2016-312297 [DOI] [PubMed] [Google Scholar]
  • 14. Blaser MJ. 2016. Antibiotic use and its consequences for the normal microbiome. Science 352:544–545. doi: 10.1126/science.aad9358 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Zimmermann P, Curtis N. 2019. The effect of antibiotics on the composition of the intestinal microbiota - a systematic review. J Infect 79:471–489. doi: 10.1016/j.jinf.2019.10.008 [DOI] [PubMed] [Google Scholar]
  • 16. Goerke C, Köller J, Wolz C. 2006. Ciprofloxacin and trimethoprim cause phage induction and virulence modulation in Staphylococcus aureus. Antimicrob Agents Chemother 50:171–177. doi: 10.1128/AAC.50.1.171-177.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Lester CH, Frimodt-Møller N, Sørensen TL, Monnet DL, Hammerum AM. 2006. In vivo transfer of the vanA resistance gene from an Enterococcus faecium isolate of animal origin to an E. faecium isolate of human origin in the intestines of human volunteers. Antimicrob Agents Chemother 50:596–599. doi: 10.1128/AAC.50.2.596-599.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Toor D, Wsson MK, Kumar P, Karthikeyan G, Kaushik NK, Goel C, Singh S, Kumar A, Prakash H. 2019. Dysbiosis disrupts gut immune homeostasis and promotes gastric diseases. Int J Mol Sci 20:2432. doi: 10.3390/ijms20102432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Colquhoun C, Duncan M, Grant G. 2020. Inflammatory bowel diseases: host-microbial-environmental interactions in dysbiosis. Diseases 8:13. doi: 10.3390/diseases8020013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Ramirez J, Guarner F, Bustos Fernandez L, Maruy A, Sdepanian VL, Cohen H. 2020. Antibiotics as major disruptors of gut microbiota. Front Cell Infect Microbiol 10:572912. doi: 10.3389/fcimb.2020.572912 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Kalghatgi S, Spina CS, Costello JC, Liesa M, Morones-Ramirez JR, Slomovic S, Molina A, Shirihai OS, Collins JJ. 2013. Bactericidal antibiotics induce mitochondrial dysfunction and oxidative damage in mammalian cells. Sci Transl Med 5:192ra85. doi: 10.1126/scitranslmed.3006055 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Yang JH, Bhargava P, McCloskey D, Mao N, Palsson BO, Collins JJ. 2017. Antibiotic-induced changes to the host metabolic environment inhibit drug efficacy and alter immune function. Cell Host Microbe 22:757–765. doi: 10.1016/j.chom.2017.10.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Dubey P, Singh A, Yousuf O. 2022. Ozonation: an evolving disinfectant technology for the food industry. Food Bioproc Tech 15:2102–2113. doi: 10.1007/s11947-022-02876-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Aranke M, Moheimani R, Phuphanich M, Kaye AD, Ngo AL, Viswanath O, Herman J. 2021. Disinfectants in interventional practices. Curr Pain Headache Rep 25:21. doi: 10.1007/s11916-021-00938-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Yan M, Xu C, Li C, Feng Y, Duan J, Zhao K, Wu D, Li G, Yang S, Han X, Xie Y, Huang Y, Yu X, Wu J, Zou L. 2023. Effects of environmental disinfection on microbial population and resistance genes: a case study of the microecology within a panda enclosure. Environ Res 235:116662. doi: 10.1016/j.envres.2023.116662 [DOI] [PubMed] [Google Scholar]
  • 26. Filipe HAL, Fiuza SM, Henriques CA, Antunes FE. 2021. Antiviral and antibacterial activity of hand sanitizer and surface disinfectant formulations. Int J Pharm 609:121139. doi: 10.1016/j.ijpharm.2021.121139 [DOI] [PubMed] [Google Scholar]
  • 27. Law K, Lozinski B, Torres I, Davison S, Hilbrands A, Nelson E, Parra-Suescun J, Johnston L, Gomez A. 2021. Disinfection of maternal environments is associated with piglet microbiome composition from birth to weaning. mSphere 6:e0066321. doi: 10.1128/mSphere.00663-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Fu Y, Dou Q, Smalla K, Wang Y, Johnson TA, Brandt KK, Mei Z, Liao M, Hashsham SA, Schäffer A, Smidt H, Zhang T, Li H, Stedtfeld R, Sheng H, Chai B, Virta M, Jiang X, Wang F, Zhu Y-G, Tiedje JM. 2023. Gut microbiota research nexus: One Health relationship between human, animal, and environmental resistomes. mLife 2:350–364. doi: 10.1002/mlf2.12101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Bergeron J, Ammirati M, Danley D, James L, Norcia M, Retsema J, Strick CA, Su WG, Sutcliffe J, Wondrack L, Kim S, Aga DS. 2007. Potential ecological and human health impacts of antibiotics and antibiotic-resistant bacteria from wastewater treatment plants. J Toxicol Environ Health Part B 10:559–573. doi: 10.1080/15287390600975137 [DOI] [PubMed] [Google Scholar]
  • 30. Artasensi A, Mazzotta S, Fumagalli L. 2021. Back to basics: choosing the appropriate surface disinfectant. Antibiotics (Basel) 10:613. doi: 10.3390/antibiotics10060613 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Marple B, Roland P, Benninger M. 2004. Safety review of benzalkonium chloride used as a preservative in intranasal solutions: an overview of conflicting data and opinions. Otolaryngol Head Neck Surg 130:131–141. doi: 10.1016/j.otohns.2003.07.005 [DOI] [PubMed] [Google Scholar]
  • 32. Pickens LB, Tang Y. 2010. Oxytetracycline biosynthesis. J Biol Chem 285:27509–27515. doi: 10.1074/jbc.R110.130419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Chang D, Mao Y, Qiu W, Wu Y, Cai B. 2023. The source and distribution of tetracycline antibiotics in China: a review. Toxics 11:214. doi: 10.3390/toxics11030214 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Payne CJ, Turnbull JF, MacKenzie S, Crumlish M. 2022. The effect of oxytetracycline treatment on the gut microbiome community dynamics in rainbow trout (Oncorhynchus mykiss) over time. Aquaculture 560:738559. doi: 10.1016/j.aquaculture.2022.738559 [DOI] [Google Scholar]
  • 35. Majeed RK, Muhammed HF, Rahim HM. 2018. Acute toxicity study of indomethacin and oxytetracycline in rabbits. Med J Babylon 15:218. doi: 10.4103/MJBL.MJBL_60_18 [DOI] [Google Scholar]
  • 36. Ignasiak K, Maxwell A. 2018. Oxytetracycline reduces the diversity of tetracycline-resistance genes in the Galleria mellonella gut microbiome. BMC Microbiol 18:228. doi: 10.1186/s12866-018-1377-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Jasim HH, Al-Naif HH. 2021. Effect of adding chitosan and oxytetracycline to the diets of corn in physiological and microbial performance of broiler. IOP Conf Ser: Earth Environ Sci 904:012034. doi: 10.1088/1755-1315/904/1/012034 [DOI] [Google Scholar]
  • 38. Morrissey RE, Tyl RW, Price CJ, Ledoux TA, Reel JR, Paschke LL, Marr MC, Kimmel CA. 1986. The developmental toxicity of orally administered oxytetracycline in rats and mice. Fundam Appl Toxicol 7:434–443. doi: 10.1016/0272-0590(86)90093-x [DOI] [PubMed] [Google Scholar]
  • 39. Merchel Piovesan Pereira B, Tagkopoulos I. 2019. Benzalkonium chlorides: uses, regulatory status, and microbial resistance. Appl Environ Microbiol 85:e00377-19. doi: 10.1128/AEM.00377-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Bonnet M, Lagier JC, Raoult D, Khelaifia S. 2020. Bacterial culture through selective and non-selective conditions: the evolution of culture media in clinical microbiology. New Microbes New Infect 34:100622. doi: 10.1016/j.nmni.2019.100622 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Kang B, Alvarado LJ, Kim T, Lehmann ML, Cho H, He J, Li P, Kim B-H, Larochelle A, Kelsall BL. 2020. Commensal microbiota drive the functional diversification of colon macrophages. Muc Immunol 13:216–229. doi: 10.1038/s41385-019-0228-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Epperson LE, Strong M. 2020. A scalable, efficient, and safe method to prepare high quality DNA from mycobacteria and other challenging cells. J Clin Tuberc Other Mycobact Dis 19:100150. doi: 10.1016/j.jctube.2020.100150 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Xavier RJ, Podolsky DK. 2007. Unravelling the pathogenesis of inflammatory bowel disease. Nature 448:427–434. doi: 10.1038/nature06005 [DOI] [PubMed] [Google Scholar]
  • 44. Chang Q, Luan Y, Sun F. 2011. Variance adjusted weighted UniFrac: a powerful beta diversity measure for comparing communities based on phylogeny. BMC Bioinformatics 12:118. doi: 10.1186/1471-2105-12-118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Alturkistani HA, Tashkandi FM, Mohammedsaleh ZM. 2015. Histological stains: a literature review and case study. Glob J Health Sci 8:72–79. doi: 10.5539/gjhs.v8n3p72 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Erben U, Loddenkemper C, Doerfel K, Spieckermann S, Haller D, Heimesaat MM, Zeitz M, Siegmund B, Kühl AA. 2014. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int J Clin Exp Pathol 7:4557–4576. [PMC free article] [PubMed] [Google Scholar]
  • 47. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 48. Wang J, Han L, Liu Z, Zhang W, Zhang L, Jing J, Gao A. 2023. Genus unclassified_Muribaculaceae and microbiota-derived butyrate and indole-3-propionic acid are involved in benzene-induced hematopoietic injury in mice. Chemosphere 313:137499. doi: 10.1016/j.chemosphere.2022.137499 [DOI] [PubMed] [Google Scholar]
  • 49. Slattery C, Cotter PD, O’Toole PW. 2019. Analysis of health benefits conferred by Lactobacillus species from kefir. Nutrients 11:1252. doi: 10.3390/nu11061252 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Xu J, Xia Q, Wu T, Shao Y, Wang Y, Jin N, Tian P, Wu L, Lu X. 2024. Prophylactic treatment with Bacteroides uniformis and Bifidobacterium bifidum counteracts hepatic NK cell immune tolerance in nonalcoholic steatohepatitis induced by high fat diet. Gut Microbes 16:2302065. doi: 10.1080/19490976.2024.2302065 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Furue M, Iida K, Imaji M, Nakahara T. 2018. Microbiome analysis of forehead skin in patients with atopic dermatitis and healthy subjects: implication of Staphylococcus and Corynebacterium. J Dermatol 45:876–877. doi: 10.1111/1346-8138.14486 [DOI] [PubMed] [Google Scholar]
  • 52. Kong K-F, Vuong C, Otto M. 2006. Staphylococcus quorum sensing in biofilm formation and infection. Int J Med Microbiol 296:133–139. doi: 10.1016/j.ijmm.2006.01.042 [DOI] [PubMed] [Google Scholar]
  • 53. Ghoul M, Mitri S. 2016. The ecology and evolution of microbial competition. Trends Microbiol 24:833–845. doi: 10.1016/j.tim.2016.06.011 [DOI] [PubMed] [Google Scholar]
  • 54. Coyte KZ, Rakoff-Nahoum S. 2019. Understanding competition and cooperation within the mammalian gut microbiome. Curr Biol 29:R538–R544. doi: 10.1016/j.cub.2019.04.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Dorey L, Pelligand L, Cheng Z, Lees P. 2017. Pharmacokinetic/pharmacodynamic integration and modelling of oxytetracycline for the porcine pneumonia pathogens Actinobacillus pleuropneumoniae and Pasteurella multocida. J Vet Pharmacol Ther 40:505–516. doi: 10.1111/jvp.12385 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Møller TSB, Liu G, Hartman HB, Rau MH, Mortensen S, Thamsborg K, Johansen AE, Sommer MOA, Guardabassi L, Poolman MG, Olsen JE. 2020. Global responses to oxytetracycline treatment in tetracycline-resistant Escherichia coli. Sci Rep 10:8438. doi: 10.1038/s41598-020-64995-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Pérez-Rodríguez M, López Cabo M, Balsa-Canto E, García MR. 2023. Mechanisms of Listeria monocytogenes disinfection with benzalkonium chloride: from molecular dynamics to kinetics of time-kill curves. Int J Mol Sci 24:12132. doi: 10.3390/ijms241512132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Duan H, Yu L, Tian F, Zhai Q, Fan L, Chen W. 2022. Antibiotic-induced gut dysbiosis and barrier disruption and the potential protective strategies. Crit Rev Food Sci Nutr 62:1427–1452. doi: 10.1080/10408398.2020.1843396 [DOI] [PubMed] [Google Scholar]
  • 59. Lange K, Buerger M, Stallmach A, Bruns T. 2016. Effects of antibiotics on gut microbiota. Dig Dis 34:260–268. doi: 10.1159/000443360 [DOI] [PubMed] [Google Scholar]
  • 60. Konstantinidis T, Tsigalou C, Karvelas A, Stavropoulou E, Voidarou C, Bezirtzoglou E. 2020. Effects of antibiotics upon the gut microbiome: a review of the literature. Biomedicines 8:502. doi: 10.3390/biomedicines8110502 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Zeineldin M, Megahed A, Burton B, Blair B, Aldridge B, Lowe JF. 2019. Effect of single dose of antimicrobial administration at birth on fecal microbiota development and prevalence of antimicrobial resistance genes in piglets. Front Microbiol 10:1414. doi: 10.3389/fmicb.2019.01414 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Jong NWM, Kessel KPM, Strijp JAG. 2019. Immune evasion by Staphylococcus aureus. Microbiol Spectr 7. doi: 10.1128/microbiolspec.GPP3-0061-2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Hsieh RC, Liu R, Burgin DJ, Otto M. 2023. Understanding mechanisms of virulence in MRSA: implications for antivirulence treatment strategies. Expert Rev Anti Infect Ther 21:911–928. doi: 10.1080/14787210.2023.2242585 [DOI] [PubMed] [Google Scholar]
  • 64. Ford CA, Hurford IM, Cassat JE. 2020. Antivirulence strategies for the treatment of Staphylococcus aureus infections: a mini review. Front Microbiol 11:632706. doi: 10.3389/fmicb.2020.632706 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Andrade WA, Zamboni DS. 2020. NLRC4 biology in immunity and inflammation. J Leukoc Biol 108:1117–1127. doi: 10.1002/JLB.3MR0420-573R [DOI] [PubMed] [Google Scholar]
  • 66. Strowig T, Henao-Mejia J, Elinav E, Flavell R. 2012. Inflammasomes in health and disease. Nature 481:278–286. doi: 10.1038/nature10759 [DOI] [PubMed] [Google Scholar]
  • 67. Sutterwala FS, Flavell RA. 2009. NLRC4/IPAF: a CARD carrying member of the NLR family. Clin Immunol 130:2–6. doi: 10.1016/j.clim.2008.08.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Jin MS, Lee J-O. 2008. Structures of the toll-like receptor family and its ligand complexes. Immunity 29:182–191. doi: 10.1016/j.immuni.2008.07.007 [DOI] [PubMed] [Google Scholar]
  • 69. Zhao Y, Yang J, Shi J, Gong Y-N, Lu Q, Xu H, Liu L, Shao F. 2011. The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatus. Nature 477:596–600. doi: 10.1038/nature10510 [DOI] [PubMed] [Google Scholar]
  • 70. Wen J, Xuan B, Liu Y, Wang L, He L, Meng X, Zhou T, Wang Y. 2021. Updating the NLRC4 inflammasome: from bacterial infections to autoimmunity and cancer. Front Immunol 12:702527. doi: 10.3389/fimmu.2021.702527 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Galán JE, Wolf-Watz H. 2006. Protein delivery into eukaryotic cells by type III secretion machines. Nature 444:567–573. doi: 10.1038/nature05272 [DOI] [PubMed] [Google Scholar]
  • 72. Miao EA, Mao DP, Yudkovsky N, Bonneau R, Lorang CG, Warren SE, Leaf IA, Aderem A. 2010. Innate immune detection of the type III secretion apparatus through the NLRC4 inflammasome. Proc Natl Acad Sci U S A 107:3076–3080. doi: 10.1073/pnas.0913087107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Nordlander S, Pott J, Maloy KJ. 2014. NLRC4 expression in intestinal epithelial cells mediates protection against an enteric pathogen. Muc Immunol 7:775–785. doi: 10.1038/mi.2013.95 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Romberg N, Al Moussawi K, Nelson-Williams C, Stiegler AL, Loring E, Choi M, Overton J, Meffre E, Khokha MK, Huttner AJ, West B, Podoltsev NA, Boggon TJ, Kazmierczak BI, Lifton RP. 2014. Mutation of NLRC4 causes a syndrome of enterocolitis and autoinflammation. Nat Genet 46:1135–1139. doi: 10.1038/ng.3066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. McDermott MF, Aksentijevich I, Galon J, McDermott EM, Ogunkolade BW, Centola M, Mansfield E, Gadina M, Karenko L, Pettersson T, et al. 1999. Germline mutations in the extracellular domains of the 55 kDa TNF receptor, TNFR1, define a family of dominantly inherited autoinflammatory syndromes. Cell 97:133–144. doi: 10.1016/s0092-8674(00)80721-7 [DOI] [PubMed] [Google Scholar]
  • 76. de Jesus AA, Canna SW, Liu Y, Goldbach-Mansky R. 2015. Molecular mechanisms in genetically defined autoinflammatory diseases: disorders of amplified danger signaling. Annu Rev Immunol 33:823–874. doi: 10.1146/annurev-immunol-032414-112227 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Sanchez-Garrido J, Ruano-Gallego D, Choudhary JS, Frankel G. 2022. The type III secretion system effector network hypothesis. Trends Microbiol 30:524–533. doi: 10.1016/j.tim.2021.10.007 [DOI] [PubMed] [Google Scholar]
  • 78. Sundaram B, Kanneganti T-D. 2021. Advances in understanding activation and function of the NLRC4 inflammasome. Int J Mol Sci 22:1048. doi: 10.3390/ijms22031048 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Jin H, Kim HJ. 2020. NLRC4, ASC and caspase-1 are inflammasome components that are mediated by P2Y2R activation in breast cancer cells. Int J Mol Sci 21:3337. doi: 10.3390/ijms21093337 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. van de Veerdonk FL, Netea MG, Dinarello CA, Joosten LAB. 2011. Inflammasome activation and IL-1β and IL-18 processing during infection. Trends Immunol 32:110–116. doi: 10.1016/j.it.2011.01.003 [DOI] [PubMed] [Google Scholar]
  • 81. Sasaki Y, Otsuka K, Arimochi H, Tsukumo S-I, Yasutomo K. 2020. Distinct roles of IL-1β and IL-18 in NLRC4-induced autoinflammation. Front Immunol 11:591713. doi: 10.3389/fimmu.2020.591713 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Man SM, Kanneganti T-D. 2015. Regulation of inflammasome activation. Immunol Rev 265:6–21. doi: 10.1111/imr.12296 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83. Xu J, Núñez G. 2011. The NLRP3 inflammasome: activation and regulation. Trends Immunol 32:110–116. doi: 10.1016/j.it.2011.01.003 [DOI] [PubMed] [Google Scholar]
  • 84. Steiner A, Reygaerts T, Pontillo A, Ceccherini I, Moecking J, Moghaddas F, Davidson S, Caroli F, Grossi A, Castro FFM, Kalil J, Gohr FN, Schmidt FI, Bartok E, Zillinger T, Hartmann G, Geyer M, Gattorno M, Mendonça LO, Masters SL. 2022. Recessive NLRC4-autoinflammatory disease reveals an ulcerative colitis locus. J Clin Immunol 42:325–335. doi: 10.1007/s10875-021-01175-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Microbiology Spectrum are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES