Microarray-Based Detection of 90 Antibiotic Resistance Genes of Gram-Positive Bacteria

Abstract

A disposable microarray was developed for detection of up to 90 antibiotic resistance genes in gram-positive bacteria by hybridization. Each antibiotic resistance gene is represented by two specific oligonucleotides chosen from consensus sequences of gene families, except for nine genes for which only one specific oligonucleotide could be developed. A total of 137 oligonucleotides (26 to 33 nucleotides in length with similar physicochemical parameters) were spotted onto the microarray. The microarrays (ArrayTubes) were hybridized with 36 strains carrying specific antibiotic resistance genes that allowed testing of the sensitivity and specificity of 125 oligonucleotides. Among these were well-characterized multidrug-resistant strains of Enterococcus faecalis, Enterococcus faecium, and Lactococcus lactis and an avirulent strain of Bacillus anthracis harboring the broad-host-range resistance plasmid pRE25. Analysis of two multidrug-resistant field strains allowed the detection of 12 different antibiotic resistance genes in a Staphylococcus haemolyticus strain isolated from mastitis milk and 6 resistance genes in a Clostridium perfringens strain isolated from a calf. In both cases, the microarray genotyping corresponded to the phenotype of the strains. The ArrayTube platform presents the advantage of rapidly screening bacteria for the presence of antibiotic resistance genes known in gram-positive bacteria. This technology has a large potential for applications in basic research, food safety, and surveillance programs for antimicrobial resistance.

The intensive use of antibiotics in both public health and animal husbandry has selected for antibiotic-resistant bacteria (39). Under antibiotic selective pressure, bacteria have the ability to develop and exchange resistance genes, making them nonsusceptible to the antimicrobial substances deployed. While antibiotic resistance has emerged in some important animal and human gram-positive pathogens, such as Staphylococcus and Streptococcus spp. and Clostridium perfringens, others, such as Bacillus anthracis, are currently still sensitive to antibiotics (15, 24). Nevertheless, B. anthracis can acquire resistance genes from other gram-positive bacteria in vitro, as previously described (30, 46) and as demonstrated in this study. It is therefore important to follow the evolution of antibiotic resistance in the bacterial population in order to prevent and repress the emergence of multidrug-resistant strains of those bacteria that can still be treated with antibiotics.

Furthermore, commensal bacteria represent a reservoir of antibiotic resistance genes that have the potential to be transferred to human and animal pathogens. An effort has therefore been made in Europe to reduce the emergence and spread of resistant bacteria. The use of antimicrobial substances for nontherapeutic purposes in animal husbandry has been banned, and surveillance programs for antibiotic-resistant bacteria among both human and animal isolates have been implemented (40). Additionally, it has been proposed that bacteria used as probiotics in food or feed or as starter cultures for the food industry must be free of antibiotic resistance genes (http://europa.eu.int/comm/food/fs/sc/scf/out178_en.pdf). Bacteria used in food preparation are mainly gram positive and include Lactococcus, Lactobacillus, Pediococcus, Leuconostoc, Carnobacterium, Enterococcus, Micrococcus, Streptococcus, Staphylococcus, and Propionibacterium spp. Animal probiotics consist mainly of strains of Bacillus, Enterococcus faecium, Pediococcus, Lactobacillus, and Streptococcus.

A simple method which allows the rapid detection of antibiotic resistance genes would complement the standard MIC determination for pathogenic and commensal bacteria. In the clinic, this would have the advantage of detecting silent antibiotic resistance genes which might be turned on in vivo or spread to other bacteria and would help in prescribing the appropriate antibiotic. Such a method could also be applied to slow-growing bacteria, for which the MIC determination may cause problems. In the food industry, it would help to determine whether antibiotic-susceptible starter cultures harbor silent antibiotic resistance genes which could directly reach consumers through the food chain. This technology could be used as a tool to survey the antibiotic resistance gene situation in specific bacteria and would enable rapid tracking of newly emerging resistance genes. For these purposes, a convenient and affordable technology should be available.

Today, PCR and hybridization analysis are common methods used to detect antibiotic resistance genes in bacteria. However, the detection of specific resistance genes remains a tremendous amount of work if every possible resistance gene has to be assessed, and therefore microarray technology is most suitable for resistance gene analysis (28). The few microarrays that have been developed to date for identification of antibiotic resistance genes are either restricted to a class of drug or limited to a certain number of genes. Call et al. developed a microarray for detecting 17 tetracycline resistance genes and one β-lactamase gene (8). Recently, a microarray-based system has been optimized for the detection of genes specific to Staphylococcus aureus, including 12 resistance genes known to occur occasionally in this species (37).

In this report we describe the first hybridization system using microarray technology for routine microbial investigations that allows rapid and efficient screening of gram-positive bacteria for the presence of up to 90 of the most prevalent and transferable antibiotic resistance genes.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. Strains harboring well-characterized resistance genes as well as field strains were used to test the specificity and sensitivity of the microarray-based hybridization system. Hybridization results are shown only for some selected strains (see Fig. 2 and 3). The completely sequenced broad-host-range enterococcal plasmid pRE25 (48), which contains five resistance genes [cat_pIP501, erm(B), sat4, aph(3′)-III, and ant(6)-Ia], was used as a gene target to reveal the presence of resistance genes in Enterococcus and in an avirulent strain of B. anthracis. Lactococcus lactis K214, harboring the mosaic resistance plasmid pK214 [tet(S), cat-LM, mdt(A), and str] (43), was used as an example of a starter culture. The array was also tested with a vancomycin-resistant E. faecium strain harboring a van(A) gene and with strains showing a multidrug resistance phenotype but an unknown genotype. For this purpose, one Staphylococcus haemolyticus strain isolated from mastitis milk and one C. perfringens isolate from cattle were investigated.

TABLE 1.

Bacterial strains and plasmids

Strain	Characteristic(s)a	Reference or sourceb
Enterococcus faecalis RE25	pRE25 [erm(B), catpIP501, aph(3′)-III, sat4, ant(6)-Ia]; tet(M)	48
Enterococcus faecalis JH2-2	Rifr Fusr	31
Enterococcus faecalis JHRE25-2	JH2-2 containing pRE25 [erm(B), catpIP501, aph(3′)-III, ant(6)-Ia, sat4]; Rifr Fusr	48
Lactococcus lactis K214	pK214 [tet(S), cat-LM, mdt(A), str]	43, 44
Clostridium perfringens MLP26c	tetA(P) erm(B) sat4catPaph(3′)-III ant(6′)-Ia	This study
Staphylococcus haemolyticus VPS617d	tet(K) mph(C) erm(C) msr blaZ mecA dfr(A) aph(3′)-III aph(2′)-Ia aac(6′)-Ie ant(6′)-IaInorAsat4	This study
Bacillus anthracis 4230	pXO2+ [Δcap::ant(9)-Ia, acpA]; pX01−; bla1 bla2	23
Bacillus anthracis BR4253	4230 containing pRE25 [erm(B), catpIP501, aph(3′)-III, ant(6)-Ia, sat4]; pXO2+ [Δcap::ant(9′)-Ia, acpA]; pXO1−; bla1 bla2	This study
Enterococcus faecium SF11770	aac(6′)-Im aph(2′)-Ib aac(6′)-Ii ant(4′)-Ia ant(6)-Ia aph(3′)-III erm(B)sat4 tet(L)-1 tet(M) van(A) van(Z)	11
Enterococcus gallinarum SF9117	aph(2′)-Ic van(C-1)erm(B)	12
Enterococcus casseliflavus UC73	aph(2′)-Id van(C)	53
Bacillus subtilis BR151	pPL708 [cat-86, ant(4′)-Ia]	21
Bacillus subtilis DSM4393	pC194 (cat-TC); tet(L)-2 aadK	DSMZ
Escherichia coli JIR1905	pWD212 (catB)	29
Escherichia coli JIR1597	pJIR235 (catQ)	3
Staphylococcus aureus NCTC50582	pC221 (catpC221); norA	NCTC
Listeria monocytogenes BM4293	dfr(D)	9; CIP
Bacillus subtilis EC101	pEC101 [erm(D), cat-TC]; tet(L)-2 aadK	35
Escherichia coli VA831	pVA831 [erm(F)]	35
Escherichia coli/pGERM	pGERM [erm(G)]	50
Staphylococcus warneri VC5	pVC5 [Inu(A)]; blaZ	41
Escherichia coli DB10	Inu(B)	7
Streptococcus salivarius Sp6	mef(A)erm(B)	51
Streptococcus pyogenes A498	tet(T)	14; CIP
Escherichia coli SC1	pSC1 [tet(W)]	4
Escherichia coli AGHD1	pAGHD1 [tet(Z)]	52
Enterococcus faecium 70/90	van(A) van(Z) aac(6′)-Ii tet(M) erm(B)	33; this study
Enterococcus faecalis DSM12956	van(B) sat4 ant(6)-Ia aph(3′)-III erm(B)	DSMZ
Enterococcus casseliflavus DSM20680	van(C)	DSMZ
Enterococcus gallinarum BM4174	van(C-1) tet(L)-1 tet(U)tet(M) ant(6)-Ia aph(3′)-III erm(B) sat4	20
Enterococcus faecium 10/96A	van(D4)	17
Enterococcus faecium N0-0072	van(D5) sat4 erm(B) ant(6)-Ia	6
Enterococcus faecalis BM4405	van(E)	22
Enterococcus faecalis BM4518	van(G) aac(6′)-Ie aph(2′)-Ia erm(B)	18
Staphylococcus aureus BM3093	pIP680 [vat(A), vgb(A), vga(A)]; norA	1; CIP
Staphylococcus aureus BM3318	vat(B) vga(B) erm(A)vga(A)v aac(6′)-Ie ant(4′)-Ia ant(6)-Ia ant(9)-Ia aph(2′)-Ia aph(3′)-III blaZ mecA sat4 norA	27; CIP
Staphylococcus cohnii BM10711	pIP1714 [vat(C), vgb(B)]; erm(C) mecA tet(K)	2
Lactobacillus fermentum ROT1	pLME300 [vat(E), erm(LF)]e	26

^aThe genes highlighted in bold are those used as references to validate the microarray. The other genes are those that were additionally detected in the reference strains with the microarray. Rif^r, rifampin resistance; Fus^r, fusidic acid resistance.

^bNCTC, National Collection of Type Cultures, Centre for Infections, Colindale, London, England; DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany; CIP, Collection de l'Institut Pasteur, Paris, France.

^cC. perfringens MLP26 was isolated from the intestines of a calf.

^dS. haemolyticus VPS617 was isolated from the milk of a cow with mastitis.

^eerm(LF) is an erm(T)-like gene which contains a 260-bp 3′ fragment identical to erm(B).

FIG. 2.

Microphotographs of microarrays hybridized with genomic DNAs of S. haemolyticus VPS617, C. perfringens MLP26, L. lactis K214, and E. faecium 70/90. Spots: 1 and 2, aac(6′)-Ie; 3 and 4, aac(6′)-Ii; 9 and 10, ant(6′)-Ia; 13 and 14, aph(2")-Ia; 21 and 22, aph(3′)-III; 25, norA; 32 and 33, blaZ; 36, cat-DPS; 37, cat-LM; 42 and 43, catDP; 47, catS; 51 and 52, dfr(A); 56 and 57, erm(B); 58 and 59, erm(C); 75 and 76, mdt(A); 77 and 78, mecA; 81 and 82, mph(C); 83 and 84, msr; 85 and 86, sat4; 87 and 88, tet(K); 93 and 94, tet(M); 95 and 96, tetA(P); 97 and 98, tet(S); 106 and 107, van(A); 120, van(Z); C, biotin position marker. The layout of the array and the description of the genes are presented in Fig. 1 and Table 3, respectively.

FIG. 3.

Microphotographs of microarrays hybridized with DNAs of E. faecalis (III and IV) and B. anthracis (I and II) before (I and III) and after (II and IV) transformation with plasmid pRE25. Spots: 9 and 10, ant(6)-Ia; 11 and 12, ant(9)-Ia; 21 and 22, aph(3′)-III; 28 and 29, bla1; 30 and 31, bla2; 56 and 57, erm(B); 85 and 86, sat4; 137, be_vgbB_539; C, biotin position marker. The layout of the array and the description of the genes are presented in Fig. 1 and Table 3, respectively.

All the strains were grown on tryptone soya agar containing 5% defibrinated sheep blood (Oxoid Ltd., Basingstoke, England) at 37°C unless otherwise indicated. C. perfringens was incubated under anaerobic conditions. L. lactis was grown on M17 agar (Oxoid) at 30°C. Escherichia coli and B. anthracis strains were grown on Luria-Bertani (LB) agar plates at 37°C. In liquid media, Enterococcus and Staphylococcus were grown in brain heart infusion broth, Bacillus strains in LB broth, and L. lactis in GM17 broth. C. perfringens was grown in Schädler broth (Oxoid) supplemented with 0.05% (vol/vol) l-cysteine at 37°C under anaerobic conditions. The assays involving B. anthracis strains were performed in a biosafety level 3 laboratory using avirulent strains.

Conjugal transfer.

The transfer of plasmid pRE25 (48) from E. faecalis RE25 to B. anthracis 4230 was performed by filter mating as described previously (42). The transconjugants were selected on LB agar plates containing 19.2 μg of the combination trimethoprim-sulfamethoxazole (1:5) (3.2 μg:16 μg) and 10 μg of erythromycin per milliliter. The transconjugants were identified by colony morphology and by the detection of both the cat_pIP501 and erm(B) resistance genes present on plasmid pRE25 by PCR.

Antimicrobial susceptibility tests.

The MICs of erythromycin, clindamycin, chloramphenicol, gentamicin, kanamycin, streptomycin, tetracycline, the combination quinupristin-dalfopristin, enrofloxacin, vancomycin, oxacillin, penicillin, the sulfonamide sulfisoxazole, trimethoprim, and the combination amoxicillin-clavulanic acid were determined in Mueller-Hinton broth using custom Sensititre susceptibility plates (Trek Diagnostics Systems, East Grinstead, England; MCS Diagnostics BV, Swalmen, The Netherlands) according to NCCLS guidelines (38).

PCR techniques.

The antibiotic resistance genes were amplified by PCR using Taq DNA polymerase in accordance with the supplier's directions (Roche Diagnostics, Basel, Switzerland) and using an annealing temperature of 54°C. The oligonucleotides used for PCRs are listed in Table 2.

TABLE 2.

Oligonucleotides used for the detection of resistance genes by PCR analysis

Gene	Primer name	Sequence (5′→3′)	Primer design reference or source
catpIP501	catF	CCTGCGTGGGCTACTTTA	This study
	catR	CAAAACCACAAGCAACCA
erm(B)	erm(B)-F	GAAAAGGTACTCAACCAAATA	13
	erm(B)-R	GTAAACAATTTAAGTACCATTACT
erm(C)	erm(C)-F	AATCGGCTCAGGAAAAGG	This study
	erm(C)-R	ATCGTCAATTCCTGCATG
mecA	mecA-1	AAAATCGATGGTAAAGGTTGGC	34
	mecA-2	AGTTCTGCAGTACCGGATTTGC
tet(K)	tet(K)-1	TTAGGTGAAGGGTTAGGTCC	This study
	tet(K)-2	GCAAACTCATTCCAGAAGCA
tetA(P)	tetA(P)F	CACAGATTGTATGGGGATTAGG	36
	tetA(P)R	CATTTATAGAAAGCACAGTAGC
tet(L)	tetLF	GTGAATACATCCTATTCA	This study
	tetLR	TTAGAAATCCCTTTGAGA	This study
tet(U)	tetU-F	ATGCAGCTAAGACGTGGC	This study
	tetU-R	TTATTCGGTATCACTTCTCTGTC
sat4	sat4-F	CGATAAACCCAGCGAACC	This study
	sat4-R	ATAACATAGTATCGACGG
aph(3′)-IIIa	aph3-III-F	CCGCTGCGTAAAAGATAC	This study
	aph3-III-R	GTCATACCACTTGTCCGC
ant(6)-Ia	ant6-I-F	AATTGTGACCCTTGAGGG	This study
	ant6-I-R	GGCATATGTGCTATCCAG
aac(6′)-Ie-aph(2′)-Ia	aac6-aph2-F	CAGAGCCTTGGGAAGATGAAG	54
	aac6-aph2-R	CCTCGTGTAATTCATGTTCTGGC
aac(6′)-Ii	aac(6)-Ii-F	GAGATACTGATTGGTAGC	This study
	aac(6)-Ii-R	TCTTCACTGACTTCTGCC
dfr(A)	dfrA-F	CCTTGGCACTTACCAAATG	This study
	dfrA-R	CTGAAGATTCGACTTCCC
blaZ	blaZ-F	CAGTTCACATGCCAAAGAG	This study
	blaZ-R	TACACTCTTGGCGGTTTC
mph(C)	mphC-F	CATTGAATGAATCGGGAC	This study
	mphC-R	TTCATACGCCGATTCTCC
van(E)	vanE-F	AGAATGGTGCTATGCAGG	This study
	vanE-R	TCATGATTTTCCACCGCC
msr(A)	msrA-F	GCTTAACATGGATGTGG	This study
msr(SA)	msrA-R	GATTGTCCTGTTAATTCCC
msr(SA′)
catD	catDPS-F	CCTTGYACATACAGYATGAC	This study
catP	catDPS-R	AACTTGRATKGCSARAGGAAG
catS
vgb(B)	vgb(B)-F	GTCTATTCCCGATTCAGG	This study
	vgb(B)-R	TGCAAACCATACGGATCC

Genomic DNA isolation.

Total DNA was obtained after half a loopful of bacterial cells was lysed in a lysis buffer (0.1 M Tris-HCl, pH 8.5, 0.05% Tween 20, 0.24 mg/ml proteinase K) for 1 h at 60°C, followed by a 15-min denaturation step at 95°C. The lysate was filtered through a 0.2-μm HT Tuffryn membrane (Acrodisc Syringe Filter; Pall Gelman Laboratory, Ann Arbor, MI). Alternatively, DNA was isolated using the guanidium thiocyanate method (45) and was extracted with phenol-chloroform. After addition of ammonium acetate, the cell lysates were purified with 1 volume of phenol:chloroform:isoamyl alcohol (49.5:49.5:1 [vol/vol/vol]). After 5 min of centrifugation at 14,000 rpm (Centrifuge Eppendorf 5415; Eppendorf AG, Hamburg, Germany), the water phase was treated with 1 volume of chloroform:isoamyl alcohol (49.5:1 [vol/vol]). The DNA was precipitated by the addition of 0.6 volume of isopropanol to the aqueous phase and then centrifuged. The DNA pellet was washed once with 80% ethanol and, after a 5-min centrifugation, was dried under a vacuum and resuspended in water.

DNA labeling.

The quality of each DNA preparation was assessed by agarose gel electrophoresis using 5 μl of the DNA sample and subsequent ethidium bromide staining. The concentration of DNA was determined spectrophotometrically at 260 nm. Genomic DNA (10 to 100 ng) was labeled by a randomly primed polymerization reaction using Sequenase, version 2.0 (USB Corporation, Cleveland, Ohio) and consisted of three cycles of enzymatic reactions. The labeling reactions were based on the method of Bohlander et al. (5). The protocol, as modified by the DeRisi Laboratory (University of California, San Francisco; www.microarrays.org/pdfs/Round_A_B_C.pdf), was altered as follows. Round A was used unmodified. During Round B, 25 instead of 35 PCR cycles were performed. In Round C, end concentrations of 0.1 mM (each) dATP, dCTP, and dGTP, 0.065 mM dTTP, and 0.035 mM biotin-16-dUTP (Roche Diagnostics) were used instead of the concentrations stated. Furthermore, 35 PCR cycles were run, and a fraction (10 to 20 μl) of the finished reaction product was used for hybridization analysis without further purification steps.

DNA array preparation.

The gene sequences and the derived specific oligonucleotides used to prepare the microarray are listed in Table 3. The oligonucleotides were designed from published DNA sequences using the Array Design Software Package (Clondiag Technologies, Jena, Germany). They consist of 26- to 33-mers with similar physicochemical parameters. The probes were spotted onto a 3- by 3-mm glass surface with a Microgrid II spotting machine (BioRobotics Inc./Apogent Discoveries Europe, Cambridge, England) as described previously (37). The glass substrates were incorporated into standard microreaction tubes. The layout of the spotted probes in the microarray is shown in Fig. 1.

TABLE 3.

Oligonucleotide sequences of the probes and characteristics and sources of the antibiotic resistance genes represented on the microarray

Spot no.	Identification	Sequence (5′→3′)	Genotype	Resistance phenotypea	Mechanism	GenBank accession no.	Gene positionb	Source
1	be_AAC6-Ie_144	ACATTATACAGAGCCTTGGGAAGATGAAGT	aac(6′)-Ie	Tob, Dbk, Ntl, Amk, Ast, 2′Ntl, 5-epi, Siso	Acetyltransferase	M18086	1725-2412	Staphylococcus aureus
2	be_AAC6-Ie_475	TTGCCAGAACATGAATTACACGAGGGCAAA
3	be_AAC6-Ii_71	CTTGGCCGGAAGAATATGGAGACAGCTCGG	aac(6′)-Ii	Tob, Dbk, Ntl, Amk, 2′Ntl, 5-epi, Siso	Acetyltransferase	L12710	169-717	Enterococcus faecium
4	be_AAC6-Ii_396	AGTGGCTTCCATCCAGAACCTTCGTGAACA
5	be_AAC6-Im_15	GCGAGTTTCCTTTCGCCCGATGAATGAGGA	aac(6′)-Im	Tob, Dbk, Ntl, Amk, 2′Ntl, 5-epi, Siso	Acetyltransferase	AF337947	1215-1751	Enterococcus faecium, E. coli
6	be_AAC6-Im_286	GCGATGGACCAATTTATCGGTGAGCCGGAA
7	be_ANT4-Ia_118	CTTGGTCGTCAGACTGATGGGCCCTATTCG	ant(4′)-Ia	Tob, Amk, Isp, Dbk	Adenylyltransferase	NC_001565	1390-2151	Staphylococcus, Bacillus
8	be_ANT4-Ia_197	ATGAATGGACAACCGGTGAGTGGAAGGTGG
9	be_ANT6-Ia_433	CCAAGCGCAAGGGAGTATGATGATTGCTGC	ant(6)-Ia	Sm	Adenylyltransferase	AF516335	14900-15808	Enterococcus, Staphylococcus
10	be_ANT6-Ia_576	ATCATGGAAGGTCGGCATCGAAACAGGCTT
11	be_ANT9-Ia_278	GGAGTGAAGTTGTCCCTTGGCAATATCCTCCA	ant(9)-Ia	Spc	Adenylyltransferase	X02588	331-1113	Staphylococcus aureus
12	be_ANT9-Ia_560	ACCCTAGCTCGAATGTGGCAAACAGTGACT
13	be_APH2-Ia_149	AAGACAAATGCACGGTTTAGATTATACAGA	aph(2′)-Ia	Km, Tob, Nm, Liv, GmC	Phosphotransferase	M18086	2494-3164	Staphylococcus aureus
14	be_APH2-Ia_292	TTATGGAAAGACTAAATGCAACAACAGTTT
15	be_APH2-Ib_317	AGGATGCCCTTGCATATGATGAAGCGACGT	aph(2′)-Ib	Km, Tob, Nm, Liv, GmC	Phosphotransferase	AF207840	122-1021	Enterococcus faecium, Escherichia coli
16	be_APH2-Ib_737	ATCAGCATAAGGCGCCGGAAGTAGCAGAAA
17	be_APH2-Ic_58	AGCATACAATCCGTCGAGTCGCTTGGTGAG	aph(2′)-Ic	Km, Tob, Nm, Liv, GmC	Phosphotransferase	U51479	196-1116	Enterococcus gallinarum
18	be_APH2-Ic_346	CTGGCGCTGCAACTTGCTGAGTTCATGAAT
19	be_APH2-Id_249	GCCATCAGAAACGTACCAAATGTCTTTCGCAGG	aph(2′)-Id	Km, Tob, GmC, 2′Ntl, 5-epi, Amk, Dbk	Phosphotransferase	AF016483	131-1036	Enterococcus casseliflavus
20	be_APH2-Id_354	GGCAGCTAAGGACCTGGCCCGATTTCTAAG
21	be_APH3-III_136	ACGGACAGCCGGTATAAAGGGACCACCTAT	aph(3′)-III	Km, Nm, Prm, Rsm, Liv, GmB	Phosphotransferase	M36771	293-1084	Staphylococcus aureus, Enterococcus faecalis
22	be_APH3-III_332	TTATCGAGCTGTATGCGGAGTGCATCAGGC
23	be_APH3-IVa_20	ATTGGCCGGAGGAACTTCTTGAGCTTCTCG	aph(3′)-IVa	Km, Nm, Prm, Rsm, But	Phosphotransferase	X03364	277-1065	Bacillus circulans
24	be_APH3-IVa_474	GGAGTACGATTGCACGCCGGAGGAATTGTA
25	be_NorA_426	AGGACCAGGGATTGGTGGATTTATGGCAGAA	norA	Nor,d Eno,d Ofl,d Cipd	Quinolones—efflux	D90119	478-1644	Staphylococcus aureus
26	be_aadK_61	ATCCGATTGGTCACTTTGGAAGGGTCACGT	aadK	Sm	Adenylyltransferase	M26879	90-944	Bacillus subtilis
27	be_aadK_175	GATCAGTGGCTCGAAATCTTTGGGAAGCGC
28	be_bla1_201	AGGTGTATATGCGATTGATACTGGTACAAA	bla1	Amp,c Amox/clav,c Pipc	Beta-lactamase	AF367983	626-1555	Bacillus anthracis
29	be_bla1_366	AGTGGATTATTCACCTGTTACAGAGAAACA
30	be_bla2_192	CGGAGAAGCAGTTCCTTCGAACGGTTTA	bla2	Amp,c Amox/clav,c Cfx,c Cpd, Cft, Caz, Cax	Beta-lactamase	AF367984	791-1561	Bacillus anthracis
31	be_bla2_246	ACTTGTCGATTCTTCTTGGGATGATAAGTT
32	be_blaZ_718	TTTGTTTATCCTAAGGGCCAATCTGAACCT	blaZ	Beta-lactams	Beta-lactamase	M60253	142-987	Enterococcus faecalis, Staphylococcus aureus
33	be_blaZ_811	AGTGAAACCGCCAAGAGTGTAATGAAGGAA
34	be_cat-86_367	AGCAGCAACCTATTTCCGAAACCTCATATGCCA	cat-86	Cm	Acetyltransferase	K00544	145-807	Bacillus pumilus
35	be_cat-86_605	TGAGGTGGCTTATTGAACATTGTGACGAGTGGT
36	be_cat-DPS_set_114	ATTTGCAGAAAGGATATGATTATTTGATTCCT	catD	Cm	Acetyltransferase	X15100	91-729	Clostridium difficile
			catP	Cm	Acetyltransferase	U15027	2953-3576	Clostridium perfringens
			catS	Cm	Acetyltransferase	X74948	1-492	Streptococcus pyogenes
37	be_cat-LM_set_135	AGGATATGAACTGTATCCTGCTTTGA	cat-LM	Cm	Acetyltransferase	X68412	1328-1975	Listeria monocytogenes
			catpC223	Cm	Acetyltransferase	AY355285	1000-1647	Staphylococcus aureus
			catpSCS5	Cm	Acetyltransferase	M58515	213-872	Staphylococcus haemolyticus
			catpSCS7	Cm	Acetyltransferase	M58516	90-719	Staphylococcus aureus
38	be_cat-TC_set_170	TGACAAGGGTGATAAACTCAAATACAGCT	cat-TC and catpC194	Cm	Acetyltransferase	U75299	657-1373	Lactobacillus reuteri
39	be_cat-TC_set_232	GGTTATTGGGATAAGTTAGAGCCACTTTAT		Cm	Acetyltransferase	NC_002013	1260-1910	Staphylococcus aureus
				Cm	Acetyltransferase	NC_002013	1260-1910	Staphylococcus aureus
40	be_catB_27	TCATTGGAGTAGAAAGCCATACTTTGAACA	catB	Cm	Acetyltransferase	M93113	145-804	Clostridium butyricum
41	be_catB_233	TAGGATATTGGGATAGCATGAATCCAAGCT
42	be_catDP_set_281	TTTCCAGCCTTTGGACTGAGTGTAAGTC	catP and catD	Cm	Acetyltransferase	U15027	2953-3576	Clostridium perfringens
43	be_catDP_set_416	CTATGATACCGTGGTCAACCTTCGATGG		Cm	Acetyltransferase	X15100	91-729
				Cm	Acetyltransferase	X15100	91-729
44	be_catQ_66	TGCGGTTAGGTGCACTTACAGTATGACTGCA	catQ	Cm	Acetyltransferase	M55620	459-1118	Clostridium perfringens
45	be_catQ_186	TAACCGTCACAAGGAGTTCCGCACCTGTTT
46	be_catS_228	CCTTTGGACACCATACATACCAGATTT	catS	Cm	Acetyltransferase	X74948	1-492	Streptococcus pyogenes
47	be_catS_383	GCTTTAATCTGAATTTGCAGAAAGGATATGA
48	be_catpXX_set_196	GTGTTTAGAACAGGAATTAATAGTGAGAATAA	catpSCS1	Cm	Acetyltransferase	M64281	208-855	Staphylococcus intermedius
			catpSCS6	Cm	Acetyltransferase	X60827	88-735	Staphylococcus aureus
			catpIP501	Cm	Acetyltransferase	X65462	208-855	Streptococcus agalactiae
			catpC221	Cm	Acetyltransferase	X02529	2267-2914	Staphylococcus aureus
			catpUB112	Cm	Acetyltransferase	X02872	208-855	Staphylococcus aureus
49	be_cfr_466	GGAATGGGTGAAGCTCTAGCCAACCGTCAA	cfr	Cm, Ffc	Unknown	AJ249217	570-1619	Staphylococcus sciuri
50	be_cfr_908	GAGAAGCAAACGAAGGGCAGGTAGAAGCCT
51	be_dfrA_20	TCGCTCACGATAAACAAAGAGTCATTGGGT	dfr(A)	Tmp	Dihydrofolate reductase	AF051916	2823-3308:r	Staphylococcus aureus
52	be_dfrA_172	AGACGTAACGTCGTACTCACTAACCAAGCT
53	be_dfrD_140	ACCTTCAATCAATCGGAAGGGCTTTACCTGACA	dfr(D)	Tmp	Dihydrofolate reductase	Z50141	94-582	Staphylococcus haemolyticus
54	be_ermA_193	TGTCAAGTGACTAAAGAAGCGGTAAACC	erm(A)	MLSB	Methylase	X03216	4551-5282:r	Staphylococcus aureus
55	be_ermA_590	AGTGGGTAAACCGTGAATATCGTGTTCT
56	be_ermB_112	ACAGGTAAAGGGCATTTAACGACGAAACTGGC	erm(B)	MLSB	Methylase	Y00116	262-999	Enterococcus faecalis
57	be_ermB_520	AAACTTACCCGCCATACCACAGATGTTCCAGA
58	be_ermC_149	AGAGGTGTAATTTCGTAACTGCCATTGA	erm(C)	MLSB	Methylase	J01755	2004-2738:r	Staphylococcus aureus
59	be_ermC_372	TTTAATCGTGGAATACGGGTTTGCTAAA	erm(C)	MLSB	Methylase
60	be_ermD_555	AGTGGACTCGGCAATGGTCAGAATAACACGA	erm(D)	MLSB	Methylase	M29832	430-1293	Bacillus licheniformis
61	be_ermF_231	TGCCCGAAATGTTCAAGTTGTCGGTTGTGA	erm(F)	MLSB	Methylase	M14730	241-1041	Bacteroides fragilis, Streptococcus
62	be_ermF_494	GTCCTGAAAGTTTCTTGCCACCGCCAACTG
63	be_ermG_98	ACATCTTTGAAATAGGTGCAGGGAAAGGTC	erm(G)	MLSB	Methylase	M15332	672-1406	Bacillus sphaericus
64	be_ermG_296	TTGGCAGCATACCTTACAACATAAGCACAA
65	be_ermQ_521	ACTTCCATCCCATGCCTAGTGTAGATTGCGT	erm(Q)	MLSB	Methylase	L22689	262-1035	Clostridium perfringens
66	be_ermT_104	TTGAGATTGGTTCAGGGAAAGGTCATTT	erm(T)	MLSB	Methylase	M64090	168-902	Lactobacillus reuteri
67	be_ermT_149	AAAGGTGTAATTATGTAACCGCCATTGAAA
68	be_ermX_231	GGCGGTCGAAGTGGTCCATGATGATTTCCT	erm(X)	MLSB	Methylase	M36726	296-1150	Corynebacterium diphtheriae
69	be_ermX_282	TCCCTGCGTCATTGTGGGAAACATTCCCTT
70	be_ermY_122	AAGGGCATTTCACACTAGAACTGGTTCA	erm(Y)	MLSB	Methylase	AB014481	556-1290	Staphylococcus aureus
71	be_ermY_258	ACAGTTTAAGTTCCCAAACAACAAAGCA
72	be_lnuA_115	AAACAACAAAGAGAACACAGAGATATAGAT	lnu(A)	Lm	Transferase	J03947	645-1130	Staphylococcus aureus
73	be_lnuA_218	ATTGGATGCCTTCACGTATGGAACTTAA
74	be_lnuB_169	TCATCCAACTGGTTGTTTGACGTAGCTCCGT	lnu(B)	Lm	Transferase	AJ238249	127-930	Enterococcus faecium
75	be_mdtA_355	CAGACCGCTCAGATGCCAACAGTCCAATCT	mdt(A)	MLSB, Tet, Min	Efflux	X92946	10534-11790	Lactococcus lactis
76	be_mdtA_571	GTCAGGATACCAGAAGTCGCTTCACAGGGC
77	be_mecA_871	AGCTCCAACATGAAGATGGCTATCGTGTCACA	mecA	Met, Oxa	Penicillin-binding protein 2′	AB096217	20340-22346	Staphylococcus aureus
78	be_mecA_1042	GCTCAGGTACTGCTATCCACCCTCAAACAGG
79	be_mef_set_39	AATATGGGCAGGGCAAGCAGTATCATTA	mef(A) and mef(B)	M	Major facilitator	U70055	314-1531	Streptococcus pyogenes
80	be_mef_set_193	GGTGTGCTAGTGGATCGTCATGATAGG		M	Major facilitator	U83667	1-1218	Streptococcus pneumoniae
				M	Major facilitator	U83667	1-1218	Streptococcus pneumoniae
81	be_mphC_281	CAGGTAAACCCGCAGCCACAATAGATCCAGA	mph(C)	M	Phosphorylase	AF167161	5665-6564	Staphylococcus aureus
82	be_mphC_555	CGAACTATGGCCTCGACATGCGACCATGAT
83	be_msr_set_289	ATGCATACAACCGACAGTATGAGTGGTG	msr(A) and msr(SA)	M, S	ATP-binding transporter	X52085	343-1809	Staphylococcus epidermidis
84	be_msr_set_655	GCTAAACGAAATCAAGCGCAACAAATGG	msr(SA)	M, S	ATP-binding transporter	AB016613	2005-3471	Staphylococcus aureus
			msr(SA′)	M, S	ATP-binding transporter	AB013298	487-1953	Staphylococcus aureus
			msr(B)	M, S	ATP-binding transporter	M81802	94-624	Staphylococcus xylosus
85	be_sat4_161	AGGATGAAGAGGATGAGGAGGCAGATTGCC	sat4	Sth	Acetyltransferase	AF516335	15805-16347	Enterococcus faecium
86	be_sat4_338	GCAAGGCATAGGCAGCGCGCTTATCAAT
87	be_tetK_259	AGTTTGAGCTGTCTTGGTTCATTGATTGC	tet(K)	Tet	Efflux	M16217	305-1684	Staphylococcus aureus
88	be_tetK_351	TGCTGCATTCCCTTCACTGATTATGGT
89	be_tetL_1_151	ACAAACTGGGTGAACACAGCCTTTATGT	tet(L)	Tet	Efflux	M11036	189-1565	Bacillus stearothermophilus
90	be_tetL_1_676	TCTTATCGTTAGCGTGCTGTCATTCCTG
91	be_tetL_2_269	GCTTAGGGTCGATCATTGGATTTGTTGG	tet(L)	Tet	Efflux	X08034	188-1564	Bacillus subtilis
92	be_tetL_2_504	GTCGTATTTGCTGCTTATTCCAACTGCA
93	be_tetM_1033	CTGCTGCAAACGACTGTTGAACCGAGCAAA	tet(M)	Tet, Min	Ribosomal protection	X04388	131-2050	Enterococcus faecalis
94	be_tetM_1308	TCCACCGAATCCTTTCTGGGCTTCCATTGG
95	be_tetAP_1193	TATCAGTGGCTCGCTTGAAGCTTGGATTGC	tetA(P)	Tet, Min	Ribosomal protection	L20800	207-2120	Clostridium perfringens
96	be_tetAP_1266	GGAGCACAAGCAGGGCAGATAGGAGCATTT
97	be_tetS_18	CGGTATCTTAGCACATGTTGATGCAGGA	tet(S)	Tet, Min	Ribosomal protection	L09756	447-2372	Listeria monocytogenes
98	be_tetS_776	CAGATGATGGTCAACGGCTTGTCTATGT
99	be_tetT_232	CACATGGATTTCATAGCCGAAGTTGAGC	tet(T)	Tet, Min	Ribosomal protection	L42544	478-2433	Streptococcus pyogenes
100	be_tetT_1326	GGTTCCACCAAATCCTTATTGGGCATCT
101	be_tetU_133	GCTGAGCCTTCTAATTGGTCGATAATTGCT	tet(U)	Tet, Min	Unknown	U01917	413-730	Enterococcus faecium
102	be_tetW_66	CCTGCTATATGCCAGCGGAGCCATTTCAGA	tet(W)	Tet, Min	Ribosomal protection	AJ222769	192-2111	Butyrivibrio fibrisolvens
103	be_tetW_455	TTATCATCAAGCAGACGGTGTCGCTGTCCC
104	be_tetZ_43	GTGATGCCGATCTTGCCTACCCTTCTCGAC	tet(Z)	Tet	Efflux	AF121000	11880-13034:r	Cornynebacterium glutamicum
105	be_tetZ_93	CATGATCCCACTGCACGTCGGACTACTGAC
106	be_vanA_192	CTATTCAGCTGTACTCTCGCCGGATAAA	van(A)	Van, Tei	Ligase	M97297	6979-8010	Enterococcus faecium
107	be_vanA_884	TACAAGATAACGGCCGCATTGTACTGAA
108	be_vanB_set_65	AATCCGCAATAGAAATTGCTGCGAACAT	van(B) and van(B2)	Van	Ligase	U00456	62-1090	Enterococcus faecalis
109	be_vanB_set_151	CTATGCAAGAAGCCATGTACGGAATGGG		Van	Ligase	AF310953	1-1029	Enterococcus faecium
				Van	Ligase	AF310953	1-1029	Enterococcus faecium
110	be_vanC-1_77	TCCAAGCTATTGACCCGCTGAAATATGA	van(C-1)	Van	Ligase	AF162694	1411-2442	Enterococcus gallinarum
111	be_vanC-1_497	ACCATGGATTCCCGATCTTTATCAAGCC
112	be_vanC_set_37	CCGGAATACACCGTTTCTTTAGCTTCAG	van(C-2) and van(C-3)	Van	Ligase	L29638	33-1085	Enterococcus casseliflavus
113	be_vanC_set_184	CAAGACACGTGGTTGTTGGATACGAAAC		Van	Ligase	AY033764	26-1078	Enterococcus flavescens
				Van	Ligase	AY033764	26-1078	Enterococcus flavescens
114	be_vanD4-5_183	CTATGCGGGATACCCGGCTGTGATTTCTCC	van(D4) and van(D5)	Van	Ligase	AF277571	1262-2293	Enterococcus faecium
115	be_vanD4-5_267	GCCTGTAGACGTGGTGCTTCCGATGATTCA		Van	Ligase	AY489045	4010-5041	Enterococcus faecium
				Van	Ligase	AY489045	4010-5041	Enterococcus faecium
116	be_vanE_298	GGAGGTTATGGTGAGAATGGTGCTATGCAGGG	van(E)	Van	Ligase	AF430807	2976-4034	Enterococcus faecalis
117	be_vanE_357	TGTAGGTTGTGGTATCGGAGCTGCAGCAAT
118	be_vanG_362	TGGCAGGAATACCTGTTGTTGGCTGCGATA	van(G)	Van	Ligase	AF253562	3715-4764	Enterococcus faecalis
119	be_vanG_549	ACCTGTTCGTGCAGGCTCTTCCTTTGGAAT
120	be_vanZ_328	ACAAATACTGTTGGAGGCTTTCTTGGACTG	van(Z)	Tei	Unknown	M97297	10116-10601	Enterococcus faecium
121	be_vatA_288	TCATCTATTCAGGATGGGTTGGGAGAAGT	vat(A)	SA	Transferase	L07778	258-917	Staphylococcus aureus
122	be_vatA_429	AATCATTGCTGCAGAAGCTGTTGTCAC
123	be_vatB_9	TGGCCCTGATCCAAATAGCATATATCCACA	vat(B)	SA	Transferase	U19459	67-705	Staphylococcus aureus
124	be_vatB_109	ACTTACTATTCCGATGTTAACGGAGCTGAA
125	be_vatC_474	TTCAGTTGTTGGCGGTAATCCTTCACGATT	vat(C)	SA	Transferase	AF015628	1307-1945	Staphylococcus aureus
126	be_vatC_552	AAGGTGGTGGGACCTAGAGATAGAGACGAT
127	be_vatD_453	GCCATACATGTTAGCTGGAGGAAATCCT	vat(D)	SA	Transferase	L12033	162-791	Enterococcus faecium
128	be_vatE_349	TGTAGTCGGAAATGACGTGTGGTTTGGGCA	vat(E)	SA	Transferase	AF139725	63-707	Enterococcus faecium
129	be_vatE_409	AGGTGACGGTGCCATTATCGGAGCAAATAGT
130	be_vgaA_834	CTCGGGTACAATTGAAGGACGGGTATTGTGGA	vga(A)	SB	ATP-binding transporter	M90056	909-2477	Staphylococcus aureus
131	be_vgaA_886	CGCGGAGGAGACAAGATGGCAATTATCGGA
132	be_vgaB_569	TGCTTCTACGAAAGCAACAAGAAGAATACG	vga(B)	SB	ATP-binding transporter	U82085	629-2287	Staphylococcus aureus
133	be_vgaB_649	GAGAATAAGGCGCAAGGAATGATTAAGCCC
134	be_vgbA_142	ACAGAGTACCCACTACCGACACCAGATGCA	vgb(A)	SB	Hydrolase	M20129	641-1540	Staphylococcus aureus
135	be_vgbA_281	TGCCTAACCCAGATTCAGCACCCTACGGTA
136	be_vgbB_273	ATATCCATTGCCACAGCCGGATTCTGGTCC	vgb(B)	SB	Lactonase	AF015628	399-1286	Staphylococcus cohnii
137	be_vgbB_539	CAAATGCAGCGGCTCCAGTGGGTATCACTA
138	1×Spottingpuffer
139	Marken-Mix

^aAminoglycosides: Tob, tobramycin; Dbk, dibekacin; Ntl, netilmicin; Amk, amikacin; 2′Ntl, 2′-N-ethylnetilmicin; 5-epi, 5-episisomicin; Siso, sisomicin; Isp, isepamicin; Sm, streptomycin; Spc, spectinomycin; Ast, Astromicin (fortimicin); Km, kanamycin; Nm, neomycin; Liv, lividomycin; GmB, gentamicin B; GmC, gentamicin C; Prm, paromomycin; Rsm, ribostamycin; But, butirosin; The phenotypes were found in references 49 and 56. Fluoroquinolones: Nor, norfloxacin; Eno, enoxacin; Ofl, ofloxacin; Cip, ciprofloxacin. Beta-Lactams and Cephem: Amp, ampicillin; Amox/clav, amoxicillin-clavulanic acid; met, methicillin; Oxa, oxacillin; Ctx, cefoxitin; Cpd, cefpodoxime; Cft, cefotaxime; Caz, ceftazidime; Cax, ceftriaxone. Phenicols: Cm, chloramphenicol; Ffc, florfenicol. Folate pathway inhibitors: Tmp, trimethoprim. MLS: M, macrolides, L, lincosamides; S_B, streptogramins B; S_A, streptogramin A; Lm, lincomycin. Tetracyclines: Tet, tetracycline, Min, minocycline. Glycopeptides: Van, vancomycin; Tei, teicoplanin. Others: Sth, streptothricin.

^b:r, the gene is found on the complementary strand.

^cWhen expressed in E. coli (10).

^dWhen overexpressed in S. aureus (32).

FIG. 1.

Distribution layout of the oligonucleotides on the microarray. The detectable genes are italicized, and details are given in Table 3. The following gene abbreviations include a family of genes: catDPS detects catD, catP, and catS; catDP detects catD and catP; catpXX detects cat_pC221, cat_pUB112, cat_pSCS1, cat_pSCS6, and cat_pIP501; cat-LM detects cat-LM, cat_pSCS5, and cat_pSCS7; cat-TC detects cat-TC and cat_pC194; mef detects mef(A) and mef(B); msr detects msr(A), msr(SA), msr(SA′), and msr(B); van(B) detects van(B) and van(B2); van(C) detects van(C-2) and van(C-3). The position controls (ctrl) consist of biotin-labeled oligonucleotides.

DNA hybridization and detection.

The microarray tubes were positioned in a Thermomixer comfort (Eppendorf AG, Hamburg, Germany) and washed twice with QMT hybridization buffer (Quantifoil, Jena, Germany) for 5 min at 30°C and 550 rpm. The labeled genomic DNA (10 to 20 μl) was mixed with QMT hybridization buffer to obtain a final volume of 100 μl, denatured for 5 min at 94°C, kept on ice for 3 min, and hybridized for 1 h at 60°C and 550 rpm. The arrays were washed in 500 μl 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate, pH 7.0) containing 0.2% sodium dodecyl sulfate solution for 5 min at 30°C and 550 rpm, in 500 μl 2× SSC for 5 min at 20°C and 550 rpm, and in 500 μl 0.2× SSC for 5 min at 20°C and 550 rpm. The arrays were blocked with 100 μl 6× SSPE (60 mM sodium phosphate, 1.08 M NaCl, 6 mM EDTA, pH 7.4) solution containing 0.005% Triton X-100 and 2% (wt/vol) milk powder for 15 min at 30°C and 550 rpm; then 100 μl of conjugate buffer (6× SSPE, 0.005% Triton X-100, 100 pg/μl of streptavidin-peroxidase conjugate [Clondiag]) was added, and the array tubes were incubated for 15 additional minutes at 30°C and 550 rpm. The arrays were washed in 2× SSC-0.01% Triton X-100 at 30°C for 5 min and in 2× SSC and then 0.2× SSC for 5 min at 20°C. The arrays were kept at 20°C in the last washing solution until visualization. The hybridized probes were enhanced using 100 μl of tetramethylbenzidine peroxidase substrate (Clondiag). The peroxidase staining procedure and the online detection were performed in an atr01 array tube reader (Clondiag) for 15 min at 25°C according to the manufacturer's specifications. The hybridization analyses were performed in duplicate.

The data were analyzed using Iconoclust software (Clondiag). Signal intensity and local background were measured for each spot on the array. Extinctions of local backgrounds were subtracted from extinctions of spots. A threshold was determined so that each value above zero was considered a signal. Resulting values below 0.1 were considered negative (−), and those above 0.3 were considered positive (+). Values between 0.1 and 0.3 were regarded as ambiguous (+/−).

RESULTS

Construction of the gene array.

A total of 90 resistance genes that had already been characterized in gram-positive bacteria were selected from the GenBank database to be represented on the microarray (Table 3). Only extrinsic potentially transmissible resistance genes were included. Antibiotic resistance due to single-base mutations of the target genes could not be considered, since highly stringent annealing temperatures would be necessary to obtain a specific hybridization with these oligonucleotides. Each antibiotic resistance gene or group of genes was represented on the array by two different oligonucleotides situated apart from each other within the protein coding sequence. The oligonucleotides were chosen according to their high specificity for the related resistance genes. Consensus sequences were used to design the oligonucleotides specific for several subtypes of resistance genes sharing DNA identities higher than 89%. Hence, the chloramphenicol acetyltransferase genes catD and catP (99.5% DNA identitity) were represented by the catDP oligonucleotides be_catDP_set_281 and be_catDP_set_416, the genes cat-LM, cat_pC223, cat_pSCS5, and cat_pSCS7 (DNA identity, ≥90.6%) by the oligonucleotide be_cat-LM_set_135, the genes cat-TC and cat_pC194 (99.7%) by the cat-TC oligonucleotides cat-TC_set_170 and cat-TC_set_232, the genes cat_pC221, cat_pUB112, cat_pSCS1, cat_pSCS6, and cat_pIP501 (≥96.9%) by the oligonucleotide be_catpXX_set_196, the macrolide efflux genes mef(A) and mef(E) (89.9%) by the mef oligonucleotides be_mef_set_39 and be_mef_set_193, the vancomycin resistance genes van(B) and van(B2) (95.6%) by the vanB oligonucleotides be_vanB_set_65 and be_vanB_set_151, the van(C-2) and van(C-3) genes (98.7%) by the vanC oligonucleotides be_vanC_set_37 and be_vanC_set_184, the van(D4) and van(D5) genes (93.6%) by the be_vanD4-5_183 and be_vanD4-5_267 oligonucleotides, and the ATB-binding transporter genes msr(A), msr(SA), msr(SA′), and msr(B) (≥98.5%) by the msr oligonucleotides be_msr_set_289 and be_msr_set_655 (Table 3). For a few genes, including nor(A), cat-LM, dfr(D), erm(Q), lnu(B), tet(U), van(Z), vat(D), and the genes of the catpXX family, only one oligonucleotide could be designed. The bifunctional aac(6′)-Ie-aph(2")-Ia gene has been considered as two individual targets for the microarray design, since these genes have also been shown to confer resistance when expressed separately (47). Additionally, the aac(4‴) gene, mediating aminoglycoside resistance in S. aureus, was described as a functional aac(6′)-Ie-aph(2)-Ia gene lacking the aph(2)-Ia site (25). The sequence of each oligonucleotide, with the corresponding genes and the specified phenotypes, is given in Table 3. The microarray possesses five position controls (see Fig. 2 and 3), which consist of biotin-labeled oligonucleotides. Certain antibiotic resistance genes, such as the tetracycline resistance gene tet(O) (GenBank accession no. M18896), the streptomycin resistance gene str (X06627), the macrolide resistance genes mre(A) (U92073) and msr(C) (AJ243209 and AF313494), and the vancomycin resistance genes van(D1) (AF130997), van(D2) (AF153050), and van(D3) (AF175293), were omitted and will be included in a second generation of the microarray.

Detection of resistance genes in Staphylococcus.

S. haemolyticus VPS617, isolated from mastitis milk, showed resistance to erythromycin (MIC, >32 μg/ml), tetracycline (MIC, 32 μg/ml), gentamicin (MIC, 32 μg/ml), kanamycin (MIC, >128 μg/ml), streptomycin (MIC, 64 μg/ml), sulfisoxazole (MIC, 1,024 μg/ml), trimethoprim (256 μg/ml), oxacillin (MIC, 32 μg/ml), and penicillin (MIC, 8 μg/ml) and was susceptible to enrofloxacin (MIC, <0.125 μg/ml), cephalotin (MIC, <1 μg/ml), and an amoxicillin-clavulanic acid combination of 2:1 (MICs, <2 and <1 μg/ml, respectively). The MICs were compared with the genes detected by the microarray (Table 4). Hybridization analysis of VPS617 genomic DNA with the microarray revealed 12 acquired antibiotic resistance genes. The erythromycin resistance could be explained by the presence of an erm(C) gene conferring resistance to antibiotics including macrolides, lincosamides, and type B streptogramins (MLS_B), an msr gene (conferring resistance to macrolides and streptogramins B), and an mph(C) gene that inactivates macrolides. S. haemolyticus was shown to harbor the tetracycline resistance gene tet(K), the aminoglycoside resistance genes aph(3′)-III, aph(2")-Ia, aac(6′)-Ie, and ant(6)-Ia, the streptothricin resistance gene sat4, the trimethoprim-resistant dihydrofolate reductase gene dfr(A), the beta-lactamase gene blaZ, and the methicillin (oxacillin) resistance gene mecA (Fig. 2). The staphylococcal housekeeping gene norA was also detected. However, this gene is not involved in acquired or transmissible antibiotic resistance. The gene norA encodes a membrane-associated protein which causes resistance to hydrophilic quinolones and a variety of other substances such as ethidium bromide, cetrimide, benzalkonium chloride, tetraphenylphosphonium bromide, and acriflavine only when overexpressed (32).

TABLE 4.

Relationship between the genes detected in S. haemolyticus, C. perfringens, L. lactis, E. faecium, E. faecalis and B.anthracis using the microarray and their MICs as determined by broth microdilution

Strain	Genes detected	Antibiotics tested	MIC (μg/ml)a	Susceptibility breakpointb (μg/ml)
S. haemolyticus VPS617	emr(C),mph(C), msr	Erythromycin	>32	≤0.5
	tet(K)	Tetracycline	32	≤4
	aac(6′)-Ie-aph(2′)-Ia	Gentamicin	32	≤4
	aph(3′)-III	Kanamycin	>128	≤16
	ant(6)-Ia	Streptomycin	64	≤8c
	mecA	Oxacillin	32	≤0.25
	blaZ	Penicillin	8	≤0.12
	dfr(A)	Trimethoprim	256	≤8
	sat4	None	ND	NA
	norAd	Norfloxacin	<0.125	≤4
C. perfringens MLP26	erm(B)	Erythromycin	>32	NA
		Clindamycin	16	≤2
	tetA(P)	Tetracycline	32	≤4
	catP	Chloramphenicol	64	≤8
	aph(3′)-III	Kanamycin	ND	NA
	ant(6)-Ia	None	ND	NA
	sat4	None	ND	NA
L. lactis K214	tet(S)	Tetracycline	>128	≤2e
	cat-LM	Chloramphenicol	32	≤4e
	mdt(A)	Erythromycin	1	≤0.25e
E. faecium 70/90	tet(M)	Tetracycline	64	≤4
	erm(B)	Erythromycin	>32	≤0.5
	aac(6′)-Ii	None	ND	NA
	van(A)	Vancomycin	>128	≤4
E. faecalis JHRE25-2	erm(B)	Erythromycin	>128	≤0.5
		Clindamycin	>32	≤2c
	aph(3′)-III	Kanamycin	>128	64f
	ant(6)-Ia	Streptomycin	>128	64f
	sat4	None	ND	NA
	Not detected	Chloramphenicol	64	≤8
B. anthracis BR4253	erm(B)	Erythromycin	>128	≤0.5
		Clindamycin	>32	≤0.5
	aph(3′)-III	Kanamycin	1	1f
	ant(6)-Ia	Streptomycin	1	1f
	sat4	None	ND	NA
	Not detected	Chloramphenicol	32	≤8
	bla1 bla2	Penicillin	<0.12	≤0.12

^aND, not determined.

^bUnless otherwise indicated, the breakpoints given are those proposed in the NCCLS guidelines (38). NA, not available.

^cBreakpoint proposed by the Société Française de Microbiologie (http://sfm.asso.fr).

^dConfers resistance only when overexpressed (32).

^eThe breakpoints for Lactococcus are those defined by the NCCLS for Streptococcus spp. other than Streptococcus pneumoniae.

^fMIC for the susceptible strains used as recipients (Table 5).

Detection of resistance genes in Clostridium.

C. perfringens MLP26 was isolated from the intestines of a calf. The strain showed resistance to tetracycline (MIC, 32 μg/ml), erythromycin (MIC, >32 μg/ml), clindamycin (MIC, 16 μg/ml), chloramphenicol (MIC, 64 μg/ml), and kanamycin (MIC, >128 μg/ml), and the MICs were compared to the genotype revealed by the microarray (Table 4). The following genes were detected in C. perfringens MLP26: the aminoglycoside resistance genes aph(3′)-III and ant(6)-Ia, the tetracycline resistance gene tetA(P), the streptothricin resistance gene sat4, the MLS_B resistance gene erm(B), and a chloramphenicol acetyltransferase gene, one of the closely related catD, catP, and catS genes (Fig. 2). Further differentiation of the latter by PCR and sequence analysis revealed the gene catP (see below).

Detection of resistance genes in Lactococcus.

L. lactis K214 harbored plasmid pK214, which confers resistance to chloramphenicol (MIC, 32 μg/ml), tetracycline (MIC, >128 μg/ml), and streptomycin (MIC, >128 μg/ml) and decreased susceptibility to erythromycin (MIC, 1 μg/ml) (44). The tetracycline resistance gene tet(S), the chloramphenicol acetyltransferase gene cat-LM, and the multidrug transporter gene mdt(A), involved in erythromycin efflux, could be detected by the corresponding oligonucleotide targets in the microarray (Fig. 2). The streptomycin resistance gene str, present on plasmid pK214, was not revealed by the hybridization, since oligonucleotides specific to this target gene were not included on the array. The relationship between the phenotype and the genotype of L. lactis K214 is presented in Table 4.

Detection of resistance genes in vancomycin-resistant E. faecium.

Microarray hybridization of E. faecium 70/90 confirmed the presence of the vancomycin and teicoplanin resistance genes van(A) and van(Z) in this clinical isolate. Additional resistance genes, such as the tetracycline resistance gene tet(M), the MLS_B resistance gene erm(B), and the aminoglycoside resistance gene aac(6′)-Ii, were identified (Fig. 2). The antimicrobial susceptibility test for this strain confirmed the phenotypic expression of the genes detected (Table 4). E. faecium 70/90 showed resistance to vancomycin (MIC, >128 μg/ml), tetracycline (MIC, 64 μg/ml), erythromycin (MIC, >32 μg/ml), and clindamycin (MIC, >32 μg/ml). The MICs of the aminoglycosides that can be affected by aac(6′)-Ii, e.g., amikacin and tobramycin (16), were not determined.

Detection of the genes present on the multidrug resistance plasmid pRE25.

Plasmid pRE25 was used as a gene target for the detection of antibiotic resistance genes in both E. faecalis and B. anthracis strains. In E. faecalis JHRE25-2, plasmid pRE25 confers resistance to erythromycin, clindamycin, chloramphenicol, and the aminoglycoside antibiotics kanamycin and streptomycin (Table 5). The resistance of strain JHRE25-2 to these antibiotics results from the presence of genes aph(3′)-III, ant(6)-Ia, erm(B), and sat4 on plasmid pRE25 (48) (Table 4). They could be detected with the microarray (Fig. 3). No signal was obtained with the chloramphenicol acetyltransferase gene target catpXX, although cat_pIP501 is present in E. faecalis JHRE25-2, as confirmed by PCR using genomic DNA.

TABLE 5.

Susceptibilities of E. faecalis, B. anthracis, and transconjugants containing plasmid pRE25 to different antibiotics

Strain	MIC (μg/ml)a of:
	ERY	CLI	CHL	KAN	STR
E. faecalis RE25	>128	>32	64	>128	>128
E. faecalis JH2-2	<0.25	2	<1	64	64
E. faecalis JHRE25-2	>128	>32	64	>128	>128
B. anthracis 4230	1	<0.25	4	1	1
B. anthracis BR4253	>128	>32	32	1	1

^aERY, erythromycin; CLI, clindamycin; CHL, chloramphenicol; KAN, kanamycin; STR, streptomycin.

Detection of resistance genes in B. anthracis.

The avirulent B. anthracis strain 4230, which lacks the virulence plasmid pXO1 and contains the spectinomycin resistance gene ant(9)-Ia instead of the capsule genes on pXO2, was used as a model for the detection of resistance genes in B. anthracis. Microarray-based analysis of B. anthracis 4230 DNA revealed the presence of the β-lactamase genes bla1 and bla2 and the spectinomycin resistance gene ant(9)-Ia (Fig. 3). It should be noted that both the bla1 and bla2 genes are endogenous to B. anthracis but are not expressed (10). One hybridization signal was obtained with only one of the two oligonucleotides specific to the vgb(B) gene. The vgb(B) gene, however, could not be amplified from B. anthracis by PCR, confirming that this gene was not present in the strain.

Plasmid pRE25 was then transferred from E. faecalis RE25 to B. anthracis 4230 by conjugation in order to obtain B. anthracis strains carrying acquired resistance genes. The MICs of different antibiotics were determined for the donor strain E. faecalis RE25, the recipient strain B. anthracis 4230, and the resulting B. anthracis transconjugants by a broth microdilution test (Table 5). The MIC for the B. anthracis transconjugant BR4253 was then compared to the antibiotic resistance genes detectable by microarray hybridization (Table 4). In the B. anthracis transconjugant BR4253, plasmid pRE25 conferred resistance only to erythromycin, clindamycin, and chloramphenicol, not to kanamycin or streptomycin, although the aminoglycoside resistance genes aph(3′)-III and ant(6)-Ia could be detected by DNA hybridization with the microarray (Fig. 3). The resistance genes erm(B) and sat4 of plasmid pRE25, as well as the B. anthracis genes bla1, bla2, and ant(9)-Ia, were also detected. As with E. faecalis JHRE25-2, the cat_pIP501 gene of pRE25 was not detected in B. anthracis BR4253 by microarray hybridization (Fig. 3) but could be amplified by PCR.

Specificity testing of the microarray using reference strains.

The specificity and sensitivity of the oligonucleotides present on the microarray in detecting antibiotic resistance genes were tested using reference strains that harbor specific antibiotic resistance genes (Table 1). Twenty-nine strains in addition to those presented in Fig. 2 and 3 were hybridized with the microarray. Each of these strains harbors 1, 2, or 3 reference antibiotic resistance genes, for a total of 43 genes. All of these genes could be detected with the specific oligonucleotides present on the microarray, with the exception of the oligonucleotide be_vanC_set_184, which did not hybridize with the van(C)-carrying Enterococcus casseliflavus strains UC73 and DSM20680. The van(C) gene was revealed in these strains with a second oligonucleotide, be_vanC_set_37. The hybridization analyses of the reference strains revealed, besides the reference antibiotic resistance genes, the presence of additional antibiotic resistance genes (Table 1). Overall, a total of 125 oligonucleotides (out of 137) were tested by hybridization of 71 different antibiotic resistance genes.

Confirmation of the resistance genes by PCR.

The resistance genes detected in the field strains S. haemolyticus VPS617 and C. perfringens MLP26 and in the transconjugants E. faecalis JHRE25-2 and B. anthracis BR4253 by the microarray hybridizations were confirmed by PCR amplification using specific oligonucleotide primers situated apart from the hybridization oligonucleotides. The chloramphenicol acetyltransferase determinant of C. perfringens MLP26 was determined by PCR using primers catDPS-F and catDPS-R, which allowed the amplification of either catD, catP, or catS, and by sequence analysis. The tet(L) and tet(U) genes of Enterococcus gallinarum BM4174 and the aac(6′)-Ii gene of E. faecium 70/90 were first detected with the microarray, then confirmed by PCR and sequence analysis, and used as references. The PCR primers are listed in Table 2.

DISCUSSION

The microarray was designed with oligonucleotides of 26 to 33 bases. This enabled us to find consensus sequences within a family of genes sharing high DNA identities (Table 3). The consensus sequences do not allow for identification of the few different bases which distinguish these genes but indicate to which family they belong. The exact identification of these genes can then be performed using either a more specialized array, PCR, or sequencing if required. The use of oligonucleotides instead of PCR products as used by Call et al. (8) facilitated and accelerated the elaboration of the microarray, since no PCRs and no template DNA of reference strains were necessary. The oligonucleotides show higher hybridization specificity than PCR products and allow a shorter hybridization time. They were found to be highly specific for the target genes by hybridization at a temperature of 60°C in 1 h only.

Two different oligonucleotides were chosen for each resistance gene, with the exception of nine genes where only a single specific oligonucleotide could be found. The use of two different oligonucleotides for the detection of resistance genes has the advantage of increased specificity and sensitivity of the method. Hence, a hybridization signal was obtained with B. anthracis DNA (Fig. 3) that was shown to be free of the vgb(B) gene by PCR but that hybridized with the oligonucleotide be_vgbB_539 and not with be_vgb_273. Similarity searches of nucleotide data banks using the BLAST search for short, nearly exact matches (National Center for Biotechnology Information) revealed an exact match of 14 nucleotides for the oligonucleotide be_vgbB_539 with genomic DNA of B. anthracis strains. These 14 nucleotides may have hybridized to B. anthracis DNA despite the use of a high hybridization temperature of 60°C. Lack of sensitivity was found with two probes only: the probe be_vanC_set_184, which could not detect the van(C) gene in either of the E. casseliflavus strains UC73 and DSM20680, and the probe be_catpXX_set_196, which could not detect the cat_pIP501 gene of plasmid pRE25 (Fig. 3). However, the be_catpXX_set_196 target was able to detect a PCR product of the cat_pIP501 gene labeled with biotin-16-dUTP as well as the cat_pC221 of plasmid pC221 (Table 1). This demonstrated that the be_catpXX_set_196 oligonucleotide was effectively spotted on the microarray and indicated that the detection of the cat_pIP501 may depend on the labeling procedure. Additionally, formation of DNA hairpins and/or auto-annealing of the randomly amplified DNA fragment may also affect the hybridization procedures. Further investigations are now necessary to elucidate this technical gap. In an effort to obtain at least two oligonucleotide targets for each antibiotic resistance gene, new sequence alignments are currently under way.

The specificity and sensitivity of the microarray in detecting resistance genes was tested with gram-positive bacteria of eight different genera (Bacillus, Clostridium, Enterococcus, Lactococcus, Lactobacillus, Listeria, Staphylococcus, and Streptococcus) harboring different antibiotic resistance genes and with resistance genes cloned into E. coli vectors. The hybridization analysis using genomic DNAs of these bacteria enabled verification of the sensitivity of 125 of the 137 oligonucleotide targets and identification of 71 resistance genes. All the genes known to be present in the reference strains listed in Table 1, except cat_pIP501 in E. faecalis, could be recovered and identified with the microarray. The microarray also identified additional genes that were present in the reference strains. Additionally, it identified 12 resistance genes involved in the multidrug resistance of S. haemolyticus VPS617 and 8 genes in C. perfringens MLP26. The antibiotic resistance phenotypes correlated in both strains with the genes detected.

The resistance gene array allowed us to characterize in less than 24 h a collection of resistance genes in two important pathogenic bacterial species of animal origin, namely, S. haemolyticus and C. perfringens. For example, the erythromycin resistance in S. haemolyticus could be explained by the presence of three different genes [erm(B), msr, and mph(C)] known to be involved in resistance to macrolide antibiotics (Fig. 2 and Table 4). This is, to our knowledge, the first report of the detection of sat4, aph(3′)-III, and ant(6)-Ia genes in a C. perfringens strain, suggesting the presence of a Tn5405-like structure. Transposon Tn5405 carries an ant(6′)-Ia-sat4-aph(3′)-III cluster which is widespread among staphylococci and enterococci (19, 48, 55) and might have been transferred from one of these species to C. perfringens. This demonstrated the efficiency of this technology to rapidly characterize antibiotic resistance genes in strains whose resistance genotype was completely unknown. Furthermore, automation of the hybridization procedures is conceivable, since all the hybridization steps are performed in the same tube. The microarray technology will then facilitate and speed the analysis of antibiotic resistance genes.

The microarrays have the particular advantage of detecting the presence of antibiotic resistance genes that are not phenotypically expressed in vitro. Indeed, B. anthracis BR4253 does not phenotypically express either of the aminoglycoside resistance genes aph(3′)-III and ant(6)-Ia present on plasmid pRE25. The expression of these genes might be repressed in B. anthracis, as is the case for both β-lactamase genes bla1 and bla2, whose expression is not sufficient to confer penicillin resistance on B. anthracis (10).

Antibiotic-resistant bacteria today are present in a large variety of ecological niches such as hospitals, the environment, and food. The microarray presented in this study has been shown to be an efficient prototype that allows for rapid screening of resistance genes in gram-positive bacteria. This technology should rapidly find application in surveillance programs of antibiotic resistance genes, industry, and research in order to limit the emergence and spread of antibiotic resistance genes and extend the therapeutic action of existing drugs.