Abstract
The purpose of this study is to evaluate Lactobacillus paracasei SMB092 as a prophylactic agent for oral pathogens. We examined the physical interaction of SMB092 with a host by identifying the presence of mucus-binding (MuB) protein domains and the capacity of the mucin binding. We determined the role of heat-killed SMB092 in host oral immunity by quantifying the mRNA levels of β-defensins (BDs), Toll-like receptors (TLRs), and their cofactors (CD14/CD36) in normal human oral keratinocytes (HOK-16B cells). To assess the clinically relevant oral health effects of heat-killed SMB092, the growth of Porphyromonas (P.) gingivalis and the production of a volatile sulfur compound (H2S) were also measured in the filtered condition media (FCM) obtained from its cultures with HOK-16B cells. SMB092 possessed 14 putative MuB protein domains and was attached to mucin. Significant amounts of hBD1/2 and TLR2/6 were expressed in heat-killed SMB092-treated HOK-16B cells. The specific neutralization of TLR2 attenuated the expression of hBD1/2 and CD14/CD36. The FCM inhibited the growth of P. gingivalis and the production of H2S. Our data indicate that heat-killed SMB092 may contribute to a healthy oral microbiome as an immune stimulant in the production of BDs via the activation of the TLR2/6 signaling pathway.
Keywords: Lactobacillus paracasei, oral epithelial cell, mucin-binding protein domain, β-defensin, toll-like receptor, Porphyromonas gingivalis, hydrogen sulfide
1. Introduction
Periodontal disease is one of the most prevalent oral diseases, posing a significant economic and health burden to people around the world. As people age, one of the main reasons for the incidence of periodontal diseases such as gingivitis and periodontitis is pathogenic bacteria [1]. Halitosis refers to odors originating from the mouth and adjacent organs, causing many people discomfort in their daily lives; pathogenic bacteria are involved in producing the main components of halitosis, volatile sulfur compounds (VSCs). VSCs include hydrogen (H2S), methyl mercaptan (CH3SH), and dimethyl sulfide (CH3SCH3). Oral pathogens commonly found in the mouths of patients with periodontal disease and halitosis include Porphyromonas (P.) gingivalis, Fusobacterium (F.) nucleatum, and Prevotella intermedia, which are Gram-negative and anaerobic bacteria [2,3,4].
The long-term use of antibiotics and antiseptics, commonly used as periodontal pathogen treatments, has been associated with side effects such as bacterial resistance and hypersensitivity [5]. As an alternative, there has been significant research into natural substances and probiotics. In particular, probiotics, mainly lactic acid-producing bacteria, have been reported to secrete antimicrobial substances, such as hydrogen peroxide, organic acids, fatty acids, and bacteriocins, that inhibit pathogenic bacteria such as P. gingivalis and F. nucleatum [6,7]. Furthermore, probiotics with various adhesion proteins, including mucus-binding (MuB) protein domains, are able to bind to the mucus layer for competitive colorization with pathogenic bacteria in establishing the microbiome homeostasis of host oral cavities and guts [8,9]. It has therefore been emphasized that probiotics typically exert beneficial effects on a host by being active and alive, in addition to colonizing oral as well as intestinal tissues [10].
On the other hand, lipoteichoic acid (LTA) on the cell walls of Gram-positive commensal microorganisms has been revealed to play a major role in stimulating epithelial cells to express antimicrobial substances, including β-defensins (BDs) [11]. BDs are small cationic peptides with broad antimicrobial and chemotactic activities, are detected in saliva as well as gingival crevicular fluid, and are essential for maintaining the oral environment [12]. Studies indicate that beneficial microorganisms do not necessarily need to be alive to enhance a host’s defense system, contributing to the host’s health. Nonviable forms of these microbes are easier to handle and can be applied in various fields within the food industry [13]. Therefore, our null hypothesis is that heat-killed Lactobacillus (L.) paracasei SMB092 (SMB092) stimulates oral epithelial cells to produce BDs, which prevents the growth of oral pathogens and the development of halitosis.
We have characterized SMB092 isolated from Makgeolli, a traditional Korean fermented rice wine. Its Genbank accession number is CP170332.1 (https://www.ncbi.nlm.nih.gov/nuccore/CP170332, accessed on 30 September 2024). The aim of this study is to find the potential of heat-killed SMB092 as a prophylactic ingredient for oral health maintenance. Thus, to confirm the physical interaction of SMB092 with a host’s oral cavity, we identified whether SMB092 has putative cell adhesion genes targeting mucus-binding (MuB) proteins and is capable of binding to mucus. We also evaluated the effects of heat-killed SMB092 on host oral immunity by measuring the production of antimicrobial peptides (β-defensins: BDs), microbial membrane-bound receptors (Toll-like receptors: TLRs), and their cofactors (CD14/CD36) in primary normal human oral keratinocytes (HOK-16B cells). Additionally, we examined whether the filtered conditioned media (FCM) obtained from HOK-16B cell cultures with heat-killed SMB092 exhibited antimicrobial activity against oral pathogens related to halitosis and periodontal disease.
2. Materials and Methods
2.1. Bacterial Strains
An SMB092 strain was incubated for 15 h in de Man, Rogosa, and Sharpe (MRS) broth (MB cell, Seoul, Republic of Korea) at 37 °C, and the cultures were spread on MRS agar plates to count the colonies. To evaluate the protective effects of heat-killed SMB092, the aforementioned cultured strain was centrifuged (8000 RPM, 4 °C, 8 min), washed twice with phosphate-buffered saline (PBS; Sigma-Aldrich, St. Louis, MO, USA), and heat-treated in a water bath (85 °C, 30 min). The heat-killed SMB092 strain was suspended in PBS at 9 log cells/mL and diluted to appropriate concentrations with PBS for the study.
P. gingivalis was grown in brain heart infusion (BHI) broth media (BD Difco, Bergen County, NJ, USA) at 37 °C under anaerobic conditions. To count the colony, BHI agar plates were used.
2.2. Whole-Genome Sequencing Analysis of SMB092
The genome of the SMB092 strain was constructed de novo by using PacBio sequencing data. Sequencing analysis was performed at CJ Bioscience, Inc. (Seoul, Republic of Korea). PacBio sequencing data were assembled with Flye2.9.2. Contigs were rearranged to start with dnaA/repA or a replication origin using Circlator 1.4.0 (Sanger Institute, Hinxton, UK).
The finding of genes and the functional annotation pipeline of whole-genome assemblies used the EzBioCloud (https://www.ezbiocloud.net, accessed on 1 September 2024) genome database. Coding sequences (CDSs) for proteins were predicted by Prodigal 2.6.2 [14]. Genes coding for tRNA were searched for by using tRNAscan-SE 1.3.1 [15]. rRNA and other non-coding RNAs were searched for via a covariance model search with the Rfam 12.0 database [16]. CRISPRs were detected by PilerCR 1.06 [17] and CRT 1.2 [18]. The CDSs were classified into groups based on their roles, with reference to orthologous groups (EggNOG 4.5; http://eggnogdb.embl.de, accessed on 1 September 2024) [19]. For more functional annotation, the predicted CDSs were compared with the Swiss-Prot [20], KEGG [21], and SEED [22] databases by using the UBLAST v8.0.1517 program [23].
2.3. Identification of the Putative MuB Responsible for the Adhesion Protein in SMB092
To identify the MuB domain from the predicted CDSs, three domains from the Pfam database—the mucin-binding domain (MucBP_2: PF17965), Muc B2-like domain (Muc_B2: PF17966), and MucBP domain (MucBP: PF06458)—were searched for across all CDSs using the Pfam v37.0 database (Pfam-A.hmm) and HMMER’s hmmsearch (version 3.1b2). An e-value threshold of 1 × 10−10 was applied to obtain significant results. If domain locations overlapped within the same gene based on alignment coordinates, the domain with the lower e-value was used. This process was performed using a simple Python (version 3.8.15) script. The results were visualized using DOG 2.0 [24].
2.4. Mucin-Binding Assay
Adhesion activity was investigated according to Karbowiak et al. [25], with some modification. Briefly, mucin from bovine submaxillary glands (Sigma-Aldrich, St. Louis, MO, USA) at a concentration of 0.1 mg/mL in PBS was applied at a volume of 1 mL per well of a 24-well plate at 4 °C, overnight. After that, the well was washed twice with PBS. Then, 500 μL of viable or heat-killed SMB092 strain was added to the wells coated with mucin and incubated at 37 °C for 1 h. To remove the unbound bacteria, the wells were rinsed three times with PBS and adhered cells were fixed by heating (60 °C, 20 min). Following treatment with 0.1% crystal violet solution to each well, PBS washing was performed thrice. To quantify the mucin-binding activity of SMB092, each well was treated with 10% acetic acid for 15 min and the absorbance was estimated at 570 nm.
2.5. Cell Culture
HOK-16B (human oral keratinocyte) cells were maintained in keratinocyte growth medium (PromoCell GmbH, Heidelberg, Germany) supplemented with gentamicin (final concentration of 30 μg/mL; Thermo Fisher Scientific, Waltham, MA, USA) and amphotericin B (final concentration of 15 ng/mL; Thermo Fisher Scientific, Waltham, MA, USA) at 37 °C under air conditions of a 5% CO2 level and 95% humidity [26]. The cells were dissociated with trypsin-EDTA (Welgene, Gyeongsangbuk-do, Republic of Korea) and sub-cultured every 3 or 4 days.
2.6. Determination of Cell Viability
The viability of HOK-16B cells was evaluated through a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay [27], with modifications. Briefly, the cells (2.4 × 104 cells/well in 96-well plates) were cultured until monolayer formation. They were treated with heat-killed SMB092 for 24 h in a CO2 incubator at 37 °C. Following the addition of the MTT solution at a final concentration of 0.5 mg/mL, the plates were incubated for 30 min. After discarding the supernatant, the resulting formazan deposits of each well were dissolved in dimethyl sulfoxide. The absorbance was estimated at 450 nm, and it was judged that there was no significant cytotoxicity when the survival rate was more than 90% compared to the negative control group (none).
2.7. Measurement of mRNA Expression
The expression levels of the mRNA of antimicrobial peptides and receptors were examined via a real-time polymerase chain reaction [28]. HOK-16B cells were seeded at 2.4 × 104 cells/well in a 6-well plate. After overnight incubation, the wells were treated with 1.0 × 104, 1.0 × 105, 1.0 × 106, 1.0 × 107, and 1.0 × 108 cells/mL of SMB092 for 1 h. Following washing with PBS and incubation for another 1 h with antibiotic-free media, the cell supernatant was removed. To determine the signaling mechanism, polyclonal antibody to human TLR2 (PAb-hTLR2; InvivoGen, San Diego, CA, USA), a neutralizing antibody, was added to the cells at a concentration of 5 μg/mL for 30 min before 1 h of treatment of heat-killed SMB092. The cells were then washed once with PBS. After adding new media, they were incubated for another hour. Total RNA was extracted using an easy-BLUE™ Total RNA Extraction Kit (iNtRON Biotechnology, Gyeonggi-do, Republic of Korea). The complementary DNA (cDNA) was synthesized using PrimeScript™ RT Master Mix (TaKaRa Bio Inc., Shiga, Japan), according to the manufacturer’s instructions. TB Green® Premix Ex Taq™ II (TaKaRa Bio Inc., Shiga, Japan) and an AriaMx Real-time PCR System (Agilent, Santa Clara, CA, USA) were used to perform real-time PCR. The expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA served as an internal reference. The primer sets used in this study are listed in Table 1.
Table 1.
Primer sets used in this study.
| Primers | Forward | Reverse |
|---|---|---|
| hBD1 | CTGCCTGCCCGATCTTTACC | CACTCCCAGCTCACTTGCAG |
| hBD2 | CATCAGCCATGAGGGTCTTGT | ACAGGATCGCCTATACCACCA |
| TLR1 | CTTCTGTTTTTGTGGCCAGGG | GGTGCCCAATATGCCTTTGTTA |
| TLR2 | TTCCCTGGGCAGTCTTGAAC | GGCTTGAACCAGGAAGACGA |
| TLR3 | CGGCCAACACTGTGAATGTG | CAGTGTCTCAGCTGTCAGGG |
| TLR4 | TGGTGTCCCAGCACTTCATC | TGATACCAGCACGACTGCTC |
| TLR5 | ACTGACAACGTGGCTTCTCC | GGGCAACTATAAGGTCAGGGG |
| TLR6 | TGCAGACAAGTGTGAGGGAC | CTGAACCTGTGTGCTCCTGT |
| TLR7 | TTCCCACGAACACCACGAAC | AGTCTGTGAAAGGACGCTGG |
| TLR8 | TGCCACTGTGACTAATGGTCC | AAAACCGAACGCAACCACAG |
| CD14 | CCTCAAGGAACTGACGCTCG | AGTGCAAGTCCTGTGGCTTC |
| CD36 | GGACGCTGAGGACAACACA | AAGTTGTCAGCCTCTGTTCCA |
| hGAPDH | AAGAAGGTGGTGAAGCAGGC | TGGGTGTCGCTGTTGAAGTC |
2.8. Bactericidal Assay
The antibacterial activity of the FCM obtained from HOK-16B cells treated with heat-killed SMB092 was examined as previously described, with modifications [29]. Briefly, HOK-16B cells (2.4 × 104 cells/well in a 6-well plate) were cultured overnight to stabilize them. Then, the cells were treated with SMB092 at concentrations of 1.0 × 106 or 1.0 × 108 cells/mL. The cells were incubated at 37 °C for 1 h, followed by treatment with 2 mL of an antibiotic-free medium to each well for another 2 h. The cell culture supernatants were collected by centrifugation (3000 rpm, 4 °C, 10 min) and filtered through a 0.45 μm pore size filter to prepare the FCM. The FCM was concentrated to one-fourth of the original volume by using a SpeedVac (Eppendorf, Hamburg, Germany). To determine the antibacterial activity of the FCM, 500 μL of the concentrated FCM was mixed with 1.0 × 104 CFU/mL P. gingivalis and incubated at 37 °C for 6 h. Subsequently, 100 μL of the reaction mixture was spread on BHI agar plates and incubated anaerobically at 37 °C for 2 days. The number of colonies formed on the BHI agar plates was counted. Additionally, 50 μg/mL of gentamycin (GEN) was used as a positive control.
2.9. Measurement of H2S
To determine whether the FCM exhibits beneficial potential to reduce halitosis, the production of H2S was quantified [30]. The test media (growth medium containing 0.1% cysteine, 0.2% FeSO4, and 0.1 M 2-morpholinoethanesulphonic acid; pH 7.0) was added to the mixture of FCM and P. gingivalis mentioned in Section 2.8. Following incubation at 37 °C for 2 days, absorbance was measured at 700 nm.
2.10. Statistical Analysis
The experimental results are presented as the mean ± standard deviation (SD). The statistical analysis of the experimental data was performed using a t-test or one-way ANOVA (Statistical Package for the Social Science (SPSS), Ver. 12.0, SPSS Inc., Chicago, IL, USA), and the significance was tested at levels of p < 0.05, p < 0.01, and p < 0.001.
3. Results
3.1. General Genome Features of SMB092
The genome assembly of SMB092 consists of a 2.849 Mbp circular chromosome, a 34.051 Kbp plasmid1, and a 11.636 Kbp plasmid2, as shown in Figure 1 and Table 2. The size of the entire genome sequence of SMB092 was 2,895,229 bp. The average G + C content of the whole genome was 46.3%. The GC content of each contig was 46.3% (chromosome), 39.2% (plasmid1), and 40.5% (plasmid2). Additionally, 2802 CDSs were identified in the total genome of SMB092, specifically 2754 CDSs for chromosome, 36 CDSs for plasmid1, and 12 CDSs for plasmid2. The SMB092 strain contained 59 tRNA and 15 rRNA genes.
Figure 1.
Circular gene map of SMB092. Each circle from the outside to the center indicates CDSs on the forward strand, CDSs on the reverse strand, tRNA, rRNA, GC skew, and GC content. The genomic mean GC skew value is used as the baseline, relative to which higher-than-average values are displayed in green, whereas lower-than-average values are displayed in red. The GC ratio also uses the genomic mean GC ratio value as its baseline, with higher-than-average values in blue and lower-than-average values in yellow.
Table 2.
Results of annotation.
| Contig Name | Length (bp) | GC Content (%) | CDS | tRNA | rRNA |
|---|---|---|---|---|---|
| Chromosome | 2,849,542 | 46.3 | 2754 | 59 | 15 |
| Plasmid1 | 34,051 | 39.2 | 36 | 0 | 0 |
| Plasmid2 | 11,636 | 40.5 | 12 | 0 | 0 |
| Total | 2,895,229 | 46.3 | 2802 | 59 | 15 |
3.2. Defining Genes Encoding MuB and Mucin-Binding Activity of SMB092
We searched for genes encoding for MuB proteins that allow SMB092 to bind to mucin (Figure 2a). Mucin-binding domain (MucBP_2), Muc B2-like domain (Muc_B2), and MucBP domain (MucBP) were searched for across all CDSs, and a total of 14 domains were identified in five CDSs from the chromosome—SMB092_00330, SMB092_00358, SMB092_01835, SMB092_02271, and SMB092_02461. Three Muc_B2 domains and two MucBP_2 domains were identified in SMB092_00330. SMB092_00358, SMB092_01835, SMB092_02271, and SMB092_02461 contained one, two, three, and three MucBPs, respectively. No MuB proteins were observed in CDSs from the plasmids. This indicates that SMB092 is likely to interact directly with a host via the mucin-binding protein domain.
Figure 2.
Architecture of the genes encoding MuB protein domains and the mucin-binding activity of SMB092. (a) MuB protein domain containing sequences in SMB092. (b) Mucin-binding activity of live and heat-killed SMB092. * p < 0.05; *** p < 0.001 compared to none. ### p < 0.001 compared to alive.
The results of in vitro adhesion to mucin studies are presented in Figure 2b. Viable and heat-killed SMB092 exhibited dose-dependent adhesion ability to mucin from bovine submaxillary glands. In particular, 109 cells/mL of heat-killed SMB092 showed higher binding activity than 109 CFU/mL of viable SMB092. These results indicate that SMB092 interacts with host cell mucins despite being inactivated by heat treatment.
3.3. The Effect of SMB092 on Cytotoxicity and BD Production in HOK-16B Cells
To investigate the safety and ability to express hBDs of heat-killed SMB092 for oral health, we utilized human primary normal oral keratinocytes (HOK-16B cells). The tested strain at concentrations below eight log cells/mL did not show any cytotoxicity in HOK-16B cells (Figure 3a); therefore, in subsequent experiments, the influence of cytotoxicity was not contemplated.
Figure 3.
The effect of SMB092 on cytotoxicity and hBD production in HOK-16B cells. (a) Viability of HOK-16B cells via heat-killed SMB092; (b) hBD1 production in heat-killed SMB092-treated HOK-16B cells; and (c) hBD2 production in heat-killed SMB092-treated HOK-16B cells. * p < 0.05, ** p < 0.01, and *** p < 0.001 compared to none.
Compared to the untreated negative control group (none), the production of hBD1 was increased markedly by treatments with 105, 106, 107, and 108 cells/mL SMB092 (Figure 3b). In particular, the expression levels of hBD1 were increased dose-dependently. Furthermore, 106, 107, and 108 cells/mL heat-killed SMB092 also significantly induced mRNA levels of hBD2 (Figure 3c). This indicates that heat-killed SMB092 has the ability to stimulate a host for antimicrobial peptide production.
3.4. The Effect of SMB092 on the Expression of TLRs in HOK-16B Cells
To examine the regulation of LTA-sensing receptors by heat-killed SMB092, we measured TLRs in HOK-16B cells. As shown in Figure 4, 108 cells/mL of heat-killed SMB092 significantly upregulated the expression of TLR2, TLR3, TLR4, TLR6, and TLR8. The data suggest that heat-killed SMB092 induces the expression of TLRs and LTA-sensing receptors.
Figure 4.
The effect of SMB092 on the expression of TLRs in HOK-16B cells. * p < 0.05; ** p < 0.01 compared to none.
3.5. The Effect of TLR2 Neutralization on the Expression of hBD1/hBD2 and CD14/CD36 in HOK-16B Cells
To verify the signaling pathway, the relative expression levels of hBD1/2 mRNA induced by heat-killed SMB092 were measured in HOK-16B cells treated with a TLR2-neutralizing antibody (Figure 5a,b). Compared to the condition without TLR2 neutralization, 108 cells/mL of heat-killed SMB092 decreased hBD1 expression. In the case of hBD2, mRNA expression levels were significantly reduced following treatment with the polyclonal antibody (PAb-hTLR2) in the six log heat-killed SMB092 group.
Figure 5.
The effect of TLR2 neutralization on the expression of hBDs and CD14/CD36 in HOK-16B cells. mRNA expression levels of (a) hBD1 and (b) hBD2; mRNA expression levels of (c) CD14 and (d) CD36. * p < 0.05; ** p < 0.01 compared to none. None: Negative control. # p < 0.05; ## p < 0.01 compared to PAb-hTLR2 (−).
Furthermore, we determined the effect of TLR neutralization on the expression of CD14/CD36. As shown in Figure 5c,d, 108 cells/mL of heat-killed SMB092 significantly induced the expression of CD14 and CD36. However, TLR2 neutralization markedly reduced the expression levels of CD14 and CD36 induced by SMB092.
The results showed that TLR2, the membrane receptor of the host epithelial cells, is a key factor in the production of BDs and their cofactor, CD14/CD36.
3.6. Effects of the FCM on P. gingivalis and Its Mediated H2S Production
The results for the evaluation of the antimicrobial effect of the FCM containing BDs secreted by HOK-16B cells are shown in Figure 6a. As expected, 50 μg/mL gentamycin (GEN) completely inhibited the growth of P. gingivalis. Additionally, the FCM obtained from the culture of HOK-16B cells treated with both 106 cells/mL and 108 cells/mL SMB092 significantly reduced the colony counts of P. gingivalis.
Figure 6.
The inhibitory survival of P. gingivalis and the reduced production of H2S by the FCM. (a) Viability of P. gingivalis; (b) H2S production. *** p < 0.001 compared to none. None: Negative control.
Figure 6b shows the production of H2S by P. gingivalis. The FCM in GEN significantly exhibited 52% inhibitory effects on H2S, a VSC, produced by P. gingivalis. The FCM obtained from the culture of HOK-16B cells treated with both 106 and 108 cells/mL of SMB092 showed 29% and 43%, respectively, compared to none. These results suggest that the antimicrobial substances, including BDs, secreted by oral epithelial cells stimulated with heat-killed SMB092 reduced the growth of P. gingivalis and its mediated H2S concentration.
4. Discussion
The oral cavity harbors extensive microbiota including commensal and pathogenic bacteria. It is constantly covered with saliva containing antimicrobial peptides produced by oral epithelial tissues. Saliva plays a major role in maintaining the homeostasis between the oral microbiota and the host [31]. It is an important strategy to strength the host’s oral mucosal barrier by stimulating the expression of the defense factors, such as BDs, in the saliva. In this study, we first characterized and identified the MuB gene encoding the mucin-binding protein domain in SMB092 and measured its mucin-binding ability. We then elucidated the ability of SMB092 to induce the expression of antimicrobial peptides in gingival epithelial cells and consequently improve oral health.
The mucin-binding domains on commensal bacteria are crucial for interactions with host extracellular matrix proteins and epithelial cells to interfere with the colonization of pathogens and initiate intracellular signaling pathways [32,33]. Identifying the structural properties of mucin-binding domains and the capacities with mucin would be key factors with which to determine the mechanisms behind the probiotic–host interaction. In this study, we confirmed that SMB092 possesses 14 putative MuB genes encoding the mucus-binding domains (Figure 2a). We also found that, regardless of the SMB092 live status, it is able to bind the mucus layer. Previous studies have identified that Lactobacillus strains differ in the size and number of mucus-binding domains [9,34,35]. Nishiyma et al. [35] demonstrated that the mutation of the mucus-binding factor (mbf) in the Lactobacillus rhamnosus FSMM22 strain significantly reduced their adhesive capacity to porcine colonic mucin and other extracellular matrix proteins, such as laminin, fibronectin, and collagen IV. Lactobacillus reuteri cell- and mucus-binding protein A (CmbA) also attaches to intestinal epithelial cells as well as mucus [36]. Our findings suggest that the dynamics of the mucus-binding domain on SMB092 impact its interaction with the host oral cavity for regulating pathogens, initiating downstream signaling pathways, and modulating host immune responses.
The commensal bacteria are known to play an important role in strengthening a host’s mucosal barrier by stimulating epithelial tissues to express antimicrobial factors [37]. We showed that the expression levels of hBD1 and hBD2 were upregulated following treatment with heat-killed SMB092 in HOK-16B cells (Figure 3b,c). Similar to our data, heat-killed Lactobacillus casei and L. fermentum were stimulated to express mRNA levels of hBD2 comparably with their respective live probiotics in Caco-2 human epithelial cells [11]. Lactobacillus helveticus SBT2171, a live form, also upregulated mRNA levels of BD2 and BD3 in human gingival epithelial Ca9-22 cells [38]. Additionally, various probiotic Lactobacillus strains stimulated human gingival epithelial cells to induce the secretion of either BD2 or BD4 [39]. Our and other results indicate that the commensal bacteria, regardless of their live status, as the approach to probiotics have sufficient conditions with which to stimulate epithelial cells to produce BDs.
The molecular signaling pathway behind BD production by commensal bacteria has not yet been clearly understood; however, we demonstrated that heat-killed SMB092 stimulated the expression of host transmembrane receptors, particularly TLR2 and TLR6, as it is well known for recognizing LTA (Figure 4). Furthermore, we verified that the induction of hBD1/2 and TLR accessary molecules, CD14/CD36, by heat-killed SMB092 was inhibited by the presence of TLR2-specific antibodies (Figure 5). Kim et al. [40] reported a similar finding, that LTA of Lactobacillus strains is one of main factors in BD production. The expression of BDs by commensal bacteria has also been associated with the nuclear factor-kappa B (NF-κB) signaling pathway through the interaction of their LTA with pattern recognition receptors, such as TLR2/6 in epithelial cells [41]. Additionally, the mRNA levels of CD14 were downregulated in the absence of TLR2 using genetically modified mice [42]. Thus, the molecular mechanism in the expression of hBD1 and hBD2 by heat-killed SMB092 is likely an intracellular downstream pathway via the interaction of its LTA with TLR2/6 on the membrane of human oral keratinocytes.
The principle of hBDs as antimicrobial agents has been described as the binding of positively charged hBDs to negatively charged components of pathogenic microbial cell membranes, disrupting and leaking their integrity [43]. We demonstrated that the growth of P. gingivalis was inhibited when it reacted with the FCM obtained from the incubation of heat-killed SMB092 with human oral keratinocytes (Figure 6a). Sequentially, the FCM significantly reduced P. gingivalis-mediated H2S production (Figure 6b). The antimicrobial effects of the FCM are probably due to the hBD1 and hBD2 expressed by human oral keratinocytes cultured with heat-killed SMB092. The possible role of BDs in oral health has been reported as the concentration of hBD2 in saliva being inversely related to the occurrence of gingivitis and the production of H2S in human subjects [44,45]. In vitro studies have also shown that hBD2 inhibited detrimental oral bacteria, such as F. nucleatum and P. gingivalis, in a dose-dependent manner [46]. Lactobacillus paracasei LMT18-32 itself produced antimicrobial substances, such as bacteriocins, that inhibited the growth of P. gingivalis [47]. Another L. paracasei ET-22 strain exhibited a significant inhibitory effect on biofilms of the oral pathogen S. mutans in all of its live, heat-killed, and secreted forms [48]. Furthermore, in patients with halitosis, the oral intake of live and heat-killed L. paracasei ET-22 for 28 days lead to a reduction in VSC levels in the oral cavity [49]. Although it has been reported that the mitigation of halitosis by heat-killed ET-22 is attributed to the marked inhibition of pathogens, including Rothia and Streptococcus, at the genus level, there are no reports of an association between halitosis and Rothia as well as Streptococcus [50,51]. On the other hand, we did not focus on the ability of SMB092 itself to produce antimicrobial substances. Instead, we demonstrated that SMB092, even when not alive, stimulated oral keratinocytes to produce BDs, which could be an important factor in preventing P. gingivalis-mediated periodontal diseases and halitosis, thereby maintaining oral health.
Future research should focus on (1) the characterization of other adhesion genes in SMB092, (2) the determination of its binding ability to human oral keratinocytes, (3) the confirmation of BD protein concentrations in the FCM, and (4) the investigation of other antimicrobial factors in the FCM. Finally, preclinical studies and clinical trials need to be conducted to validate these findings on the full therapeutic potential of SMB092 in various oral health applications.
5. Conclusions
Based on the data of whole-genome sequences, the putative mucus-binding domains were identified in SMB092. SMB092 remarkably adhered to mucin, regardless of its live status, and had no significant cytotoxicity to human oral keratinocytes. The heat-killed SMB092 upregulated the mRNA levels of antimicrobial peptides (hBD1/2), as well as their regulators (TLR2/6) and cofactors (CD14/CD36) in the same cell line. The FCM obtained from the incubation of heat-killed SMB092 with HOK-16B cells inhibited the growth of P. gingivalis and its mediated production of H2S. Overall, the heat-killed SMB092 could be employed as a prophylactic agent for the improvement of oral hygiene, including the treatment of halitosis and periodontal diseases.
Author Contributions
Conceptualization, B.-S.H., H.K. and D.Y.S.; methodology, W.-J.K., G.J., T.K. and J.K.; software, W.-J.K., G.J., T.K. and J.K.; validation, W.-J.K., G.J. and T.K.; formal analysis, W.-J.K. and G.J.; investigation, W.-J.K., G.J. and T.K.; writing—original draft preparation, W.-J.K., G.J. and T.K.; writing—review and editing, B.-S.H., H.K. and D.Y.S.; visualization, W.-J.K., G.J. and T.K.; supervision, B.-S.H., H.K. and D.Y.S.; project administration, B.-S.H., H.K. and D.Y.S.; funding acquisition, B.-S.H. All authors have read and agreed to the published version of the manuscript.
Data Availability Statement
The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.
Conflicts of Interest
Authors Won-Ju Kim, Jinseon Kim, Byung-Serk Hurh and Do Yu Soung were employed by the company Sempio Foods Company. Author Taewook Kim was employed by the company CJ Bioscience Inc. Author Hangeun Kim was employed by the company Skin Biotechnology Center Co. Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Funding Statement
This work was supported by the Technology Innovation Program (20008991) funded by the Ministry of Trade, Industry & Energy (MOTIE, Republic of Korea).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Chavda R.M., Patel E.D., Shah S.H., Shah S.K., Sheth S., Munia V. A study to assess the unique oral health challenges faced by elderly individuals, including denture use, dry mouth, and periodontal diseases. Int. J. Oral Care Res. 2023;11:44–47. doi: 10.4103/INJO.INJO_20_23. [DOI] [Google Scholar]
- 2.Byrne S.J., Dashper S.G., Darby I.B., Adams G.G., Hoffmann B., Reynolds E.C. Progression of chronic periodontitis can be predicted by the levels of Porphyromonas gingivalis and Treponema denticola in subgingival plaque. Oral Microbiol. 2009;24:469–477. doi: 10.1111/j.1399-302X.2009.00544.x. [DOI] [PubMed] [Google Scholar]
- 3.Hajishengallis G., Kajikawa T., Hajishengallis E., Maekawa T., Reis E.S., Mastellos D.C., Tancopoulou D., Hasturk H., Lambris J.D. Complement-dependent mechanisms and interventions in periodontal disease. Front. Immunol. 2019;10:406. doi: 10.3389/fimmu.2019.00406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Karbalaei M., Keikha M., Kobyliak N.M., Zadeh Z.K., Yousefi B., Eslami M. Alleviation of halitosis by use of probiotics and their protective mechanisms in the oral cavity. New Microbes New Infect. 2021;42:100887. doi: 10.1016/j.nmni.2021.100887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kim T.I., Choi E.J., Jeong J.P., Han S.B., Gu Y. Antimicorbial effect of Zea mays L. and Magnoliae cortex extract mixtures on periodontal pathogen and effect on human gingival fibrobla. J. Periodont. Implant Sci. 2002;32:249–255. [Google Scholar]
- 6.Lim H.S., Yeu J.E., Hong S.P., Kang M.S. Characterization of Antibacterial cell-free supernatant from oral care probiotic Weissella cibaria, CMU. Molecules. 2018;23:1984. doi: 10.3390/molecules23081984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen Y.T., Hsieh P.S., Ho H.H., Hsieh S.H., Kuo Y.W., Yang S.F., Lin C.W. Antibacterial activity of viable and heat-killed probiotic strains against oral pathogens. Lett. Appl. Microbiol. 2020;70:310–317. doi: 10.1111/lam.13275. [DOI] [PubMed] [Google Scholar]
- 8.Rossoni R.D., Velloso M.D.S., de Barros P.P., de Alvarenga J.A., Santos J.D.D., Santos Prado A.C.C.D., Ribeiro F.C., Anbinder A.L., Junqueira J.C. Inhibitory effect of probiotic Lactobacillus supernatants from the oral cavity on Streptococcus mutans biofilms. Microb. Pathog. 2018;123:361–367. doi: 10.1016/j.micpath.2018.07.032. [DOI] [PubMed] [Google Scholar]
- 9.Van Tassell M.L., Miller M.J. Lactobacillus adhesion to mucus. Nutrients. 2011;3:613–636. doi: 10.3390/nu3050613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sanders M.E. Impact of probiotics on colonizing microbiota of the gut. J. Clin. Gastroenterol. 2011;45:S115–S119. doi: 10.1097/MCG.0b013e318227414a. [DOI] [PubMed] [Google Scholar]
- 11.Habil N., Abate W., Beal J., Foey A.D. Heat-killed probiotic bacteria differentially regulate colonic epithelial cell production of human β-defensin-2: Dependence on inflammatory cytokines. Benef. Microbes. 2014;5:483–495. doi: 10.3920/BM2013.0061. [DOI] [PubMed] [Google Scholar]
- 12.Dommisch H., Skora P., Hirschfeld J., Olk G., Hildebrandt L., Jepsen S. The guardians of the periodontium-sequential and differential expression of antimicrobial peptides during gingival inflammation. Results from in vivo and in vitro studies. J. Clin. Periodontol. 2019;46:276–285. doi: 10.1111/jcpe.13084. [DOI] [PubMed] [Google Scholar]
- 13.Siciliano R.A., Reale A., Mazzeo M.F., Morandi S., Silvetti T., Brasca M. Parabiotics: A new perspective for functional foods and nutraceuticals. Nutrients. 2021;13:1225. doi: 10.3390/nu13041225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Hyatt D., Chen G.L., LoCascio P.F., Land M.L., Larimer F.W., Hauser L.J. Prodigal: Prokaryotic gene recognition and translation initiation site identification. BMC Bioinform. 2010;11:119. doi: 10.1186/1471-2105-11-119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Schattner P., Brooks A.N., Lowe T.M. The tRNAscan-SE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic Acids Res. 2005;33:W686–W689. doi: 10.1093/nar/gki366. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Nawrocki E.P., Burge S.W., Bateman A., Daub J., Eberhardt R.Y., Eddy S.R., Floden E.W., Gardner P.P., Jones T.A., Tate J., et al. Rfam 12.0: Updates to the RNA families database. Nucleic Acids Res. 2015;43:D130–D137. doi: 10.1093/nar/gku1063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Edgar R.C. PILER-CR: Fast and accurate identification of CRISPR repeats. BMC Bioinform. 2007;8:18. doi: 10.1186/1471-2105-8-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bland C., Ramsey T.L., Sabree F., Lowe M., Brown K., Kyrpides N.C., Hugenholtz P. CRISPR Recognition Tool (CRT): A tool for automatic detection of clustered regularly interspaced palindromic repeats. BMC Bioinform. 2007;8:209. doi: 10.1186/1471-2105-8-209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Powell S., Forslund K., Szklarczyk D., Trachana K., Roth A., Huerta-Cepas J., Gabalón T., Rattei T., Creevey C., Kuhn M., et al. EggNOG v4.0: Nested orthology inference across 3686 organisms. Nucleic Acids Res. 2014;42:D231–D239. doi: 10.1093/nar/gkt1253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.The UniProt Consortium UniProt: A hub for protein information. Nucleic Acids Res. 2015;43:D204–D212. doi: 10.1093/nar/gku989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kanehisa M., Goto S., Sato Y., Kawashima M., Furumichi M., Tanabe M. Data, information, knowledge and principle: Back to metabolism in KEGG. Nucleic Acids Res. 2014;42:D199–D205. doi: 10.1093/nar/gkt1076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Overbeek R., Begley T., Butler R.M., Choudhuri J.V., Chuang H.Y., Cohoon M., de Crécy-Lagard V., Diaz N., Disz T., Edwards R., et al. The subsystems approach to genome annotation and its use in the project to annotate 1000 genomes. Nucleic Acids Res. 2005;33:5691–5702. doi: 10.1093/nar/gki866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Edgar R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 2010;26:2460–2461. doi: 10.1093/bioinformatics/btq461. [DOI] [PubMed] [Google Scholar]
- 24.Ren J., Wen L., Gao X., Jin X., Xue Y., Yao X. DOG 1.0: Illustrator of Protein Domain Structures. Cell Res. 2009;19:271–273. doi: 10.1038/cr.2009.6. [DOI] [PubMed] [Google Scholar]
- 25.Karbowiak M., Galek M., Szydlowska A., Zielińska D. The influence of the degree of thermal inactivation of probiotic lactic acid bacteria and their postbiotics on aggregation and adhesion inhibition of selected pathogens. Pathogens. 2022;11:1260. doi: 10.3390/pathogens11111260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ji S., Kim Y.S., Oh J., Min B., Choi Y. Toll-like receptor 2 and NALP2 mediate induction of human beta-defensin by Fusobacterium nucleatum in gingival epithelial cells. Infect. Immun. 2009;77:1044–1052. doi: 10.1128/IAI.00449-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kim W.J., Yu H.S., Lee N.K., Paik H.D. Levilactobacillus brevis KU15151 inhibits Staphylococcus aureus lipoteichoic acid-induced inflammation in RAW 264.7 macrophages. Probiotics Antimicrob. Proteins. 2022;14:767–777. doi: 10.1007/s12602-022-09949-x. [DOI] [PubMed] [Google Scholar]
- 28.Nguyen A.T., Kim M., Kim Y.E., Kim H., Lee S., Lee Y., Kim K.Y. MSF enhances human antimicrobial peptide β-defensin (HBD2 and HBD3) expression and attenuates inflammation via the NF-κB and p38 signaling pathways. Molecules. 2023;28:2744. doi: 10.3390/molecules28062744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kim H., Meyer K., Di Bisceglie A.M., Ray R. Hepatitis C Virus suppresses C9 complement synthesis and impairs membrane attack complex function. J. Virol. 2013;87:5858–5867. doi: 10.1128/JVI.00174-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Kang M.S., Kim B.G., Chung J., Lee H.C., Oh J.S. Inhibitory effect of Weissella cibaria isolates on the production of volatile sulphur compounds. J. Clin. Periodontol. 2006;33:226–232. doi: 10.1111/j.1600-051X.2006.00893.x. [DOI] [PubMed] [Google Scholar]
- 31.Carpenter G.H. The secretion, components, and properties of saliva. Annu. Rev. Food Sci. Technol. 2013;4:267–276. doi: 10.1146/annurev-food-030212-182700. [DOI] [PubMed] [Google Scholar]
- 32.Lebeer S., Vanderleyden J., De Keersmaecker S.C.J. Host interactions of probiotic bacterial surface molecules: Comparison with commensals and pathogens. Nat. Rev. Microbiol. 2010;8:171–184. doi: 10.1038/nrmicro2297. [DOI] [PubMed] [Google Scholar]
- 33.Nakamura K., Sakuragi N., Takakuwa A., Ayabe T. Paneth cell α-defensins and enteric microbiota in health and disease. Biosci. Microbiota Food Health. 2016;35:57–67. doi: 10.12938/bmfh.2015-019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Toropov V., Demyanova E., Shalaeva O., Stikin S., Vakhitov T. Whole-genome sequencing of Lactobacillus helveticus D75 and D76 confirms safety and probiotic potential. Microorganisms. 2020;8:329. doi: 10.3390/microorganisms8030329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Nishiyama K., Nakamata K., Uemo S., Terao A., Aryantini N.P.D., Sujaya N., Fukuda K., Urashima T., Yamamoto Y., Mukai T. Adhesion properties of Lactobacillus rhamnosus mucus-binding factor to mucin and extracellular matrix proteins. Biosci. Biotechnol. Biochem. 2015;79:271–279. doi: 10.1080/09168451.2014.972325. [DOI] [PubMed] [Google Scholar]
- 36.Jensen H., Roos S., Jonsson H., Rud I., Grimmer S., van Pijkeren J.-P., Britton R.A., Axelsson L. Role of Lactobacillus reuteri cell and mucus-binding protein A (CmbA) in adhesion to intestinal epithelial cells and mucus in vitro. Microbiology. 2014;160:671–681. doi: 10.1099/mic.0.073551-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Madsen K.L. Enhancement of epithelial barrier function by probiotics. J. Epithel. Biol. Pharmacol. 2012;5:55–59. doi: 10.2174/1875044301205010055. [DOI] [Google Scholar]
- 38.Kobatake E., Kobayashi R., Kabuki T.L., Kurita-Ochiai T. Lactobacillus helveticus SBT2171 upregulates the expression of β-defensin and ameliorates periodontal disease caused by Porphyromonas gingivalis. Microbiol. Immunol. 2019;63:293–302. doi: 10.1111/1348-0421.12719. [DOI] [PubMed] [Google Scholar]
- 39.Pahumunto N., Duangnumsawang Y., Teanpaisan R. Effects of potential proviotics on the expression of cytokines and human β-defensin in human gingival epithelial cells and in vivo efficacy in a dog model. Arch. Oral Biol. 2022;142:105513. doi: 10.1016/j.archoralbio.2022.105513. [DOI] [PubMed] [Google Scholar]
- 40.Kim J.H., Kim K.H., Kim H.J., Lee J., Myung S.C. Expression of beta-defensin 131 promotes an innate immune response in human prostate epithelial cells. PLoS ONE. 2015;10:e0144776. doi: 10.1371/journal.pone.0144776. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Schlee M., Harder J., Köten B., Stange E.F., Wehkamp J., Fellermann K. Probiotic lactobacilli and VSL#3 induce enterocyte β-defensin 2. Clin. Exp. Immunol. 2008;151:528–535. doi: 10.1111/j.1365-2249.2007.03587.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Kielian T., Haney A., Mayes P.M., Garg S., Esen N. Toll-like receptor 2 modulates the proinflammatory milieu in Staphylococcus aureus-induced brain abscess. Infect. Immun. 2005;73:7428–7435. doi: 10.1128/IAI.73.11.7428-7435.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Pazgier M., Hoover D.M., Yang D., Lu W., Lubkowski J. Human β-defensins. Cell. Mol. Life Sci. 2006;63:1294–1313. doi: 10.1007/s00018-005-5540-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Vandar-Sengul S., Demirci T., Sen B.H., Erkizan V., Kurulgan E., Baylas H. Human β defensin-1 and -2 expression in the gingiva of patients with specific periodontal diseases. J. Periodont. Res. 2007;42:429–437. doi: 10.1111/j.1600-0765.2006.00964.x. [DOI] [PubMed] [Google Scholar]
- 45.de Lima P.O., Nani B.D., Rolim G.S., Groppo F.C., Franz-Montan M., de Moraes A.B.A., Cogo-Müller K., Marcondes F.K. Effects of academic stress on the levels of oral volatile sulfur compounds, halitosis-related bacteria and stress biomarkers of healthy undergraduate students. J. Breath Res. 2020;14:036005. doi: 10.1088/1752-7163/ab944d. [DOI] [PubMed] [Google Scholar]
- 46.Ghosh S.K., Feng Z., Fujioka H., Lux R., McCormick T.S., Weinburg A. Conceptual perspectives: Bacterial antimicrobial peptide induction as a novel strategy for symbiosis with the human host. Front. Microbiol. 2018;9:302. doi: 10.3389/fmicb.2018.00302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Choi W.J., Cho S.K., Dong H.J., Kim T.H., Soon J., Lee H.J., Yoon K.H., Kwak S., Yun J. Preventive effect of Lacticaseibacillus paracasei LMT18-32 on Porphyromonas gingivalis induced periodontitis. Food Sci. Biotechnol. 2024;33:2161–2167. doi: 10.1007/s10068-023-01451-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Zhao Z., Wu J., Sum Z., Fan J., Liu F., Zhao W., Liu W.H., Zhang M., Hung W.L. Postbiotics derived from L. paracasei ET-22 inhibit the formation of S. mutans biofilms and bioactive substances: An analysis. Molecules. 2023;28:1236. doi: 10.3390/molecules28031236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Wuri G., Liu F., Sun Z., Fang B., Zhao W., Hung W.L., Liu W.H., Zhang X., Wang R., Wu F., et al. Lactobacillus paracasei ET-22 and derived postbiotics reduce halitosis and modulate oral microbiome dysregulation—A randomized, double-blind placebo-controlled clinical trial. Food Func. 2023;14:7335. doi: 10.1039/D3FO02271D. [DOI] [PubMed] [Google Scholar]
- 50.Ghapanchi J.L., Kamali F., Jalaly Z., Ebrahimi H., Bazargani A., Shahidi S.P., Vossoughi M. Lack of association between halitosis and the presence of Streptococcus mutans in saliva. Br. J. Med. Med. Res. 2015;10:1–7. doi: 10.9734/BJMMR/2015/19571. [DOI] [Google Scholar]
- 51.Carda-Diéguez M., Rosier B.T., Lloret S., Llena C., Mira A. The tongue biofilm metatransciptome identifies metabolic pathways associated with halitosis and its prevention. medRxiv. 2021;11:21266067. doi: 10.1101/2021.11.09.21266067. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.







