Long-term alterations in lung epithelial cells after EL-RSV infection exacerbate allergic responses through IL-1β-induced pathways

Abstract

Early-life (EL) respiratory infections increase pulmonary disease risk, especially EL-Respiratory Syncytial Virus (EL-RSV) infections linked to asthma. Mechanisms underlying asthma predisposition remain unknown. In this study, we examined the long-term effects on the lung after four weeks post EL-RSV infection. We identified alterations in the lung epithelial cell, with a rise in the percentage of alveolar type 2 epithelial cells (AT2) and a decreased percentage of cells in the AT1 and AT2-AT1 subclusters, as well as upregulation of Bmp2 and Krt8 genes that are associated with AT2-AT1 trans-differentiation, suggesting potential defects in lung repair processes. We identified persistent upregulation of asthma-associated genes, including Il33. EL-RSV-infected mice allergen-challenged exhibited exacerbated allergic response, with significant upregulation of Il33 in the lung and AT2 cells. Similar long-term effects were observed in mice exposed to EL-IL-1β. Notably, treatment with IL-1ra during acute EL-RSV infection mitigated the long-term alveolar alterations and the allergen-exacerbated response. Finally, epigenetic modifications in the promoter of the Il33 gene were detected in AT2 cells harvested from EL-RSV and EL-IL1β groups, suggesting that long-term alteration in the epithelium after RSV infection is dependent on the IL-1β pathway. This study provides insight into the molecular mechanisms of asthma predisposition after RSV infection.

Introduction

RSV is the primary cause of bronchiolitis in children worldwide. Severe RSV-bronchiolitis infection has been associated with the onset of childhood wheezing and the increased risk of developing asthma later in childhood.^1,2 In addition, severe early-life respiratory tract infections have been associated with disrupted lung development, leading to reduced lung function as adults, increased risk of developing pulmonary diseases, and premature adult death.^3–5 The severity of the EL-RSV infection correlates with the age of the infants, where premature infants and children under six months of age present a higher risk of developing severe RSV-bronchiolitis.¹

Severe RSV infection is characterized by a robust Th2/Th17 immune response that leads to mucus hyperproduction in the airways.^6,7 Asthma is a chronic disease characterized by bronchial constriction, airway obstruction, and persistent inflammatory cell infiltration.⁸ Prevalence of the disease has risen over the years, with > 8 % of the population afflicted.⁹ Inherited genetic variations that contribute to the development of atopy cannot be altered. However, pharmacotherapy targeting modifiable risk factors, along with behavioral interventions such as reducing chemical or smoke exposure, can help decrease the disease burden.¹⁰ The initiation of asthmatic disease most often begins before pre-school years, and the chronic symptoms usually emerge early and are persistent until adulthood.¹¹ Notably, some asthmatic patients exhibit genetic modifications, including the overexpression of Il33.¹² Clinically, increased levels of IL-33 and IL-1β have been identified in the airways and tracheal washes of infants infected with RSV compared to uninfected children.^13–15

Allergic asthma and RSV-bronchiolitis are associated with inflammatory responses primarily driven by Th2-type cytokines. The epithelial cell-derived cytokines TSLP, IL-33, and IL-25 are central regulators of type 2 immunity, which drives allergic responses.¹⁶ The epithelium releases these innate cytokines in response to external insults and provides signals to the immune and mesenchymal cells. These cytokines can activate and recruit the underlying immune cells, including macrophages and type 2 innate lymphoid cells (ILC2), to influence the lung immune environment. ILC2s, a critical source of Th2 cytokines (IL-4, IL-5, and IL-13), are activated directly by IL-25, IL-33, and TSLP, and increased numbers of these cells have been detected during acute RSV infection.¹⁷

Furthermore, IL-33 has been widely implicated in asthma pathogenesis and is produced by the epithelial cells upon stimulation. High levels of this cytokine have been detected in the bronchoalveolar lavage fluid of asthmatics.¹² Notably, a correlation between the concentration of this cytokine and lung function has been reported.^12,17 However, it is unclear if the changes in asthmatics epithelium are the cause or consequence of the disease. Previous studies from our group have shown persistent upregulation of TSLP and IL-33 in mice lung after four weeks of EL-RSV infection.¹⁸ The lung epithelium represents a key moderator of the immune response and the possible initiator of the subsequent lung disease.

It has been reported that RSV can infect bronchiolar epithelial cells,^19–20 ciliated epithelial cells,²¹ and alveolar epithelial type 2 cells (AT2 cells).^15,22–23 The alveolar epithelium consists of alveolar epithelial type 1 cells (AT1), which facilitate gas exchange, and alveolar epithelial type 2 cells (AT2), which produce surfactant and act as progenitor cells. After lung injury, the alveolar epithelium undergoes regeneration, with AT2 cells proliferating and differentiating into AT1 cells. This process involves a highly regulated transitional state.²⁴

The lung epithelium, as the primary driver of allergy after EL-RSV, has yet to be thoroughly studied and represents an appropriate central cells that links to lung immune function.²⁵ In this work, we studied the long-term alteration after early-life RSV infection in the lung, with particular emphasis on the lung epithelium, to understand some of the mechanisms behind RSV immunopathology and asthma predisposition. We further hypothesized that the long-term alterations in the alveolar epithelium were generated by the upregulation of pulmonary IL-1β.

Results

Map of cellular composition in the lung of normal and 4wpi EL-RSV infected mice

In this work, we investigated the role of the lung epithelium in the immunopathology of EL-RSV infection and the long-term alteration of the lung epithelium. We have established a neonatal RSV infection model (EL-RSV) to study the effect of respiratory virus infection during early life. In this model, we infected neonates at 7 days old with RSV intranasally, as we previously published^18,26–27 (Fig. 1A). We have shown previously that the virus is completely cleared in our EL-RSV infection model at 14 days post-infection.¹⁸ To identify if EL-RSV infection generated long-term transcriptional changes in the lung, we performed whole lung unbiased scRNA-seq of lung samples from naïve and 4 weeks post-EL-RSV infected mice. Cells were clustered based on their expression profile, and cell types were annotated based on established cell markers available on LungMap (https://lungmap.net/), CellMaker 2.0, and published literature.²⁸ In this work, we identified nine central cell clusters and 11 subclusters (Sup Fig. 1A). No evident alterations were observed between EL-RSV 4wpi and control clusters in the whole lung (Sup Fig. 1B). The clusters were designated based on their gene signatures (Sup Fig. 1D). Differential gene expression of the whole lung was analyzed and we detected significant upregulation of asthma-related genes interleukin 33 (Il33) and Zinc Finger And BTB Domain Containing 1 (Zbtb16) and downregulation of genes related with alveolar differentiation and AT1 cell markers; the retinoic acid RA-catabolizing Cyp26 enzyme (cyp26b1) and homeodomain only protein (Hopx), as observed in the volcano plot (Fig. 1B).

Fig. 1. Map of the cellular composition of the lung of normal and EL-RSV 4 weeks post-infected mice.

A) Animal model: 7-day-old Balb/c mice were intranasally infected with RSV (EL-RSV), and lung samples were taken 4 weeks post-infection (4wpi) for scRNA-seq analysis. B) Volcano plot showing the differential gene expression of all cells obtained from whole lung scRNA-seq in the EL-RSV infected group vs. Control (p-VAL). C) UMAP plot of all scRNA-seq data, showing 11 distinct immune cell clusters. D) UMAP plots showing a contrast of subclusters between the control group and EL-RSV. E) Volcano plot showing the differential gene expression of immune cells cluster in the EL-RSV infected group vs. Control. N=3 animals/group.

In this research, we focus on the epithelial and immune cells (Sup Fig. 1. D and E) as the most relevant players in asthma and allergic disease. To identify if EL-RSV infection generated long-term transcriptional changes in the lung immune cells. Immune cells were clustered based on their expression of the Ptprc gene, and from there, we identified 11 subclusters based on gene identity: B cells, T cells, Interstitial Macrophages, Monocyte, natural killer cells (NK), Neutrophils, dendritic cells (DCs), innate lymphocyte cells type 2 (ILC2), Basophils, Alveolar Macrophages, and plasmacytoid DCs. (Sup Fig. 2A–C). EL-RSV infection presented subtle alteration in the composition of lung immune cells, featuring an elevated proportion of T cells (3 %), Interstitial macrophages (3 %), Neutrophils (2 %), and DCs (1 %), and a decrease in B cells (3 %), Monocytes (4 %), NK (2 %) and Alveolar macrophages (1 %) (SupFig. 2C). Finally, we analyzed the differential gene expression of the immune cell cluster and identified some genes related to asthma risk, such as Il33, as shown in the volcano plot (Fig. 2E). Analyzing the differential gene expression of the immune cell subcluster, we identify some upregulated asthma-related genes. Among those were C–C motif chemokine 17 (CCL17), Chitinase 1 (Chia 1), and Il33 (Table 1). These data suggest that EL-RSV infection generated long-term transcriptional alteration in the lung, and the immune cells cluster contributes to the long-term upregulation of the IL-33 in the lung after EL-RSV infection.

Fig. 2. Cellular composition of lung epithelial cells in normal lung and after EL-RSV 4wpi.

A) UMAP plot of all scRNA-seq data, showing five distinct lung epithelial cell subclusters. B) Gene identity in the lung epithelial cell subclusters. C) UMAP plots illustrating the differences in subclusters between the control and EL-RSV groups D) Lung epithelial cells subcluster percentage of cells in normal (Control) and EL-RSV 4wpi mice. E) Volcano plot showing the different gene expressions in the epithelial cells cluster EL-RSV infected group vs. Control. D) Differentially expressed asthma-related genes in the lung epithelial subclusters. E-F) Total Il33 expression in the lung epithelial cell cluster and subclusters. G) Zbtb16 expression in the different epithelial cell subclusters. N=3 animals/group.

Table 1.

Asthma-associated genes differentially expressed in EL-RSV infection in the Immune cell clusters (Ptprc).

Gene name (symbol)	Avg_log2FC/pval	Asthma-association and function	Ref.
Cystic fibrosis transmembrane conductance regulator(Cftr)	2.57443222/0.01697348	Cftr is a gene associated with cystic fibrosis. It encodes a protein that functions as a chloride channel and is important for the regulation of mucus. Carriers of CFTR gene have been found to have an increased risk of persistent asthma	94
Transglutaminase 1(Tgml)	2.225375934/0.017832461	Tgm1 is a member of a class of enzymes that catalyze the crosslinking of proteins. This enzyme has been associated with tissue eosinophil infiltration.	95
T cell immunoglobulin and mucin domain containing 4(Tim-4)	1.707453/0.006248	Tim-4 Orchestrating M2 macrophage polarization via NFkb. It also has been associated with regulating Th2 inflammation via Sirt1 expression.	96,97
C-C motif chemokine 17(CCL17)	1.662115718/0.048951	Macrophages differentiated from bone marrow or blood monocyte progenitors of HDM-allergic mice or asthma patients show upregulation of CCL17,) upon stimulation. Rhinovirus-induced asthma exacerbation upregulated CCl17.	98,99
	1.13853857/0.047917	Yap-1 is a transcriptional coactivator involved in the Hippo signaling pathway that has been associated with asthma in animal models and human studies.	100,101
Interleukin-33(Il33)	0.8674983833/0.001419	IL-33 plays important roles in type-2 innate immunity via activation of allergic inflammation-related eosinophils, basophils, mast cells, macrophages, and group 2 innate lymphoid cells (ILC2s) through its receptor ST2.“ IL-33 has been widely associated with allergic responses and asthma	30,31
Chitinase 1(Chia1)	0.730552/0.012104	Chia1 is an enzyme that breaks down chitin, a component of fungal cell walls. Elevated levels of Chia1 have been found in the airways of asthmatic mice.	102
Surfactan Protein A1(Sftpa1)	0.40987/49.0459E-16	Sftpa1 (SP-A) was found increase in sputum samples of patient with asthma and also upregulated in patient with COPD.Surfactant protein gene A, B, and D marker alleles in COPD. Sftpd−/− mice have an impaired systemic T(H) 2 response at baseline and reduced inflammation and airway responses after allergen exposure.	103–105
Surfactan Protein B(Sftpb)	0.5959358/4.86752E-10
Surfactan Protein C(Sftpc)	0.54105922/1.7254139E-46
Surfactan Protein D(Sftpd)	0.3639906/0.0027534
chemokine receptor CXCR2 (Cxcr2)	0.490974486/0.028208471	The chemokine receptor CXCR2 is a G protein-coupled receptors that bind to the human IL-8 family chemokines. They promote neutrophil migration. This chemokine has been associated with the pathogenesis of asthma.	106,107
Cluster of differentiation 80 (Cd80)	0.7183214/0.025038	APCs express costimulatory molecules such as CD80 (B7–1). CD80 modulated T-cell function by ligation to their receptors, CD28. CD28 promotes T-cell activation and survival . CD80 upregulation has been reported in alveolar macrophages of asthmatics.	108,109

Long-term transcriptional changes in the lung epithelial cells after EL-RSV infection

To analyze long-term alteration in the lung epithelial cells, the cells were clustered based on the expression of the Epcam gene to separate all lung epithelial cells, and then the cell expression profile and cell types were annotated based on established cell markers (Fig. 2A–2B), we identified five cell subclusters in the group of epithelial cells with distinct gene expression profiles, Alveolar type I epithelial cells (AT1), Alveolar type II epithelial cells (AT2), transitional epithelial cells (AT2-AT1), and from bronchial airway epithelium, two clusters were identified Ciliated and Club cells^28,29,36 (Fig. 2B). After generating the transcriptional profile of the different clusters, we compared the lung epithelium cell distribution between the control and EL-RSV samples, and we observed that EL-RSV infection impaired the long-term cellular composition of the lung epithelial cells (Fig. 2C and 2D). Specifically, the AT2 cluster percentage was 22 % higher in the EL-RSV sample (68 %) than in control (46 %; in the case of the AT2-AT1 and AT1 clusters, the EL-RSV sample had an impaired cell composition with 4 % loss in AT2-AT1(11 %) and 10 % reduction in AT1(16 %) frequency when compared with the cell distribution observed in the control uninfected lung samples (AT2-AT1 15 % and AT1 16 %). In the bronchial epithelial cell cluster, the Club cell population was reduced by 7 % in the EL-RSV sample (8 %) compared to control (15 %). The ciliated cells population remained constant between EL-RSV infected and control with a 1 % decrease in the EL-RSV 4wpi sample (Fig. 2C and 2D). This data suggested that EL-RSV infection generated long-term changes in the cellular composition of epithelial cells, which could generate structural changes and possibly alter long-term lung function.

The differential gene expression analysis in the epithelial cell cluster identified 667 significantly upregulated genes and 662 downregulated in the EL-RSV sample compared with the control sample (Fig. 2E and Sup. Table 1). In this cluster, we identified several asthma-associated genes previously described, such as interleukin 33 (Il33),^30,31 Amphiregulin (Areg),³² BTB/POZ zinc finger protein (Zbtb16),³³ and interferon-gamma inducible protein 30 (Ifi30),³⁴ and vitamin D-binding protein (DBP)³⁵ (Fig. 2F,Table 2). It is important to note that Il33 was upregulated in 2 clusters, AT2 and AT2-AT1 (Fig. 2G and 2H, tables 3), increasing the total expression of this gene in the epithelial cell clusters. A similar effect was observed with Zbtb16, which was upregulated in AT1, AT2, AT1-AT2 subclusters, and ciliated cells (Fig. 2I, Tables 3).

Table 2.

Asthma-related genes differentially expressed in epithelial cell cluster (EpCam +).

Gene name	Log2FC/Pval.	Asthma-association and function	Ref.
AregAmphiregulin(Areg)	0.870021482/0.000000000311	Amphiregulin is a protein and a member of the epidermal growth factor (EGF) family. Amphiregulin is a cytokine that plays a role in cell signaling and has various biological functions, particularly in cell growth, tissue repair, and inflammation. Asthmatic patients have higher levels of Amphiregulin) protein in their blood and saliva compared to control subjects. This observation suggests a potential association between AREG and asthma.	32
Zinc finger and BTB domain-containing protein 16(Zbtb16)	0.835493613/1.22E-19	Zbtb16 is a transcription factor. Many biological processes are associated with ZBTB16 including stem cell maintenance and proliferation, metabolism, and immunity. Regulated alveolar cells gene expression and interferes with glucocorticoid-induced apoptosis. Zbtb16 has been reported as highly upregulated in asthmatic patients treated with corticosteroids, and SNPs at 11q23 locus with asthma in African Americans.	47,57
Interleukin -33(Il33)	0.8345012/4.88E-23	Described above.	30,31
Interferon, gamma-inducible protein 30(Ifi30)	0.81778896/1.24E-31	Encodes interferon, gamma-inducible protein 30, which is involved in superoxide anion generation. Differentially expressed between asthmatic and no asthmatic patients.	34
Vitamin D-binding protein (DBP)	0.92597133/9.64E-40	DBP variants are associated with circulating 25-(OH)D levels and with an increased risk of developing asthma in children.	35
Chitinase-like 1(Chil1)	0.66248551/1.42E-22	Chitinase-Like 1 proteins have been studied in the context of asthma due to their potential roles in allergic responses and airway inflammation. Chil1 has been associated with asthma.	110

Table 3.

Asthma-associated genes differentially expressed in EL-RSV infection in the different lung epithelial cell subclusters.

Gene name	Log2FC/Pval.	Cell Subcluster	Asthma-association and function	Ref.
Mastermind-like 3 (MAML3)	1.628461/3.09E-05	AT1	Involved with Noch signaling.MAML3 in a genome-wide association study (GWAS), was related to bronchial hyperresponsiveness severity in adults with asthma	39
ATP-binding cassette subfamily C member 4 (Abcc4)	1.62680473/ 0.01413624	AT1	Abcc4gene encodes a transmembrane protein involved in the export of proinflammatory molecules, including leukotriene, prostaglandin, and sphingosine-1-phosphate across the plasma membrane. A functional polymorphism in the ABCC4 promoter, may increase extracellular 15-hydroxyeicosatetraenoic acid, sphingosine-1-phosphate, and periostin levels, contributing to airway inflammation in asthmatics	40
Protein-tyrosine phosphatase receptor-type delta(Ptprd)	1.377732/2.67E-06	AT1	Polymorphisms of PTPRD are strongly associated with pediatric bronchial asthma in the Taiwanese population.asthma GWAS genes in children.	41,42
ENAH-VASP-like(EVL)	1.34025165/0.01106011	AT1	Multiple CpGs annotated to EVL genes in nasal samples of asthmatics In Epigenome-wide DNAm measurements differentially methylated CpGs with current asthma compared to never reporting asthma.Also, significantly differentially methylated positions of EVL were associated with Cow milk allergy in the discovery and replication samples.	43,44
Zinc Finger and BTB Domain Containing 1(Zbtb1)	1.31040849/0.00563353	AT1	Zbtb1 was differentially upregulated in children with asthma.	111
Inmmunoglobuline Superfamily Member 5(Igsf5)	1.26949357/ 0.01927978	AT1	IGSF5 has been associated with asthma in adults.	112
Zinc finger and BTB domain containing 16 (Zbtb16)	1.373534/0.004137280.79630/ 2.85E-090.56773/0.0026631.28650/0.02729071.2548799/0.006668	AT1AT2AT2-AT1Club cellsCiliated cells	Described above.Zbtb16has been reported as highly upregulated in asthmatic patients treated with corticosteroids, and SNPs at 11q23 locus with asthma in African Americans.	47,57
Hemoglobin β(Hbb-bs)	2.80748434/3.82E-13	AT2	Hemoglobin α and Hbβ expression increased in ATII cells and MLE-15 cells after induction of hypoxia, suggesting a role in hypoxic adaptation.Higher levels of airway epithelial Hbβ gene expression were associated with lower FEV1 in asthma. Higher levels of Hbβ gene expression were associated with airflow obstruction. Hbβ and eNOS were colocalized in ciliated cells, and heme affected oxidation of the NOS product. Epithelial Hb expression may be relevant to human airways diseases	63
Hemoglobin alpha, adult chain 1.(Hba-a1)	2.11819/0.00001939	AT2	Upregulated in the lung of allergic IL-13KO mice	65
Nuclear receptor Subfamily 4 Group A member 2(Nr4a2)	0.821599951564346/4.86E-05	AT2	The nuclear orphan receptor has been described as a transcription factor involved in immune regulation. It has been associated with atopy in patients with atopic dermatitis.	113
(Rho GTPase activating Protein 24)(Arhgap24)	0.62929473/2.23E-05	AT2	Arhgap24 has been identified in patients with severe asthma.	48
Amphiregulin(Areg)	0.53871962/0.00196139	AT2	Described above.Asthmatic patients have higher levels of Amphiregulin.	32
Laminin subunit beta 3 (Lamb3)	0.4694639/ 0.00073	AT2	Lamb3 was identified as a biomarker associated with the progression of childhood asthma. Lamb3 was associated with atopic dermatitis in a German case–control cohort.	49
Programmed Cell Death 4 (Pdcd4)	0.44511908/ 0.00004141	AT2	Pdcd4 on markers of macrophage alternative activation and airway remodeling knockdown of Pdcd4 suppressed airway eosinophil infiltration	55
Enhancer of zeste homolog 2 (Ezh2)	0.4391442/0.0307	AT2	EZH2 upregulated in animal model of asthma. EZH2 promotes asthma progression.involvement in the progression of COPDas a key regulator of fibrosis in injured lung epithelium	50,51
Interleukin -33(Il33)	0.3367/0.00180.61698/	AT2AT2-AT1	Described above.IL-33 has been widely associated with allergic responses and asthma.	30,31
Bromodomain-containing protein 4(Brd4)	0.3441882/ 0.00066	AT2	Bromodomain and extra-terminal domain (BET) proteins are epigenetic modulators that regulate gene transcription through interacting with acetylated lysine residues of histone proteins. Brd4 mediates aeroallergen-induced inflammation and remodeling.	56
Potassium Channel Tetramerization Domain Containing 3(Kctd3)	0.3960/0.0408812	AT2	Bromodomain and extra-terminal domain (BET) proteins are epigenetic modulators that regulate gene transcription through interacting with acetylated lysine residues of histone proteins. Brd4 mediates aeroallergen-induced inflammation and remodeling.	56
Elastin(Eln)	0.422546/ 0.00553	AT2	Elastin is increased in patients with severe asthma.	53
FH506-binding protein 5(Fkbp5)	1.05238968/5.58E-05	AT2-AT1	FKBP51 is a major component of the glucocorticoid receptor. FKBP5 polymorphism has been associated with asthma susceptibility in asthmatic patients.	66
DNA damage-inducible transcript 4(Ddit4)	0.49671763/0.00312869	AT2-AT1	Ddit4 is part of the eight common glucocorticoid gene set and it has been related with lung development, asthma, and asthma treatment response. It has been reported a differential expression of DDIT4 between Subjects with Asthma and No asthmatic Control Subjects in Asthma BRIDGE.	66
Syntaxins 6(Stx6)	1.9140274/0.0269939	Club cells	STX6 may be one of the genes associated with atopic asthma.	69
Claudin 5(Cldn5)	−0.77977/0.01554	Club cells	The tight junction protein claudin-5 (CLDN5) is critical to the control of endothelial cellular polarity and pericellular permeability CLDN5 level decreased in patients with COPD. Other claudins have been linked with asthma, such as Claudin-18 deficiency is associated with airway epithelial barrier dysfunction and asthma.	72
Secretoglobin Family 3A Member 1(Scgb3a1)	5.86080606 /0.01812431	Ciliated cells	The human SCGB3A1 gene is located at 5q31–q35, which has been suggested to be an asthma susceptibility region. Its expression is up-regulated by retinoic acid-induced differentiation of human bronchial epithelial cells, suggesting a role for SCGB3A1 in mucinous epithelial cell differentiation. Encodes cytokine-like proteins predominately found in airway epithelium.	114
Surfactant protein A1(Sftpa1)	1.408448/ 0.01790	Ciliated cells	This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens.Polymorphisms within SFTPA loci may be associated with wheezing and persistent cough in white infants at risk for asthma. Mutations in this gene are associated with idiopathic pulmonary fibrosis. SFTPA has been associated with severe RSV infection in infants.	115,116
Mitogen-activated protein kinase 13(Mapk13)	1.2444950/ 0.00495	Ciliated cells	MAPK13 that is responsible for IL-13–driven mucus production in human airway epithelial cells and is necessary for IL-13–induced mucus production. Human CLCA1 activates MAPK13 which in turn conveys a signal to stimulate MUC5AC mucin gene expression.	74
Cardiomyopathy-associated 5 (Cmya5)	1.213013/0.0291976	Ciliated cells	Cmya5 was a top 50 DEGs inTranscriptome-wide association study of atopic asthma in nasal epithelium, observed in 3 different cohorts.Upstream regulatory analysis predicted activation of the IL-13 pathway	117
Epithelial Membrane Protein 1.(Emp1)	1.109060/0.024053	Ciliated cells	Emp1 has been reported upregulated in bronchial epithelial cells after controlled allergen challenge in asthmatic patient.	75
Mammalian target of rapamycin (Mtor)	1.01061092/0.00902551	Ciliated cells	Activation of the mTOR signaling pathway is required for asthma onset. mTOR is suppressed during asthma remission, and inhibiting the mTOR pathway in asthmatic mice alleviates asthmatic markers and restores the balances of Th17/Treg and Th1/Th2 cytokines.	76

Interestingly, we also observed significant upregulation of genes related to lung remodeling and altered pulmonary function, like chitinase-like 1 (Chil1),³⁶ Elastin (Eln),³⁷ and Collagen VI (Col6)³⁸ (Sup. Table 1).

In the AT1 subcluster, we identified 406 upregulated and 275 downregulated genes in the EL-RSV group (Sup. Table 2). Here, we identify several asthma-related genes significantly upregulated in the AT1 subcluster: Mastermind-like 3 (MAML3),³⁹ ATP-binding cassette subfamily C member 4 (Abcc4),⁴⁰ protein-tyrosine phosphatase receptor-type delta (Ptprd),^41,42 ENAH-VASP-like (EVL),^43,44 Zinc Finger And BTB Domain Containing 1 (Zbtb1) (Table 3). Interestingly, we identified upregulation of glutathione S-transferase C-terminal domain containing (Gstcd), which has been related to changes in lung function⁴⁵, and Collagen VI alpha 1 chain (Col6a1) that has been reported related to lung restructured/fibrosis⁴⁶ (Sup. Table 2).

In the AT2 subcluster, 223 significantly upregulated 351 downregulated genes were identified in the infected group (Sup. Table 4). In the AT2 subcluster, several asthma-related genes were identified: Zbtb16,⁴⁷ Rho GTPase-activating protein (Arhgap24)⁴⁸ Amphiregulin (Areg),³² Laminin subunit beta 3 (Lamb3),⁴⁹ Enhancer of zeste homolog 2 (Ezh2),^50,51 Il33,^30,31 and Potassium Channel Tetramerization Domain Containing 3 (Kctd3)⁵² (Table 3). Interestingly, we identified genes related to lung remodeling in asthmatic airways. These include Elastin (Eln),^53,54 Programmed Cell Death 4 (Pdcd4),⁵⁵ Bromodomain 4 (Brd4),⁵⁶ and secreted protein acidic and rich in cysteine (Sparc). These genes are related to irregular epithelialization in lung fibrosis, lung injury, and repair.⁵⁷ Additionally, we observed increased expression of genes involved with AT2 cell trans-differentiation, such as bone morphogenetic protein (Bmp2),^58,59 Keratin 8 (Krt8),^60,61 SRY-Box Transcription Factor 5 (Sox5).⁶² Finally, we also observed highly upregulated genes related to Hemoglobin α and Hemoglobin β adult chain (Hbb-bs, Hba-a1 and Hba-a2) expression. These latter genes have been reported to be upregulated in lung epithelial cells after hypoxia induction and associated with hypoxia adaptation and airflow obstruction, with Hba-a2 also being related to the modulation of eNOS activity.^63–65

In the subcluster of AT2-AT1, we identified a total of 300 upregulated and 398 downregulated genes in the EL-RSV 4wpi sample (Sup. Table 5). Of these genes, we have discovered multiple genes related to asthma; among those are FKBP Prolyl Isomerase 5 (Fkbp5),⁶⁶ Il33,^30,31 Zbtb16⁴⁷, and DNA Damage Inducible Transcript 4 (Ddit4).⁶⁶ Interestingly, we observed the upregulation of the Carboxypeptidase M (CPM) gene, which cleaves the C-terminal arginine and lysine of peptides and is an indicator of AT1 cell injury in parenchymal lung disease.^67,68 Like the AT2 cluster, we observed upregulation of the genes Hbb-bt, Hba-a2, and Hbb-bs. Additionally, we identified genes related to AT2-AT1 cell transdifferentiation, such as Bmp2 upregulation and significant downregulation of the Retinoic acid RA-catabolizing Cyp26 enzyme (Cyp26b1); these enzymes metabolize RA into inactive forms and the loss of Cyp26b1 has been related with the reduction of AT1 and increased in AT2 cells.^67,68

Several genes were significantly differentially expressed between the airway epithelial clusters (Sup. Table 6 and 7). The asthma-related genes differential expressed in the club cells subcluster were Zbtb16⁴⁷ and Syntaxin 6 (STX6)⁶⁹ (Table 3). Interestingly, we observed high upregulation of surfactant protein C (Sftpc) in Club cells of EL-RSV-infected mice; upregulation of this gene has been described in Club cells that generated new AT2 cells after lung damage.⁷⁰ We also observed the differential expression of genes related to lung remodeling processes and chronic obstructive pulmonary disease (COPD), like upregulation of Insulin-like growth factor binding protein-5 (Igfbp-5),⁷¹ and downregulation of Claudin 5 (Cldn5).⁷²

Finally, in the subcluster of ciliated cells, we searched for the asthma-related genes and identified differential expression of Secretoglobin Family 3A Member 1(Scgb3a1),^73, Zbtb16,⁴⁷ mitogen-activated protein kinase 13 (Mapk13),⁷⁴ cardiomyopathy-associated 5 (CMYA5) gene,⁷⁴ epithelial Membrane Protein 1 (Emp1),⁷⁵ mammalian target of rapamycin (Mtor), and downregulation of TNF alpha-induced protein 3 (Tnfaip3)⁷⁶ (Table 3).

In the lung epithelial cluster, we identify important genes related to the ATII cell trans-differentiation and AT1 cell damage, suggesting a possible long-term defect in alveolar epithelial transition that can lead to defects in lung repair after injury. Furthermore, several asthma-related genes were identified, such as IL-33, that has been widely studied and recognized as an important cytokine in the pathophysiology of asthma in humans. Here, we observed that this gene is highly upregulated in the whole lung, with high expression in the subcluster of alveolar epithelial cells. Suggesting that alveolar epithelial cells, specifically AT2, presented long-term phenotypic alteration after EL-RSV infection that could promote persistent type 2 immune response.

Early-life RSV infection generates acute and long-term changes in AT2 cells

To validate the long-term phenotypic alteration in the AT2 population after in vivo EL-RSV infection, as well as to assess the acute changes in these cells, we harvested AT2 cells from EL-RSV infected mice at two-time points: 7 days post-infection (7dpi) for acute changes, and at 4 weeks-post-infection (4wpi) to study the long-term changes (Fig. 3A).

Fig. 3. Early-life RSV infection generates acute and long-term changes in AT2 cells.

A) Animal model, B-F) Cultures of primary alveolar type II epithelial cells (AT2) harvested from EL-RSV infected Balb/c mice at 7 days post-infection (7dpi), with or without IL-1ra treatment, showing the expression levels of Il1r1, Tslp, Il33, Ccl2 and Il1β. G and J) AT2 cells harvested from EL-RSV 4 weeks post-infection (4wpi), with or without IL-1ra treatment during EL-RSV infection, showing gene expression levels of Il33, Zbtb16, Krt8, and Bmp2. Data represent mean ± SEM. **p < 0.01, ***p < 0.001, ****p < 0.0001. N=4 mice per group. Three experimental repeats.

We have shown that RSV infection upregulates the IL-1β pathway in infants.²⁷ To investigate the impact of IL-1 upregulation during EL-RSV infection and its influence on the AT2 cells, we treated a group of neonates with IL-1ra (EL-RSV+IL1ra) to inhibit IL-1 signaling during infection (Fig. 3A). We observed that primary cultures of AT2 cells harvested from EL-RSV infected mice at 7dpi had significantly increased expression of the innate receptor Il1r1, and the proinflammatory cytokines Il33, Tslp, Ccl2, and Il1β were upregulated in the AT2 cells harvested from EL-RSV group when compared to cells harvested from uninfected control mice. These effects were inhibited in the mice treated with IL1ra during infection EL-RSV/IL1ra (Fig. 3B–F), showing the critical role of IL-1β signaling during acute RSV infection. Next, to evaluate the long-lasting changes in the AT2 cells after EL-RSV infection, we harvested AT2 cells from mice at 4 weeks post-infection. We observed that the cells harvested from EL-RSV infected mice expressed persistently increased expression of Il33 and Ztbtb16 when compared with cells from naïve mice, and the AT2 cells harvested from EL-RSV/IL1ra group did not show differences when compared with the naïve (Fig. 3G and H). Krt8 and Bmp2 were also upregulated in the AT2 cells from the EL-RSV group, corroborating the data of scRNA-seq. Interestingly, the treated EL-RSV/IL1ra group did not show differences compared to the naïve (Fig. 3I and J). Thus, these data showed that EL-RSV infection generated long-lasting modification in the alveolar epithelium, which affects the expression of asthma-related and genes related to AT2-AT1 transdifferentiation, suggesting that EL-RSV infection generated long-term phenotypic alteration on AT2 cells and may be dependent of IL-1 signaling during acute infection. To evaluate the long-term alteration in the percentage of alveolar epithelial cells in the lung of mice after EL-RSV infection 4wpi, we performed lung immunofluorescence. We observed a significant increase in the percentage of AT2 cells in the lungs of EL-RSV-infected mice compared to control mice. However, there were no differences in the percentage of AT2 cells between the EL-RSV/IL1ra group and the control group. Additionally, the percentage of AT1 cells was slightly reduced in the EL-RSV-infected group (Sup Fig.3A and B). Suggesting that EL-RSV infection generated long-term alteration in the percentage of alveolar epithelial cells, and those alterations may lead to changes in lung structure.

Early-life RSV infection generates long-lasting changes in the lungs that exacerbate allergic responses

To study the long-term alteration of the lung after EL-RSV infection, we used a fungal allergen Alternaria alternata (AA) extract implicated in severe asthma in humans.⁷⁷ We challenge mice with AA for five consecutive days after 4 weeks of EL-RSV infection (Fig. 4A). We observed that EL-RSV infection exacerbated the allergic response to AA at 4wpi (EL-RSV+AA), with a significant increase expression of mucus-related genes Muc5a and Gob5 (Fig. 4B and C) and proinflammatory cytokines Il13, Il4, Il1β and Il33 in the lung, this effect was attenuated in the group of mice treated with IL1ra during infection (EL-RSV/IL1ra + AA) (Fig. 4D–G). Lung inflammatory infiltration was evaluated by flow cytometry, and the EL-RSV+AA group presented a subtle increase in the total numbers of ILC2 cells and a significantly elevated difference in the numbers of interstitial macrophages compared to the AA control. The number of ILC2 and Interstitial macrophages were diminished in the IL-1ra-treated mice (Fig. 4H and I); no other differences were observed in other immune cells. The increased numbers of ILC2 in the EL-RSV+AA group correlated with the upregulation of IL-33, a known activator of ILC2 in the lung. Additionally, we harvested AT2 cells from these mice and observed that AT2 cells from EL-RSV+AA presented upregulated expression of Il-33 when compared with AT2 cells from control allergic mice and the treated group (EL-RSV/IL1ra + AA). Finally, in the histology section of lung tissue stained with periodic acid-Schiff (PAS), we observed increased mucus deposition in the airways and inflammatory infiltration in the EL-RSV group (Fig. 4K), and elevated production of IL-33 (Fig. 4L), which correlated with increased mucus-related gene and Il33 expression in the lung and AT2.

Fig. 4. Early-life RSV infection generates long-lasting changes in the lung that exacerbate allergic responses.

A) Animal model: EL-RSV-infected mice were challenged with AA at 4wpi for five consecutive days. B) Lungs were harvested and homogenized, and mRNA was extracted to determine gene expression, B) Muc5ac and C) Gob5 mucus-related gene, D) Il13 E) Il4 F) Il1β and G) I33 expression in the lung. Flow cytometry, H) Innate lymphocyte cells type 2 ILC2 and I) Interstitial macrophages. AT2 cells harvested from control or EL-RSV infected mice after allergen challenge, showing gene expression J) Il33. K) Lung histopathology Periodic acid-Shiff (PAS). Confocal microscopy of lung samples L) IL-33 immunostaining in green and DAPI in blue, white box. Scale bar (white box left) 100 μM. Data represent mean ± SEM. **p < 0.01, ***p < 0.001, ****p < 0.0001. N=4–8 mice per group. Two experimental repeats.

Altogether, these data suggest that the exacerbated effect after the allergen challenge was driven by long-term alteration in the epithelium generated during EL-RSV infection, which is dependent upon IL-1 signaling.

Early-life IL-1β exposure generates long-lasting changes in the lung that exacerbate allergic responses

To further investigate the role of IL-1β in long-term alteration in the lung epithelium during early life, we administered recombinant murine IL-1β (ng/mouse) intranasally to 7-day-old neonates for five days (EL-IL-1β) (Fig. 5A). After 4 weeks post-treatment (4 wt), AT2 cells were harvested and cultured for analysis. We observed that AT2 harvested from EL-IL-1β mice presented increased expression of Il33 (Fig. 5B) and Krt8 and Bmp2 (Fig. 5C and D) compared with controls, suggesting that EL-IL-1β generated persistent changes in the AT2 population. To evaluate this effect, we performed lung immunofluorescence in samples of EL-IL1β treated mice at 4wpt. We observed a significant increase in the percentage of AT2 cells in the lungs of EL-IL1β mice and a significant reduction in the percentage of AT1 cells compared with control mice (Sup Fig. 3A and B). Suggesting that EL-IL-1β exposure generated persistent changes in the percentage of AT2 and AT1 populations.

Fig. 5. Early-life IL-1β infection generates long-lasting changes in the lung that exacerbate allergic responses.

A) Animal model: AT2 cells were harvested from control or EL-IL-1β treated at 4wpi. EL-IL-1β exposure mice were challenged with Alternaria alternata (AA) at 4 weeks post-treatment for five consecutive days. AT2 cells were harvested at 4wpi, and gene expression was analyzed B) Il33, C) Krt8, and D) Bmp2. Lungs were harvested after the allergen challenge, and mRNA was extracted to determine gene expression E) Il4, F) Il1β, and G) II33 expression in the lung. Flow cytometry H) ILC2. I) Lung histopathology Periodic acid-Shiff (PAS). J) Muc5a mucus-related gene expression. Confocal microscopy of lung samples K) IL-33 immunostaining in green and DAPI in blue. Data represent mean ± SEM. **p < 0.01, ***p < 0.001, ****p < 0.0001. N=4–8 mice per group. Two experimental repeats.

To evaluate if EL-IL-1β exacerbates lung allergic response, EL-IL-1β mice and control mice were challenged with A. alternata (EL-IL-1β + AA) (Fig. 5A). The lung of the EL-IL-1β + AA mice exhibited significantly increased expression of proinflammatory cytokines Il4, Il1β, and Il33 when compared with naïve-AA challenged (AA) group (Fig. 5E–6G). The lung of EL-IL-1β + AA presented significantly increased numbers of ILC2 cells compared with controls (Fig. 5G); no other differences were observed in other immune cells. The lung histology of the EL-IL-1β + AA group showed increased levels of inflammatory infiltrates and mucus deposition in the airways (Fig. 5I) that correlated with the expression of the mucus-related gene Muc5a (Fig. 5J). Finally, IL-33 production in the lung of EL-IL-1β mice was higher by immunostaining, corroborating with the expression of Il33 in the whole lung and AT2 cells. Thus, EL-IL-1β could have a decisive role in the long-term alteration observed in the lung epithelium after EL-RSV infection.

Fig. 6. Epigenetic modification in the AT2 cells.

ChIP-PCR on primary cultures of AT2 cells to identify active epigenetic marks (H3K4me3) on Il33 gene promoter. A) EL-RSV 4wpi and control and B) EL-IL1β and control. Data represent the mean ± SEM. *p < 0.05,**p < 0.01. N=9–12 mice per group, 3–4 mice pooled separately to generate triplicated. Three experimental repeats.

Early-life RSV infection generates long-lasting epigenetic modification in the alveolar epithelium

Epigenetic alteration of the cells modifies gene expression without changing the underlying DNA code. Long-term alteration in the lung epithelial cells could be linked to epigenetic modifications after EL-RSV infection. To identify the specific epigenetic modifications after EL-RSV infection, we performed ChIP-PCR on primary cultures of AT2 cells to identify active epigenetic marks (H3K4me3) that could elucidate the exacerbated and persistent expression of Il33. AT2 cells were harvested from control and EL-RSV infected mice after 4wpi, and ChIP-PCR analysis was conducted as described previously,⁷⁸ using specific antibodies against H3K4me3 or IgG-control antibody. The purified DNA was subjected to quantitative real-time PCR analysis using primers targeting the promotor of Il33. The EL-RSV group exhibited a significantly increased H3K4me3 mark in the Il33 gene promoter when compared to controls, and interestingly, in the EL-RSV/IL1ra group, a decreased H3K4me3 mark was observed when compared with the EL-RSV group (Fig. 6A). Furthermore, we tested if EL-IL1β exposure, was linked with the epigenetic modification in the AT2 cells and observed that cells harvested from EL-IL1β mice presented increased H3K4me3 mark in the promoter of Il33 gene. (Fig. 6B). These findings suggest that the EL-RSV infection generated epigenetic modification to the Il33 promoter on AT2 cells, contributing to the long-term pro-asthmatic immune environment. Furthermore, the data highlight the critical role of IL-1β in the changes in lung epithelial responsiveness.

Discussion

The current studies demonstrate that EL-RSV infection induced long-term lung epithelial cell alteration, exacerbating allergic response later in life. This study identified transcriptional and epigenetic modifications in the alveolar epithelial type 2 cells that generated long-term effects after EL-RSV infection; among the asthma-related genes differentially expressed in the lung epithelial cells after EL-RSV infection was Il33, which has been widely associated with allergic responses and asthma.^30,31 Interestingly, a rare mutation that generates a loss of function of IL-33 has been shown to protect from asthma development.⁷⁹ Importantly, clinical studies have reported that the use of itepekimab, a monoclonal antibody against IL-33, resulted in a reduction of events of asthma control loss and improved lung function in patients with moderate to severe asthma, compared to the placebo. This demonstrates the significant role of this cytokine in asthmatic patients.⁸⁰

In this work, we identified significant upregulation of Il33 in AT2 and AT2-AT1 cell subclusters (Fig. 2F and 2H), and Il33 was one of the top genes differentially expressed in the epithelial cluster (Fig. 2E). The lung immune clusters also contribute to the whole lung upregulation of Il33, although not as significant as the alveolar epithelium. In this work, we observed that EL-RSV infection long-term alteration in the AT2 cells generates persistent upregulation of IL-33 that exacerbates allergic response by increasing the recruitment and activation of ILC2, as it is led by IL-33 upregulation^30,31 (Fig. 7).

Fig. 7.

Early-life RSV infection generates long-term alteration in AT2 cells and persistent upregulation of asthma-associated genes in the lung epithelium.

We also identified epigenetic alterations in the promoter of the Il33 gene, suggesting a mechanism that leads to persistent upregulation of the gene and elevated expression during allergy. Another interesting top gene differentially upregulated was the BTB/POZ zinc finger protein (Zbtb16); this gene was upregulated in the AT2, AT2-AT1, AT1, and ciliated subclusters (Fig. 3I). Zbtb16 is a transcription factor detected as highly upregulated in asthmatic patients treated with corticosteroids. Previous studies suggested that increased expression of ZBTB16 could reduce inflammatory signaling and gene expression.⁴⁷ The interferon-gamma inducible protein 30 (Ifi30) was a top-upregulated gene in the epithelial cluster and highly upregulated in the AT2, AT2-AT1, and Ciliated subcluster. Ifi30 is involved in superoxide anion generation and has been differentially expressed between asthmatic and non-asthmatic patients.³⁴ Finally, vitamin D-binding protein (DBP), was highly upregulated in the epithelial cluster and detected upregulated in AT2, AT2-AT1, Club, and the Ciliated subcluster. DBP variants have been associated with circulating 25-(OH) D levels, which could be associated with an increased risk of developing asthma in children.³⁵ Our data indicate that the EL-RSV infection significantly modifies lung epithelial cell subsets, leading to a pro-asthmatic lung environment that may be central to lung disease severity later in life (Fig. 7).

One of the most affected cell types was the alveolar epithelial cell subsets, with a 22 % increase in AT2 and a 4 % and 10 % decrease in AT2-AT1 and AT1 cell clusters, respectively. We confirmed these observations by staining AT1 and AT2 cells in lung tissue and noting changes in the AT1 to AT2 cell ratio in the lungs of EL-RSV-infected mice. This effect was mitigated in the EL-RSV/IL1ra group but exacerbated in the EL-IL1β mice. These findings suggest that during EL-RSV infection, upregulation of IL-1β leads to long-term changes in alveolar epithelial cells.

One interpretation of these findings may relate to the trans-differentiation process of AT2; these cells differentiate into AT1 to restore the alveolar architecture and function after lung injury.⁶¹ In our data, the AT2 cluster presented upregulation of bone morphogenetic protein (Bmp2) and Keratin 8 (Krt8) gene. AT2 trans-differentiation requires Bmp2 downregulation and, when upregulated, inhibits TGF-β signaling and delays trans-differentiation by inhibiting the gain in AT1 cell-specific gene expression.^58,59 Likewise, Krt8 has also been described in the trans-differentiation process and is highly upregulated during early differentiation and downregulated during late differentiation. High expression of Bmp2 and Krt8 in AT2 cells likely causes alteration in alveolar epithelial cell development^60,61 and may lead to alveolar regeneration defects after lung injury. These findings may contribute to lung dysfunction observed later in life in children with severe RSV infection during infancy. Moreover, we have identified that early-life respiratory virus infection can alter lung structure and function long-term.⁸¹

A number of genes related to AT1 homeostasis and injury were upregulated. In the AT2-AT1 subcluster, we detected upregulation of Carboxypeptidase M (Cpm), which was suggested to be indicative of AT1 cell injury.⁸² Interestingly, there is significant downregulation of the Retinoid acid RA-catabolizing Cyp26 enzyme (Cyp26b1), which metabolizes RA into inactive forms. It has been reported that the loss of Cyp26b1 leads to reduced AT1 cells, failure of alveolar inflation, and early postnatal lethality in mice, as well as failure of distal lung epithelial differentiation, with increased AT2 and decreased AT1 cell types,⁶⁷ as observed in our cell distribution data with increased AT2 and decrease AT1 percentage in the EL-RSV group. Additionally, we identify genes related to remodeling in the epithelial cells cluster, such as Elastin, Chitinase-like 1, Collagen VI, and glutathione S-transferase GSTCD, that may be indicative of lung remodeling processes, that usually appear after defective lung injury repair, as seen in COPD.

Previous studies have shown that RSV infection upregulates the IL-1β pathway in infants, and IL-1β upregulation is associated with severe RSV infection.²⁷ Interestingly, others have shown that induction of IL-1β by doxycycline administration in pups on postnatal (PN) days 0, 0.5, and 1 leads to increased numbers of macrophages and neutrophils on PN21. At PN84, they observed larger alveoli, thicker alveolar walls, goblet cell hyperplasia, and increased airway reactivity to methacholine, suggesting that EL-IL1β influences chronic lung disease in adulthood.⁸³ The role of IL-1β signaling during allergic asthma in an animal model has been studied using an IL-1R1-deficient mouse. It has been reported that these mice presented decreased pulmonary eosinophilia and goblet cell hyperplasia and reduced Th2 responses.⁸⁴ In this work, we characterized the role of IL-1β upregulation during EL-RSV infection and its role in the long-term alteration of the lung epithelium. We observed that IL-1 signaling inhibition diminished the exacerbated allergic response generated by EL-RSV infection in the A. alternata model by inhibiting long-term changes in the AT2 cells, decreasing inflammatory response and mucus production in the airways. These findings suggest that inhibiting the IL-1 pathway during severe EL-RSV infection could be beneficial. The role of IL-β in the long-term alteration of the alveolar epithelial cells was corroborated by exposing neonates to intranasal IL-1β and recapitulating many of the pathologic changes observed by EL-RSV infection, such as AT2 persistent upregulation of IL-33 and the epigenetic changes in the promoter of Il33 gene, suggesting that IL-1β upregulation during EL-RSV infection is critical for generating long-term AT2 alteration and the subsequent allergic exacerbated response. It has been shown that hyperoxia-exposed neonatal mice have increased caspase-1 activation and IL-1β production, increased inflammatory response, and decreased alveolarization. This effect was attenuated in NLRP3 −/− mice and neonatal mice treated with IL-1ra, suggesting that hyperoxia caused by oxygen therapy could be activating the NLRP3-inflammasome-IL-1β pathway and generating lung structural changes, such as alveolar simplification,⁸⁵ highlighting the impact of IL-1β upregulation in the neonatal lung. Here, we observed that AT2 cells harvested from EL-IL1β exposure mice presented persistent upregulation of Krt8 and Bmp2, suggesting that a high concentration of IL-1β in the lung of neonates could change the transcriptional phenotype of the AT2 cells, as observed in EL-RSV infected mice, and contributing to the long-term lung changes.

It is interesting to speculate on the longevity of these responses. A recent large clinical study in Lancet has indicated that patients who experienced severe lower respiratory tract infection by two years of age (RSV the most common) have twice the risk of dying prematurely from respiratory disease,⁵ indicating a significant consequence of early life pulmonary infection. Thus, understanding the cellular and molecular mechanism that leads to phenotypic changes in the lung epithelium may help identify different prophylactic or therapeutic targets to prevent or control post-viral influence on allergic asthma and strategies to evaluate long-term alteration after early-life RSV infection.

Material and methods

Animal models

The University of Michigan Institutional Animal Care & Use Committee approved all experiments involving the use of animals. Female BALB/c mice, 6–8 weeks of age, were purchased from The Jackson Laboratory (Bar Harbor, ME). These were bred 1:1 male and female to produce neonates. Each litter underwent a uniform treatment condition, and the multiple litters underwent different treatment conditions at the same time. Treatment conditions were replicated across various mice cohorts. Standard pathogen-free conditions were maintained in the Unit for Laboratory Animal Medicine at the University of Michigan. We have reported sex differences in long-term alteration in mice, where males had more severe allergic responses after EL-RSV infection.¹⁸ Based on this information, we used male mice for all the experiments in this work.

RSV virus and Early-life RSV infection (EL-RSV)

A chimeric RSV A2 strain with recombinant Line19 fusion protein⁸⁶ was used for all experiments. To better understand the long-term effects of EL-RSV infection in the respiratory epithelium, in this work, we used 7-day-old mice for EL-RSV infection, as the lungs of neonatal mice represent the lungs of a newborn human infant.⁸⁷ We used our established neonatal animal model with mice bred in-house to maintain environmental uniformity.^26,27 Neonatal Balb/c mice were intranasally infected with RSV (1 X 10⁵ PFU/mouse) at 6–7 days old. Control mice were mock infected using saline.

We have shown previously that the virus is completely cleared in our EL-RSV infection model at 14 days post-infection.¹⁸ To understand the role of IL1β in the lung long term alteration, as we saw before the important role of IL1β in RSV pathology we used IL-1 receptor antagonist (IL1ra).²⁷ The mice were treated starting from day 1 (24 h after infection) to 6 daily with 5 μL/animal of recombinant murine IL-1ra (at 0.2 μg per mouse, approximately 0.08 mg/kg) or saline intranasally during infection. The viral response was analyzed 7 days and 4 weeks post-infection to determine the primary response and long-term alteration.

Allergy model

Mice were sensitized with Alternaria alternata (AA) (50ug) for five consecutive days, and samples were harvested after the last sensitization. This was performed at 4 weeks post-EL-RSV infection (4wpi) or 4 weeks post IL-1β treatment (4wpt). This protocol allowed us to examine the activation of the lung epithelium since Alternaria A. has intrinsic serine protease activity that elicits the release of epithelial-derived cytokine (IL-33), which generates rapid pulmonary inflammation and mucus release. In addition, we can assess allergic response after neonatal infection (Fig. 1A).

Early-life IL-1β animal model

EL-IL1β:

Recombinant IL-1β (Peprotech, Cranbury, NJ) was administrated intranasally (250 ng/mice/5ul) daily for five days to 7-day-old mice. Control animals were treated with saline intranasally. Analysis of the AT2 cells was performed 4 weeks post-treatment. The allergy model was performed after 4 weeks post-treatment as described before.

Quantitative RT-PCR

Lung tissue was homogenized in TRIzol reagent, and RNA was extracted following manufactured recommendation (Invitrogen, Carlsbad, CA). cDNA was synthesized using murine leukemia virus reverse transcriptase (Applied Biosystems, Foster City, CA) and incubated at 37 °C for one hour, followed by incubation at 95 °C for 10 min to stop the reaction. Real-time quantitative PCR (qPCR) was multiplexed using TaqMan primers with a FAM-conjugated probe and VIC- conjugated probe (Applied Biosystems). Fold change was quantified using the 2 ^−ΔΔcycle threshold (CT) method. Custom primers were designed to measure Muc5ac and Gob5 mRNA levels as described before.²⁷ All reactions were run on a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA).

Lung histology

The left lung was perfused with 4 % (vol/vol) formaldehyde for fixation and embedded in paraffin. Five-micrometer lung sections were stained with periodic acid-Schiff (PAS) to detect mucus production, and inflammatory infiltrates. Photomicrographs were captured using a Zeiss Axio Imager Z1 and AxioVision 4.8 software (Zeiss, Munich, Germany).

Flow cytometry

The lungs were removed to analyze the leukocyte population described in.¹⁵ Lung single cells were isolated by enzymatic digestion with 1 mg/ml collagenase A (Roche, Indianapolis, IN) and 20 U/ml DNase I (Sigma, St. Louis, MO) in RPMI 1640 containing 10 % fetal calf serum (FCS). Tissues were further dispersed through an 18-gauge needle (10-ml syringe), RBCs were lysed, and samples were filtered through 100-μm nylon mesh twice. Cells were resuspended in PBS, and live cells were identified using a LIVE/DEAD Fixable Yellow Dead Cell Stain kit (Thermo Fisher Scientific, Waltham, MA), then washed and resuspended in PBS with 1 % FCS and Fc receptors were blocked with purified anti-CD16/32 (clone 93; BioLegend, San Diego, CA). Surface markers were identified using Abs (clones) against the following antigens, all from BioLegend: anti-Gr-1 (RB6- 8C5), B220 (RA3-6B2), CD3 (145-2C11), Ter119 (Ter-119), CD11b (M1/70), CD25 (PC61), CD45 (30-F11), c-Kit (2B8), CD90 (53-2.1), CD11c (N418), MHCII (M5/114.15.2), CD103 (2E7). SiglecF (E50-2440) was purchased from B.D. Biosciences (San Jose, CA). For innate lymphoid cell type 2 (ILC2) staining, lineage markers were anti-CD3, CD11b, B220, Gr-1, and TER119. ILC2: Lin-CD45 + CD90 + ICOS+c-Kit + GATA3 + . Eosinophils: SSC^high CD11b + SiglecF+. Neutrophils: SSC^high CD11b + SiglecF- GR-1 + . DC: CD64-CD11b + CD11c + MHCII+. Interstitial macrophages: CD64 + CD11b + F4/80 + . Data was collected using a NovoCyte flow cytometer (ACEA Bioscience, Inc. San Diego, California). Data analysis was performed using FlowJo software (Tree Star, Oregon, U.S.A.).

Mouse alveolar type II (AT2) epithelial cells isolation and primary culture

The isolation and primary cultures of AT2 were performed following the reported protocols.⁸⁸ In brief, whole lungs of mice were digested in Dispase (BD Biosciences), filtered through the 25-μm mesh filter, and depleted of immune cells by labeling with biotinylated antibodies to CD16/32 and CD45 (BD Pharmingen), followed by labeling with anti-biotin microbeads and passage through a MACS column (Miltenyi Biotec, Bergisch Gladbach, Germany). Depleted cell suspensions were adherence-purified overnight in DMEM-based complete media. Non-adherent cells were cultured in complete media within fibronectin-coated wells for two days, yielding ≥ 90 % E-cadherin-positive cells, as shown previously.²⁴ The cells were maintained at 37 °C, 5 % CO₂.

Tissue immunostaining and confocal microscopy

Lung sections were immunostained as previously described.⁸⁹ In brief, lung sections were deparaffinized in xylene, hydrated with graded ethanol solutions, and equilibrated to water. Antigen retrieval was performed by boiling slides in Target Retrieval Solution (Dako, Santa Clara, CA) for 20 min. Sections were then blocked in 2 % BSA in Tris-buffered saline with 0.05 % Tween, followed by incubation with anti–IL–33 polyclonal antibody (Thermo Fisher Scientific, Waltham, MA), and then Alexa 488 conjugated anti-goat secondary antibodies (Thermo Fisher Scientific, Waltham, MA). Slides were mounted with Vectashield HardSet mounting medium with DAPI (Vector Laboratories, Burlin-game, CA). Digital images were acquired using an A1 confocal Nikon microscope. The AT1 cells fluorescent staining used a hamster anti-podoplanin (Jackson Immuno, Cat. No. 8.1.1; 1:500 dilution), followed by a secondary goat-anti-hamster-FITC (Jackson Immuno, Cat. No. 107-095-142; 1:1000 dilution). The AT2 cells were stained using a primary rabbit-anti-ProSPC (Millipore, Cat. No. AB3786: 1:500 dilution), followed by a secondary donkey-anti-rabbit-Cy3 (Jackson Immuno, Cat. No. 711-166-152; 1:1000 dilution). Analysis and cell quantification were performed using the cell image analysis software CellProfiler version 4.2.6.^90,91

Single-cell RNA sequencing and data analysis

Mice were euthanized at 4wpi by 10 μl/g i.p. injection of pentobarbital sodium (CDMV, Saint-Hyacinthe, QC, Canada). Following euthanasia, the chest was opened, and the abdominal aorta and vena cava were cut above the liver. The left atrium was perforated, and the lungs were perfused with PBS until entirely white. We combined lung samples from 3 mice in each group sequenced to obtain sample heterogeneity, using male mice in both groups (Control- naïve and EL-RSV infected). Lungs were removed, dissected into individual lobes, and then digested by combined enzymatic and mechanical dissociation as described previously.¹⁵ Next, to maintain an equitable representation of distinct cell types within our samples, CD45 cells were positively isolated using Microbeads (Miltenyi Biotec, Gaithersburg, MD). Subsequently, one-third of the isolated CD45 cells were reintroduced into the original sample. scRNA-seq was performed using approximately 10,000 cells in Chromium Next GEM Single Cell 3′ Kit v3.1 (10X Genomics) cells at the University of Michigan Advanced Genomics Core following the manufacturer’s instructions. Samples were analyzed following previously published work.^24,92 For data processing, raw sequencing data were converted to Fastq files using cellranger-6.1.0 pipeline. A gene count matrix was generated using the “cellranger count” pipeline using mm10 mouse genome as a reference. Downstream analyses were performed in R/4.1.0 using the Seurat R package. We applied quality control filters to eliminate low-quality cells using two criteria: (a) number of features between 200 and 5000 and (b) percent of mitochondrial genes less than 20 %. Unique molecular identifier data were normalized using log normalization. Uniform manifold approximation and projection (UMAP) was used for nonlinear dimensionality reduction to visualize data. We used the “FindMarkers” function in the Seurat package to identify cluster-specific differentially expressed markers. The identified markers were, in turn, queried for known expression in the literature, cell types labels were the added to the Seurat object⁹² and a gene expression database PanglaoDB⁹³ (https://panglaodb.se/, accessed) and visualized in feature plots. We then integrated SD and HFD datasets using “FindIntegrationAnchors” function in the Seurat package, as others have previously analyzed data.^24,92

Differentially expressed genes, cell types, and substructures within single-cell data were identified using a simple Wilcoxon rank-sum test with the “FindAllMArkers” function in Seurat.

Differentially expressed genes in whole cells, and subset populations (immune cells and epithelial cells clusters) were identified using DESeq2. This analysis adjusted p-values using the Benjamini-Hochberg method to control the false discovery rate. Significant genes were determined based on an adjusted p-value threshold of < 0.05 and an absolute log2 fold change of > 0.5. Data visualization was generated as t-SNE, UMA and enhanced volcano plotsP.⁹²

Chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR)

To obtain sufficient cells for ChIP-qPCR, we pooled AT2 cells from 9 to 12 mice per group, 3–4 mice pooled separately to generate triplicates. ChIP was performed using the ChIP-IT High Sensitivity Kit (Active Motif, Carlsbad, CA) according to the manufacturer’s protocol. Histone H3K4me3 antibody (Active Motif, Carlsbad, CA) and rabbit- IgG as a negative control antibody (Diagenode) were used for ChIP assays. The fold change of the DNA fragment enriched by a specific antibody versus total input was calculated by 2^{−(ct_ChIP-ct-Input)}. Primers used for ChIP-PCR assays were: Il33 promoter: Forward primer: GAAAAGTTGGCCCCGATCCT Reverse primer: CCTCGATGATTCTGCCGTGA.

Statistical analysis

Data were analyzed by Prism 8 (GraphPad Software). Data presented are mean values ± S.E.M. Comparison of two groups was performed with an unpaired, two-tailed Student t-test. ANOVA analyzed comparisons of three or more groups with a Tukey posttest. A p-value < 0.05 was considered significant.