Positive effect of fermented sorghum on productivity, jejunal histomorphology, and tight junction gene expression in broiler chickens

Abstract

This study aimed to investigate the effects of dietary fermented sorghum (FS) as a substitute for corn on growth performance, jejunal histomorphology, cecal short-chain fatty acid (SCFA) levels, and gene expression of tight junctions in broiler chickens. A total of 240 one-day-old male New Lohmann Indian River chicks were randomly divided into five groups, with each group receiving different dietary treatments: a control group (CTRL) with a basal diet, groups supplemented with 10% (NFS10) and 20% (NFS20) non-fermented sorghum, and groups supplemented with 10% (FS10) and 20% (FS20) fermented sorghum. Each group was further divided into six replications, with eight birds per replicate. Orthogonal contrasts were used to compare the feed treatments (fermented sorghum and non-fermented sorghum) to the control. The results revealed that the inclusion of 20% fermented sorghum significantly increased feed intake (FI, P = 0.005), body weight (BW; P = 0.025), and body weight gain (BWG; P = 0.010) compared to other groups. Additionally, the FS20 group exhibited a notable increase in villus height (P = 0.001). There were significant differences in cecal short-chain fatty acid (SCFA) production among the treatment groups (P < 0.05). Furthermore, fermented sorghum notably upregulated the gene expression of occludin (OCLN, P = 0.008), without significant impacts on the expression of claudin-1 (CLDN-1), junctional adhesion molecules-2 (JAM-2), and zonula occludens-1 (ZO-1). In conclusion, addition of 20% fermented sorghum in broiler diets could enhance growth performance and intestinal histomorphology, indicating its potential as a beneficial feed ingredient for poultry production.

Introduction

Corn is the primary component of broiler diets, commonly contributing a significant proportion of the total feed composition, ranging from 65% to 70% (Vargas et al., 2023). As the primary energy source, corn provides complex carbohydrates that are efficiently metabolized by the digestive system of broiler chickens (Stefanello et al., 2023). However, the availability of corn as feed for broilers is currently facing significant challenges. Various factors, such as shifts in planting seasons, unpredictable weather conditions, and fluctuations in the global market, contribute to limitations in corn stocks (Paranhos et al., 2023; Nguyen et al., 2024). Increases in corn prices due to high demand often exceed the available supply, exacerbating challenges within the feed industry. Consequently, the imbalance between demand and supply directly impacts feed price hikes, presenting additional hurdles for broiler farming enterprises in managing production costs and ensuring long-term sustainability (Ayele et al., 2021; Han et al., 2023). Therefore, exploring alternative feed energy sources for broiler farming is imperative. Sorghum emerges as a promising alternative, offering potential benefits for broiler feed (Saleh et al., 2019; Masenya et al., 2021; Moritz et al., 2022).

Sorghum (Sorghum bicolor (L.) Moench) has emerged as one of the most promising cereal crops for cultivation. This is attributed to its highly adaptive nature to various soil types, including those of low fertility or critical conditions, and its ability to thrive in marginal lands with relatively high tolerance to pest and disease pressures (Videgain-Marco et al., 2020; Sarshad et al., 2021). Additionally, sorghum boasts a nutritional value comparable to other cereals in terms of composition, including protein, fat, and carbohydrates, as well as bioactive components such as vitamin B and fat-soluble vitamins (D, E, and K) (Tanwar et al., 2023), micronutrients, macronutrients, and non-nutrients like carotenoids and polyphenols (Cavalcante et al., 2018; Chhikara et al., 2019). These components contribute to various health benefits of sorghum grains, including antioxidant (Kumari et al., 2021), anti-inflammatory (Li et al., 2021), and anti-cancer effects (Cardoso et al., 2017; Smolensky et al., 2018). Moreover, sorghum contains various types of phenolic compounds, such as ferulic acid, lignans, anthocyanins, and flavonoids (Li et al., 2021; Khalid et al., 2022), which have the potential to provide antioxidant and anti-inflammatory effects and play a role in maintaining gut microbiota balance and the digestive health of livestock (McCuistion et al., 2018).

Implementing fermentation technology has shown that microorganisms in the fermentation process can decompose macromolecular compounds, including polysaccharides, fats, and proteins, into small organic acids, which improves nutrient digestion and absorption in chickens (Sharma et al., 2021; Chen et al., 2022). The utilization of Limosilactobacillus fermentum in the fermentation of chicken feed is an essential component of feed processing, as it involves the utilization of lactic acid bacteria (LAB) (Racines et al., 2023). Specifically, L. fermentum can protect intestinal villi from Salmonella damage and boost IgM levels in broilers, potentially enhancing their immune response to Salmonella infection (Guo et al., 2023). Moreover, strains of L. fermentum support gut health by regulating factors such as gut architecture, epithelial integrity (the health of the cells lining the gut), microbial diversity (the variety of microorganisms present in the gut), and inflammation (Šefcová et al., 2020; Geeta et al., 2021; Li et al., 2022). LAB can synthesize diverse enzymes that convert starch and protein structures into smaller molecules, hence improving the digestibility of these compounds for animals (Wang et al., 2021; Harper et al., 2022). Also, LAB exhibits antimicrobial activity, inhibiting pathogenic bacteria growth, reducing bacterial colonization in the intestinal epithelium, and alleviating inflammation and infections in the intestinal mucosa, thereby influencing intestinal morphology by increasing villi height (Liu et al., 2023; Yang et al., 2024).

The fermentation process also reduces the content of anti-nutrients, thereby enhancing the digestive tract's ability to absorb nutrients and producing short-chain fatty acids (SCFA), such as acetate (C2), propionate (C3), and butyrate (C4) (Horiuchi et al., 2020; Chang and Yu, 2022). SCFA play a significant role in regulating metabolism and the immune system, protecting the body from pathogens, maintaining body homeostasis, and preserving the well-being and structural integrity of intestina epithelial cells, including restoring tight junction function (Ali et al., 2022; Yang et al., 2024). However, the use of fermented sorghum (FS) in broiler nutrition has not been investigated. Consequently, no specific recommendations exist on the optimal amounts of FS that can be used in broiler diets without negatively impacting bird health and productivity. Therefore, using fermentation technology in sorghum by applying Limosilactobacillus fermentum might be a promosing strategy for improving livestock health and optimizing feed effeciency in poultry.

Best of our knowledge, the use of fermented feed in broilers has been extensively studied to improve digestibility. However, there is limited research on the effectiveness of fermented sorghum in broiler performance, SCFA production, histomorphology, and its relationship with the intestinal immune system. Therefore, this study aimed to evaluate the potential of fermented sorghum as an alternative to corn in feed formulations, with a focus on enhancing broiler health and performance. The analysis included an evaluation of broiler productivity and small intestine development, specifically targeting jejunal morphology, short-chain fatty acid production, and the regulation of gene expression related to intestinal epithelial integrity (tight junctions).

Materials and methods

Animal ethics statement

The experimental protocol and procedures followed the Guidelines for the Care and Use of Animals as approved by the Research Ethics Committee of the Faculty of Veterinary Medicine, Universitas Gadjah Mada, Yogyakarta. The study was conducted under License Number 80/EC-FKH/Eks./2023.

Preparation of fermented sorghum

The sorghum seeds used in this study were purchased from Billa Sorghum Store, a sorghum seed distributor in Yogyakarta, Indonesia. The seeds were ground into flour using a grinder (Model NdFeB, Adam Poultry Equipment, Malang, Indonesia) and subsequently used as a fermentation substrate. Amino acid content analysis of the sorghum was conducted at Master Lab Asia Laboratory, PT. Trouw Nutrition Indonesia (Bekasi, Indonesia), utilizing the TNI/MLA/WI-D-7.2.58-C1, C2, and C3 (UHPLC) method. Futhermore, samples were analyzed for dry matter (DM), crude protein (CP), ether extract (EE), and crude fibre (CF) (AOAC, 2005). Limosilactobacillus fermentum BN21 (10⁹ CFU/mL) for fermentation was obtained from the Laboratory of Nutritional Biochemistry, Department of Animal Nutrition and Feed Science, Faculty of Animal Science, Universitas Gadjah Mada. L. fermentum was cultured on sterile Lactobacillus MRS Agar (MRS Agar) and incubated (Memmert IN55, 53 L, Schwabach, Germany) at 37°C for 24 h. L. fermentum (10⁷ CFU/mL) was added to the substrate, mixed and supplemented with sterile water to achieve 40% moisture content. The mixture was divided equally into 40 $\times$ 60-cm plastic fermentation bags, which were sealed tightly and fermented at 28°C for 5 d. After fermentation, a portion of the feed was dried in an oven (Faithful DGF-4A, China) at 55°C for 24 h. The dried samples were ground and stored at room temperature until mixed into experimental diets.

Experimental design and bird management

A total of 240 one-day-old male broilers of the New Lohmann Indian River (MB 202 Platinum) strain were obtained from a commercial hatchery (PT. Widodo Makmur Unggas Tbk, Yogyakarta). The birds were vaccinated against Newcastle disease (ND) and infectious bursal disease (Gumboro). The chicks were placed in rearing cages for 11 days during the brooding period. On day 11, the chickens were weighed, with an average initial weight of 318 ± 1.0 g, and randomly assigned to housing units. The animals were distributed into 30 cages (1 m × 0.75 m) according to a completely randomized design, with feed and water provided ad libitum throughout the experimental period. This study consisted of 5 groups, with 6 replicates of each treatment group and 8 chickens per replicate. The groups were as follows: control group (CTRL); 10% non-fermented sorghum (NFS10); 20% non-fermented sorghum (NFS20); 10% fermented sorghum (FS10); and 20% fermented sorghum (FS20). Experimental diets were given from d 11 to d35. The starter phase (1 to 10 d) used a commercial feed from PT Japfa Comfeed Indonesia Tbk, with a composition of 12% moisture, 5% ether extract, 1.1% calcium (Ca), 0.5% phosphorus (P), 1.20% lysine, 0.45% methionine, 0.80% methionine + cystine, 0.19% tryptophan, and 0.75% threonine. The grower (11 to 21 days) and finisher (22 to 35 days) phases were formulated based on Aviagen (2022) recommendations, as detailed in Table 1. The management of broilers primarily followed the recommendations of the Indian River broiler management handbook (Aviagen, 2018). The broiler house was kept ventilated and hygienic. The house temperature was maintained at 30°C until 3 d, then reduced by 2.5°C per week until it reached 20°C. In the early stages of growth, lighting programs typically provide 23 h of light followed by 1 h of darkness. As the animals come around seven days of age, adjusting the lighting schedule to include approximately 5 h of darkness may be beneficial, with the optimal range falling between 4 to 6 h.

Table 1.

Compositons and nutrient content of experimental grower (11 to 21 d) and finisher (22 to 35 d) diets.

Feed ingredients	Percentage (%)
	Grower (11-21 d)						Finisher (22-35 d)
	CTRL	NFS10	NFS20	FS10	FS20		CTRL	NFS10	NFS20	FS10	FS20
Corn	62.65	51.72	40.79	51.72	40.79		64.94	55.63	46.34	55.63	46.34
Rice bran	6.00	6.00	6.00	6.00	6.00		7.00	6.18	5.35	6.18	5.35
Soybean meal	23.00	22.86	22.75	22.86	22.75		19.45	18.83	18.21	18.83	18.21
Meat bone meal	2.00	2.00	2.00	2.00	2.00		1.50	1.63	1.76	1.63	1.76
Crude palm oil	2.20	3.10	4.00	3.10	4.00		3.15	3.65	4.15	3.65	4.15
Sorghum non-fermented	0.00	10.00	20.00	0.00	0.00		0.00	10.00	20.00	0.00	0.00
Sorghum fermented	0.00	0.00	0.00	10.00	20.00		0.00	0.00	0.00	10.00	20.00
Limestone	0.88	0.86	0.83	0.86	0.83		0.80	0.79	0.77	0.79	0.77
Dicalcium phospate	1.62	1.64	1.67	1.64	1.67		1.46	1.46	1.50	1.46	1.50
NaCl	0.40	0.40	0.40	0.40	0.40		0.37	0.37	0.37	0.37	0.37
Vitamin mix1	0.05	0.05	0.05	0.05	0.05		0.05	0.05	0.05	0.05	0.05
Mineral mix2	0.30	0.30	0.30	0.30	0.30		0.30	0.30	0.30	0.30	0.30
Choline chloride	0.10	0.10	0.10	0.10	0.10		0.13	0.07	0.00	0.07	0.00
Toxin Binder	0.20	0.20	0.20	0.20	0.20		0.20	0.20	0.20	0.20	0.20
L-lysine	0.32	0.36	0.40	0.36	0.40		0.32	0.36	0.40	0.36	0.40
DL-methionine	0.19	0.21	0.22	0.21	0.22		0.26	0.26	0.27	0.26	0.27
L-threonine	0.09	0.12	0.15	0.12	0.15		0.04	0.08	0.11	0.08	0.11
L-tryptophan	0.00	0.00	0.00	0.00	0.00		0.01	0.01	0.00	0.01	0.00
L-isolucine	0.00	0.02	0.03	0.02	0.03		0.02	0.05	0.07	0.05	0.07
L-arginine	0.00	0.04	0.08	0.04	0.08		0.00	0.05	0.10	0.05	0.10
L-valine	0.00	0.02	0.03	0.02	0.03		0.00	0.03	0.05	0.03	0.05
Total	100.00	100.00	100.00	100.00	100.00		100.00	100.00	100.00	100.00	100.00
Nutrient content
Crude protein (%)	19.03	20.29	21.14	20.52	21.64		19.17	19.24	20.84	20.11	21.19
Ether extract (%)	5.19	5.22	6.08	5.85	6.41		4.26	4.49	4.98	4.58	5.11
Crude fiber (%)	3.70	3.59	3.68	2.64	2.69		3.77	3.14	3.39	2.64	2.75
ME (kcal/kg)	3140	3135	3130	3140	3130		3220	3215	3210	3215	3210
Ca (%)	0.88	0.88	0.88	0.88	0.88		0.84	0.83	0.81	0.83	0.81
Total P (%)	0.71	0.71	0.71	0.71	0.71		0.71	0.68	0.65	0.68	0.65
Available P (%)	0.44	0.44	0.44	0.44	0.44		0.43	0.42	0.41	0.42	0.41
dLYS (%)	1.21	1.23	1.24	1.23	1.24		1.09	1.10	1.10	1.10	1.10
dMET (%)	0.49	0.50	0.50	0.50	0.50		0.53	0.53	0.53	0.53	0.53
dCYS (%)	0.30	0.30	0.31	0.30	0.31		0.28	0.28	0.28	0.28	0.28
dMET+CYS (%)	0.79	0.80	0.81	0.80	0.81		0.81	0.81	0.81	0.81	0.81
dILE (%)	0.79	0.78	0.77	0.78	0.77		0.73	0.73	0.74	0.73	0.74
dTHR (%)	0.82	0.83	0.84	0.83	0.84		0.71	0.72	0.72	0.72	0.72
dTRP (%)	0.22	0.23	0.23	0.23	0.23		0.20	0.20	0.20	0.20	0.20
dARG (%)	1.27	1.24	1.21	1.24	1.21		1.14	1.14	1.14	1.14	1.14
dVAL (%)	0.87	0.87	0.87	0.87	0.87		0.79	0.79	0.80	0.79	0.80

¹Supplied per kg if diet: vitamin A, 50,000,000 IU; vitamin D3, 10,000,0000 IU; vitamin E, 80,000 mg; vitamin K3,10,000 mg; vitamin B1, 10,000 vitamin B2, 30,000 mg; vitamin B3, 225,000 mg; vitamin B5, 62,000 mg; vitamin B6, 10,000 mg; vitamin B9, 5,000 mg; vitamin B12, 100 mg; vitamin H, 100 mg; vitamin C, 20,000 mg.

²Supplied per kg of diet: Mn, 40,000 mg; Fe, 32,000 mg; Cu, 6,050 mg; Zn, 32,000 mg; I,404 mg; Se, 100 mg.

CTRL = control (0% sorghum); SNF10 = 10% sorghum non-fermented; SNF20 = 20% sorghum non-fermented; SF10 = 10% sorghum fermented; SF20 = 20% sorghum fermented.

Growth performance measurements

Chickens' body weight and feed intake were recorded on d 10, 21, and 35. Body weight (BW), body weight gain (BWG), feed intake (FI), feed conversion ratio (FCR), and performance index (PI) were calculated at the end of the experiment. Mortalities were recorded daily and were used to adjust the total number of birds at the end of 35 d to determine the final feed intake and FCR of the broilers.

Samples collection

At the end of the feeding trial (d 35), two chickens per replicate, with body weights close to the median for each group, were selected, weighed, and exsanguinated by cutting the jugular veins. Jejunal tissue samples were collected 6 cm from Meckel's diverticulum. The 2-cm segments were immediately fixed in a 10% buffered formalin solution for histomorphological analysis. Another 2-cm segment was placed in microtubes, flash-frozen in liquid nitrogen, and stored at -80°C until further gene expression analysis. Additionally, cecal digesta samples were collected, rapidly frozen with liquid nitrogen in sterile centrifuge tubes for short-chain fatty acid (SCFA) analysis, and stored in a cooler at -20°C until SCFA analysis could be performed.

Jejunal histomorphology analysis

Jejunal morphology analysis was conducted following the methodology outlined by Maesaroh et al. (2022). Histological preparation of the jejunal samples involved fixation in Bouin's solution, dehydration in alcohol solutions of increasing concentrations (35%, 50%, 70%, and 95%), and embedded in paraffin. The prepared samples were then cut into 4 μm slices using a microtome, dewaxed with xylene, and stained using hematoxylin-eosin (HE). Jejunal morphology was observed using atransmission electron microscope with 4X magnification and an Optilab digital camera (Optilab Advance, Miconos, Indonesia). Image analysis was conducted using Image Raster software version 4.0.5 to assess the structural characteristics of the jejunal villi. The morphological indices, such as villus height (VH) from the tip of the villus to the crypt, villus width (VW) as average of VW at one-third and two-thirds of the villus, crypt depth (CD) from the villus base to the submucosa, and villus height to crypt depth ratio (VH:CD) were determined.

Short-chain fatty acids profiles

The quantification of short-chain fatty acid (SCFA) levels followed the protocol of García-Villalba et al. (2012). Specifically, 0.5 g of digesta was solubilized in 1.5 mL of a 2.5% metaphosphoric acid solution. The solution was cooled on ice for 30 minutes and homogenized using a Vortex Mixer (Dlab MX-S). After homogenization, the sample was centrifuged at 14,000 g for 10 minutes at 4°C. The resulting supernatant was used for SCFA concentration determination by gas chromatograph (Agilent 780A, Wilmington, NC). The SCFA measured were acetic acid, propionic acid, and butyric acid.

Tight junction protein mRNA levels

Expression levels of tight junctions of broilers at 35 d of age were determined. The gene expression analysis began with RNA extraction from jejunal samples weighing up to 20 mg, using Quick-RNA Miniprep Kit (Zymo Research Corp., Irvine, California) according to established protocols. The purity and quantity of the extracted RNA were assessed using a Nanodrop Spectrophotometer (Maestrogen Inc., Hsinchu City, Taiwan). The total RNA was used as a template for cDNA synthesis, employing the reverse transcriptase enzyme with the ReverTrace qPCR RT Master Mix (Toyobo Co., Ltd., Osaka, Japan, Cat No. FSQ-301). Relative gene expression analyses were performed using the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA) and Thunderbird SYBR qPCR Mix (Toyobo Co., Ltd., Osaka, Japan, Cat No. QPX-201) following the prescribed protocol. Briefly, a mixture containing2 uL of diluted cDNA, 6 pmol of forward primer, 6 pmol of reverse primers , 0.04 uL of ROX reference dye, and 10 uL of qPCR Mix, with nuclease-free water, was prepared, resulting in a total reaction volume of 20 uL. Primer pairs targeting claudin-1 (CLDN-1), occludin (OCLN), junctional adhesion molecules-2 (JAM-2), and zonula occludin-1 (ZO-1) gene expressions were listed in Table 2. The thermal cycling conditions included an initial hold stage at 95°C for 2 min, followed by 40 cycles of PCR with denaturation at 95°C for 1 s and annealing/extension at 60°C for 30 s. The melt curve analysis conducted after the run facilitated the determination of specific product amplification. Each experimental group consisted of seven samples, with each sample analyzed in duplicate. mRNA levels were normalized to β-actin expression using the 2^−ΔΔCT method, and the resulting data were expressed relative to the control group (Livak and Schmittgen, 2001).

Table 2.

Primer pairs for analysis of tight junction gene expression.

Gen	Primer sequence (5’$\to$3’)	Orientation	Base pairs	References
β-actin	GTGTGATGGTTGGTATGGGC	Forward	225	Xie et al., 2019
	CTCTGTTGGCTTTGGGGTTC	Reverse
CLDN-1	GGTGAAGAAGATGCGGATGG	Forward	139	Proszkowiec-Weglarz et al., 2020
	TCTGGTGTTAACGGGTGTGA	Reverse
OCLN	GATGGACAGCATCAACGACC	Forward	142	Proszkowiec-Weglarz et al., 2020
	CTTGCTTTGGTAGTCTGGGC	Reverse
ZO-1	GCCAACTGATGCTGAACCAA	Forward	141	Proszkowiec-Weglarz et al., 2020
	GGGAGAGACAGGACAGGACT	Reverse
JAM-2	CTGCTCCTCGGGTACTTGG	Forward	135	Proszkowiec-Weglarz et al., 2020
	CCCTTTTGAAAATTTGTGCTTGC	Reverse

CLDN-1 = claudin-1; OCLN = occludin; JAM-2 = junctional adhesion molecules-2; ZO-1 = zonula occluding-1.

Statistical analysis

All experimental data were analyzed by one-way analysis of variance (ANOVA) using SPSS 20.0 (Inc., IBM, Chicago, IL) statistical software. The statistical significance of all analyses was set at P <0.05 for probability values, and the results were presented as means with their standard errors (SEM). Differences among treatments were determined using orthogonal contrasts test. Comparisons made were: 1) CRTL vs NFS10, NFS20, FS10, FS20; 2) CTRL vs NFS10, NFS20; 3) CTRL vs FS10, FS20; 4) CTRL vs NFS10, FS10; 5) CTRL vs NFS20, FS20; 6) NFS10, NFS20 vs FS10, FS20; 7) NFS10, FS10 vs NFS20, FS20.

Results

Growth performance

The growth performance of birds fed diets containing non-fermented and fermented sorghum during the 11 to 21-day rearing period is presented in Table 3. No significant differences (P > 0.05) were observed among the treatment groups for feed intake (FI), body weight (BW), body weight gain (BWG), feed conversion ratio (FCR), and the performance index (PI).

Table 3.

Broiler performance with dietary of fermented sorghum and non-fermented sorghum in the grower phase (11 to 21 d).

Treatment	Parameters
	FI (g)	BW (g)	BWG (g)	FCR (%)	PI (%)
CTRL	915.21	924.06	607.08	1.51	293.15
NFS10	926.58	932.28	614.88	1.51	289.30
NFS20	939.02	940.19	623.32	1.51	291.40
FS10	949.90	951.96	634.44	1.50	296.26
FS20	974.26	960.96	642.88	1.52	288.30
SEM	9.23	4.58	4.58	0.02	3.82
P-value	0.314	0.076	0.080	0.998	0.973

FI = feed intake; BW = body weight; BWG = body weight gain; FCR = feed conversion ratio; PI = performance index; SEM = standard error of the mean; CTRL = control (0% sorghum); NFS10 = 10% non-fermented sorghum; NFS20 = 20% non-fermented sorghum; FS10 = 10% fermented sorghum; FS20 = 20% fermented sorghum.

In contrast, during the 22 to 35-day period, as shown in Table 4, significant differences were observed among the treatments. Feed intake (FI) and body weight (BW) increased significantly (P = 0.014; P = 0.025, respectively) across the groups, while body weight gain (BWG), feed conversion ration (FCR), and performance index (PI) remained statistically similar (P > 0.05). Orthogonal contrast analysis further revealed that broilers fed fermented sorghum diets (FS10 and FS20) had significantly higher feed intake (FI) and body weight (BW) (P = 0.017; P = 0.009, respectively) compared to the control (CTRL). However, no significant differences were found between CTRL and the non-fermented sorghum diets (NFS10 and NFS20) for these parameters (P > 0.05). Additionally, fermentation in 10% and 20% levels (FS10; FS20) significantly increased FI and BW (P = 0.002; P = 0.002, respectively) compared to non-fermented feeds. No significant differences in FI were observed between CTRL and the lower fermentation level groups (NFS10, FS10), (P > 0.05), although BW was significantly higher (P = 0.038). Futhermore, both NFS20 and FS20 showed significant improvement in FI and BW (P = 0.012; P = 0.007, respectively) compared to CTRL. The final analysis indicated that fed with fermented sorghum diets (FS10 and FS20) exhibited significantly increased FI and BW (P < 0.005) compared to those on non-fermented diets (NFS10 and NFS20). However, no significant differences were found between the lower and higher concentration groups within the fermented and non-fermented feed treatments (P > 0.05).

Table 4.

Broiler performance with dietary of fermented sorghum and non-fermented sorghum in the finisher phase (22 to 35 d).

Treatment	Parameters
	FI (g)	BW (g)	BWG (g)	FCR (%)	PI (%)
CTRL	2421.94	2266.37	1342.31	1.81	352.86
NFS10	2560.25	2352.46	1420.18	1.81	373.06
NFS20	2614.79	2378.26	1438.07	1.82	358.92
FS10	2830.08	2435.46	1483.50	1.91	351.37
FS20	2983.50	2498.30	1538.23	1.93	362.80
SEM	59.97	24.53	22.61	0.03	6.51
P value	0.014	0.025	0.065	0.346	0.858
Orthogonal contrasts	Probabilities
CTRL vs. NFS10; NFS20; FS10; FS20	0.017	0.009
CTRL vs. NFS10; NFS20	0.244	0.102
CTRL vs. FS10; FS20	0.002	0.002
CTRL vs. NFS10; FS10	0.060	0.038
CTRL vs. NFS20; FS20	0.012	0.007
NFS10; NFS20 vs. FS10; FS20	0.009	0.043
NFS10; FS10 vs. NFS20; FS20	0.368	0.361

FI = feed intake; BW = body weight; BWG = body weight gain; FCR = feed conversion ratio; PI = performance index; SEM = standard error of the mean; CTRL = control (0% sorghum); NFS10 = 10% non-fermented sorghum; NFS20 = 20% non-fermented sorghum; FS10 = 10% fermented sorghum; FS20 = 20% fermented sorghum.

As summarized in Table 5, for the 11 to 35-day period, significant improvements were observed across the treatment groups in FI (P = 0.005), BW (P = 0.025), and BWG (P = 0.010), while FCR and PI remained unaffected (P > 0.05). Orthogonal contrasts revealed that the treated groups (NFS10, NFS20, FS10, and FS20) significantly enhanced FI, BW, and BWG (P = 0.008; P = 0.009; P = 0.004, respectively) compared to CTRL. However, no significant differences were found between the non-fermented diets (NFS10 and NFS20) to the control, no significant differences were detected (P > 0.05). In contrast, the fermented diets (FS10 and FS20) showed significant increases in FI, BW, and BWG compared to CTRL (P = 0.001; P = 0.002; P = 0.001, respectively). Lastly, a comparison of the fermented and non-fermented treatments exhibited that the fermented sorghum diets (FS10 and FS20) consistently led to significant improvements in FI (P = 0.005), BW (P = 0.043), and BWG (P = 0.027) over the non-fermented groups.

Table 5.

Broiler performance with dietary of fermented sorghum and non-fermented sorghum in the total phase (11 to 35 d).

Treatment	Parameters
	FI (g)	BW (g)	BWG (g)	FCR (%)	PI (%)
CTRL	3337.15	2266.37	1941.86	1.72	370.70
NFS10	3486.84	2352.46	2027.50	1.72	381.79
NFS20	3553.81	2378.26	2038.77	1.74	364.88
FS10	3779.97	2435.46	2095.26	1.80	363.45
FS20	3957.76	2498.30	2155.91	1.83	365.93
SEM	61.79	24.53	21.02	0.02	6.30
P-value	0.005	0.025	0.010	0.255	0.906
Orthogonal contrasts	Probabilities
CTRL vs. NFS10; NFS20; FS10; FS20	0.008	0.009	0.004
CTRL vs. NFS10; NFS20	0.193	0.102	0.069
CTRL vs. FS10; FS20	0.001	0.002	0.001
CTRL vs. NFS10; FS10	0.040	0.038	0.020
CTRL vs. NFS20; FS20	0.005	0.007	0.003
NFS10; NFS20 vs. FS10; FS20	0.005	0.043	0.027
NFS10; FS10 vs. NFS20; FS20	0.284	0.361	0.368

FI = feed intake; BW = body weight; BWG = body weight gain; FCR = feed conversion ratio; PI = performance index; SEM = standard error of the mean; CTRL = control (0% sorghum); NFS10 = 10% non-fermented sorghum; NFS20 = 20% non-fermented sorghum; FS10 = 10% fermented sorghum; FS20 = 20% fermented sorghum.

Cecal short-chain fatty acids

The effect of non-fermented and fermented sorghum on cecal short-chain fatty acid (SCFA) concentrations is presented in Table 6. Significant differences were observed in acetate (P = 0.002) and propionate (P = 0.015) concentrations among the treatment groups, while no significant difference was found for butyrate concentration (P > 0.05). Orthogonal contrast analysis was conducted for pairwise comparisons among the treatment groups to explore these differences futher. The results indicated that CTRL significantly increased acetate (P = 0.001) and propionate (P = 0.005) concentrations compared to other treatment groups, including non-fermented sorghum (NFS10, NFS20) and fermented sorghum (FS10, FS20). Notably, fermented sorghum diets (FS10 and FS20) significantly enhanced acetate (P = 0.006) and propionate (P = 0.041) concentrations compared to non-fermented sorghum diets (NFS10 and NFS20).

Table 6.

Concentrations and profile of short-chain fatty acids (SCFA) in the cecal digesta in broiler fed with fermented sorghum.

Treatment	Parameters
	Acetic Acid (mMol)	Propionic Acid (mMol)	Butyrate Acid (mMo)
CTRL	20.98	4.37	4.05
NFS10	10.71	2.38	4.88
NFS20	12.95	2.53	4.20
FS10	16.11	3.09	3.55
FS20	17.41	3.63	4.78
SEM	0.95	0.22	0.26
P-value	0.002	0.015	0.489
Orthogonal contrasts	Probabilities
CTRL vs, NFS10; NFS20; FS10; FS20	0.001	0.005
CTRL vs, NFS10; NFS20	0.000	0.001
CTRL vs, FS10; FS20	0.048	0.063
CTRL vs, NFS10; FS10	0.001	0.004
CTRL vs, NFS20; FS20	0.008	0.020
NFS10; NFS20 vs, FS10; FS20	0.006	0.041
NFS10; FS10 vs, NFS20; FS20	0.295	0.418

SEM = standard error of the mean; CTRL = control (0% sorghum); NFS10 = 10% non-fermented sorghum; NFS20 = 20% non-fermented sorghum; FS10 = 10% fermented sorghum; FS20 = 20% fermented sorghum.

Jejunal histomorphology

The jejunal histomorphology in broiler fed diets containing fermented sorghum and non-fermented sorghum are represented in Table 7. The analysis showed a significant difference between treatment groups for VH (P = 0.001) but no significant difference for VW, CD, and VH: CD (P > 0.05). Orthogonal contrast analysis showed a significant increase in VH (P = 0.003) for the treatment (NFS10, NFS20, FS10, FS20) compared to CTRL. The contrast between CTRL and non-fermented sorghum diets (NFS10 and NFS20) showed no significant difference (P > 0.05), whereas the between CTRL and fermented sorghum diets (FS10 and FS20) showed highly significant in increasing VH (P < 0.001). Additionally, significant differences were observed with NFS10 and FS10 (P = 0.031) and NFS20 and FS20 (P = 0.001), both showing increased VH compared to CTRL. In futher contrast, the fermented sorghum diets (FS10, FS20) significantly increased the VH compared to non-fermented sorghum diets (P = 0.002). Meanwhile, no significant difference was found between NFS10 and FS10 compared to NFS20 and FS20 (P > 0.05).

Table 7.

Effect of dietary fermented sorghum on jejunal histomorphology of broiler.

Treatment	Parameters
	VH (μm)	VW (μm)	CD (μm)	VH : CD
CTRL	1359.98	160.80	189.06	8.87
NFS10	1420.52	183.31	193.14	7.83
NFS20	1525.51	188.79	204.72	8.28
FS10	1612.22	186.09	226.69	9.16
FS20	1720.61	191.29	224.61	9.01
SEM	33.47	5.77	7.36	0.33
P-value	0.001	0.486	0.359	0.463
Orthogonal contrasts	Probabilities
CTRL vs, NFS10; NFS20; FS10; FS20	0.003
CTRL vs, NFS10; NFS20	0.112
CTRL vs, FS10; FS20	0.000
CTRL vs, NFS10; FS10	0.031
CTRL vs, NFS20; FS20	0.001
NFS10; NFS20 vs, FS10; FS20	0.002
NFS10; FS10 vs, NFS20; FS20	0.068

VH = villus height; VW = villus width; CD = crypt depth; VH:CD = villus height to crypt depth ratio; SEM = standard error of the mean; CTRL = control (0% sorghum); NFS10 = 10% non-fermented sorghum; NFS20 = 20% non-fermented sorghum; FS10 = 10% fermented sorghum; FS20 = 20% fermented sorghum.

Tight junction gene expression

The expression of tight junction (TJ) genes in broiler fed diets containing fermented and non-fermented sorghum is shown in Table 8. The analysis revealed a significant difference in the expression of the OCLN gene (P = 0.008). In contrast, no significant differences were observed in the expression of the CLDN-1, JAM-2, and ZO-1 genes (P > 0.05) across the treatment groups. Orthogonal contrast analysis further showed a significant difference between the CTRL and the other treatment groups (NFS10, NFS20, FS10, and FS20) in increasing the expressiOCLN gene expression (P = 0.023). However, no significant difference was found between CTRL and the NFS10 and NFS20 treatment groups (P > 0.05) in OCLN gene expression. Feeding fermented sorghum diets (FS10 and FS20) significantly increasedOCLN gene expression (P = 0.002). Additionally, no significant difference was observed between CTRL and the NFS10 and FS10 treatment groups (P > 0.05) in OCLN gene expression. A significant increase in OCLN gene expression was found between CTRL and the NFS20 and FS20 treatment groups (P = 0.010). Furthermore, feeding FS10 and FS20 diets resulted in higher expression levels of the OCLN gene (P = 0.007) compared to NFS10 and NFS20 treatments, with no significant differences observed between the combinated NFS10 and FS10 NFS20 and FS20 in OCLN gene expression (P > 0.05).

Tabel 8.

Gene expression of tight junctions in the jejunum of broiler fed with fermented sorghum.

Treatment	Parameters
	CLDN-1	OCLN	JAM-2	ZO-1
CTRL	1.05	1.10	1.19	1.01
NFS10	1.14	1.20	1.05	1.14
NFS20	1.13	1.24	1.16	1.01
FS10	1.21	1.39	1.17	1.17
FS20	1.25	1.63	1.33	1.12
SEM	0.02	0.05	0.03	0.03
P-value	0.102	0.008	0.112	0.359
Orthogonal contrasts	Probabilities
CTRL vs, NFS10; NFS20; FS10; FS20		0.023
CTRL vs, NFS10; NFS20		0.325
CTRL vs, FS10; FS20		0.002
CTRL vs, NFS10; FS10		0.118
CTRL vs, NFS20; FS20		0.010
NFS10; NFS20 vs, FS10; FS20		0.007
NFS10; FS10 vs, NFS20; FS20		0.159

CLDN-1 = claudin-1; OCLN = occludin; JAM-2 = junctional adhesion molecules-2, ZO-1 = zonula occluding-1; SEM = standard error of the mean; CTRL = control (0% sorghum); NFS10 = 10% non-fermented sorghum; NFS20 = 20% non-fermented sorghum; FS10 = 10% fermented sorghum; FS20 = 20% fermented sorghum.

Discussion

Nowadays, there has been a growing recognition of the importance of dietary interventions in improving the health and performance of broiler chickens. Among these interventions, incorporating fermented diets has emerged as a promising strategy for improving nutrient utilization and mitigating challenges associated with conventional feed formulations. Fermented feed, produced through the controlled microbial fermentation of organic substrates, serves a reservoir of bioactive compounds, probiotics, and enzymes that can significantly influence the gastrointestinal ecology of broilers (Clavijo and Flórez, 2018; Li et al., 2020; Liu et al., 2021a). This study explores the effects of dietary supplementation with fermented sorghum on the growth performance of broiler chickens during the feeding period from 11 to 35 days. It was observed that both 10% and 20% levels of fermented sorghum in the diet resulted in increased FI, BW, and BWG compared to diets containing non-fermented sorghum or the basal diet. The result suggest that feed fermented over an extended period, mainly using Limosilactobaccilus fermentum, may positively influence feed intake due to enhanced palatability. Similar results have also been reported, with improved growth performance in broilers fed fermented diets (Kim et al., 2012; Palupi et al., 2023; Chen et al., 2024). This assumption is based on the belief that Limosilactobacillus fermentation can improve the sensory qualities of the feed, such as aroma, flavour profile, and texture (Youssef et al., 2020; Senanayake et al., 2023), making it more appealing to broilers and increasing FI. Li et al. (2023) also found that fermentation can enhance the nutritional profile of feed ingredients by breaking down complex compounds into more digestible forms and increasing the bioavailability of nutrients. Limosilactobacillus can improve digestive function by secreting a variety of digestive enzymes which aid in the of complex nutrients such as carbohydrates, proteins, and fats into simpler forms that can be more readily absorbed by the animal's body (Ou et al., 2019; Dempsey and Corr, 2022). The positive effect of fermented feed on growth performance may be due to an improvement in the nutritive value and digestibility of feed components during fermentation. Malyar et al. (2024) reported that fermented feed can improve digestion, thereby promoting intestinal health and development, and enhancing the growth performance of broiler chickens.

Improvements in broiler performance are usually linked to the integrity of their intestinal tract. Changes in the morphology of the small intestine, such as increased VH, VW, CD, and VH:CD ratio, are known to influence bird performance positively. In the present study, villus development in the jejunum of broilers was significantly stimulated by FS supplementation. The highest increase in villus growth was observed in birds fed the diet with 20% FS supplementation. The most pronounced increase in villus growth was observed in birds fed the diet containing 20 FS, which resulted in higher VH compared to CTRL and NFS diets (Fig. 1). These findings align with those of Xie et al. (2020) and Wu et al. (2022), who reported that diets supplemented with fermented feed enhance intestinal morphological development, as indicated by increased in villus height. Similarly, Soumeh et al. (2019) demonstrated an increase in the villus height in jejunum and ileum of chickens fed diets containing fermented feed. Moreover, the metabolic activity of microorganisms during fermentation plays a critical role in this process, as it stimulates the production of enzymes and bioactive compounds such as peptides, amino acids, and organic acids. These substances have been shown to improve gut function (Jazi et al., 2019). Consequently, fermented feed can promote the growth of intestinal epithelial cells, thereby increasing the surface area available for nutrient absorption and enhancing nutrient utilization efficiency. The improved intestinal morphology observed in broiler consuming fermented diets will likely contribute to better nutrient digestibility and enhanced growth performance.

Fig. 1.

Microstructure of the intestinal villi in the jejunum of broiler fed with fermented sorghum. (A) CTRL = control (0% sorghum); (B) NFS10 = 10% non-fermented sorghum; (C) NFS20 = 20% non-fermented sorghum; (D) FS10 = 10% fermented sorghum; (E) FS20 = 20% fermented sorghum.

Fermentation of sorghum seeds using L. fermentum significantly impacted the production of short-chain fatty acids (SCFAs), including acetic acid, propionic acid, and butyric acid. Interestingly, feeding sorghum-based diets led to a significant decrease in SCFA concentrations. The potential of fermented feed prepared with L. fermentum to enhance SCFA production has yet to be extensively explored in scientific research. However, studies focusing on fermentation techniques employing specific bacterial species or strains have highlighted their varied impact on SCFA levels. Molnár et al. (2020) showed that feed fermented using C. butyricum did not affect cecal SCFA concentration. The lack of significant effects on SCFA production in broilers fed with fermented sorghum seed could be attributed to the fermentation process itself and fermentation of sorghum seed may not yield sufficient quantities of fermentable substrates or conducive conditions for optimal SCFA production. Several factors could explain this discrepancy, including fermentation conditions (Moonga et al., 2021; Maleke et al., 2022), fermentation duration (Shu et al., 2015; Moonga et al., 2019), and microbial composition (Bartkiene et al., 2017, 2021; Vadopalas et al., 2020), which can influence the types and levels of SCFAs produced.

While fermentation processes are theorized to enhance SCFA levels by producing organic acids such as lactic acid and acetic acid, studies specifically investigating the effects of fermented sorghum seeds on SCFA production in broilers remain limited. Ding et al. (2019) reported that the supplementation of Lactobacillus plantarum 15-1 significantly increased SCFA levels in the cecal contents of broilers. This enhancement in SCFA concentrations was suggested to contribute to resistance against pathogenic bacterial invasion in gastrointestinal tract. Moreover, Xu et al. (2021) found that dietary supplementation with fermented feed using B. subtilis, and notably B. licheniformis, significantly increased SCFA levels in the cecal contents, with particular improvements in butyric acid concentration. Similar results have been observed in a study by Pessione, 2012, who noted that Lactobacilli can produce SCFAs through the metabolism of pyruvate and the phosphoketolase pathway under heterofermentative conditions. The ability of lactobacilli to produce SCFA is influenced by the microbial composition used in feed formulation. For example, supplementation with Lactobacillus salivarius ssp. salicinius JCM 1230 and L. agilis JCM 1048 for 24 h in a simulated chicken cecum significantly increased propionate and butyrate production. L. acidophilus CRL 1014 has also been shown to enhance SCFA production (Meimandipour et al., 2010; Sivieri et al., 2013).

SCFA play a crucial role in maintaining gut health in broiler chickens, mainly through their connection with tight junctions (TJs) (Liu et al., 2021b; Mátis et al., 2022; Li et al., 2022). Tight junctions are specialized structures located between epithelial cells lining the intestinal tract, serving as a barrier that regulates permeability (Buckley and Turner, 2018; Pearce et al., 2018; Cuccato et al., 2022). The study suggest a correlation between the relatively modest SCFA production and the limited impact on the expression for crucial TJ protein, such as claudin-1 (CLDN-1), junction adhesion molecule-2 (JAM-2), and zonula occluden-1 (ZO-1). Although SCFAs are known to play a crucial role in regulating tight junctions and thereby influencing intestinal health (Song et al., 2020; Ali et al., 2022), the low levels of SCFA production in this study may have contributed to the minimal effect observed on TJ protein in broilers (Pérez-Reytor et al., 2021). However, it is noteworthy that the introduction of fermented sorghum resulted in increased levels of occludin (OCLN) expression in broilers. Shen and Turner (2006) explained that occludin (OCLN) is a critical TJ protein capable of relocating within paracellular junctions to modulate epithelial permeability. Within the tight junctions, OCLN acts as a molecular gatekeeper, controlling the passage of various molecules across the epithelial layer and by forming tight molecular seals between adjacent cells. OCLN helps to restrict the movement of substances, ensuring that essential nutrients, water, and electrolytes are efficiently absorbed while preventing the entry of harmful pathogens, toxins, and other unwanted molecules into the bloodstream (Buchholz et al., 2021; Lugata et al., 2024). By enhancing epithelial integrity, OCLN is vital in optimizing nutrient absorption and protecting the intestinal tract from external threats, highlighting its importance in supporting broiler gut health.

Conclusions

The results suggest that the inclusion of fermented sorghum in broiler diets resulted in significant improvements in FI, BW, and BWG, as well as improvements in VH. However, FS supplementation did not significantly increase SCFA production. In addition, FS supplementation enhanced gene expression of tight junction proteins, such as OCLN, while having no significant effect on CLDN-1, JAM-2, and ZO-1. This study emphasize the beneficial effects of fermented sorghum on broiler performance and intestinal health.

Declaration of competing interest

The authors whose names are listed immediately certify that they have no affiliation with or involvement in any organization or entity with any financial interest (such as honoraria; educational grants; participation in speakers’ bureaus; membership; employment; consultancies; stock ownership; or other equity interest; and expert testimony or patent-licensing arrangements), or non-financial interest (such as personal or professional relationships, affiliations, knowledge or beliefs) in subject matter or materials discussed in this manuscript.