Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2025 Jan 7;21:10. doi: 10.1186/s12917-024-04440-x

A SYBR green I-based multiplex real-time PCR for simultaneous detection of pseudorabies virus, porcine circovirus 3 and porcine parvovirus

Lihua Cao 1,#, Wenke Lv 1,#, Anqi Li 1,#, Lulu Yang 1, Feng Zhou 1, Feng Wen 1, Sheng Yuan 1, Shujian Huang 1, Zhili Li 1, Jinyue Guo 1,✉
PMCID: PMC11705656  PMID: 39773253

Abstract

Background

Pseudorabies virus (PRV), porcine parvovirus (PPV) and porcine circovirus 3 (PCV3) are common in swine farms in China. Single infection or co-infection with PRV, PPV and/or PCV3 was difficult to distinguish between their clinical symptoms and pathological changes. Therefore, a quick and accurate detection method is needed for epidemiological surveillance, disease management, import and export control.

Methods

In the present study, we established a multiplex real-time PCR assay based on SYBR Green I for the simultaneous detection of PRV, PPV and PCV3 genomes.

Results

PRV, PPV and PCV3 were distinguished in the same sample by their different melting temperatures (Tm), with melting peaks at 90 °C for PRV, 84 °C for PPV and 80 °C for PCV3, respectively, and other non-targeted swine pathogens did not exhibit specific melting peaks. The assay showed a high degree of linearity (R2≧0.995), and the detection limits were 4.76 copies/μL for PRV, 3.67 copies/μL for PPV, 3.07 copies/μL for PCV3 and 1.87 × 102 copies/μL for the three mixed plasmids, respectively. In this research, 81 clinical samples from pig farms in nine different regions of Guangdong Province were used to evaluate this new method. The detection rate of the multiplex real-time PCR assay was higher than that of the conventional PCR assay.

Conclusions

This multiplex real-time PCR assay could be used as a diagnostic tool that is rapid, sensitive and reliable for the detection of co-infection of PRV, PPV and PCV3 as well as for molecular epidemiological surveillance.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-024-04440-x.

Keywords: Pseudorabies virus, Porcine circovirus 3, Porcine parvovirus, Multiplex real-time PCR

Introduction

The intensification of swine production in China has led to a rise in enteric, respiratory, vesicular, and reproductive diseases. These diseases often present with similar clinical signs, making it challenging to accurately identify the causative pathogen based on symptoms alone. Pseudorabies virus (PRV), porcine parvovirus (PPV), and porcine circovirus 3 (PCV3) are among the pathogens associated with respiratory and reproductive diseases in swine, and their clinical manifestations frequently overlap [1–4]. This lack of clear distinction in clinical presentation poses a significant challenge for effective disease management and control.

PRV is a double-stranded linear DNA virus with a genome of approximately 145 kb encoding more than 70 proteins [5, 6], enclosed by a capsid, tegument and envelope, which belongs to the subfamily Alphaherpesvirinae of the family Herpesviridae [7]. PRV can infect numerous livestock and wild animals, and swine is a natural viral reservoir [2, 4, 7]. Due to PRV latent infection and the emergence of variant strains in China, PRV infection has increased sharply in many Chinese pig farms with large economic losses. PPV is a single-stranded and non-enveloped linear DNA virus with a genome size of approximately 5 kb, belonging to the genus Parvovirus of the family Parvoviridae [3, 6]. Because PPV is highly stable in the environment, the virus is distributed in many provinces of China, such as Guangxi, Inner Mongolia, Hunan, Anhui and so on [8–11]. PCV3 is an identified circular single-stranded DNA virus, which belongs to the genus Circovirus of the family Circoviridae [12]. PCV3 was first confirmed in 2016 in the United States and then was widely distributed throughout pig farms in more than 24 provinces in China [12–18]. Recently, co-infection of one of these three viruses with another has been reported in China, which could aggravate clinical signs and symptoms and make the correct diagnosis more difficult [9, 10]. Consequently, a test that provides rapid detection and differentiation of PRV, PPV and PCV3 is urgently needed to prevent the epizootics of these viruses.

Currently, quantitative real-time PCR has become a powerful alternative for the rapid detection and identification of pathogenic viruses. Several TaqMan-based and SYBR Green I-based real-time PCR assays have been reported to individually detect PRV, PPV or PCV3 [15, 17, 19–21]. However, these assays face limitations in effectively and rapidly diagnosing co-infections involving these three viruses. Existing multiplex PCR assays often lack the sensitivity or specificity needed for accurate co-infection diagnosis, especially in complex clinical scenarios. To address this gap, we developed a sensitive and specific multiplex real-time PCR assay capable of simultaneously detecting PRV, PPV, and PCV3. This novel assay offers a significant improvement in diagnostic efficiency, facilitating rapid and accurate diagnosis even in co-infection scenarios.

Methods

Viruses and clinical samples

PRV, PPV, Classical swine fever virus (CSFV), and Porcine reproductive and respiratory syndrome virus (PRRSV) were provided by the Key Laboratory for Guangzhou, China. PCV2 and PCV3 positive tissue sample was collected and identified by real-time PCR assay [15, 22].

A total of 81 clinical tissue samples including liver, lung, spleen, kidney, heart and lymph nodes were collected from pig farms in nine different regions of Guangdong Province (Foshan, Yangjiang, Jiangmen, Maoming, Zhongshan, Guangzhou, Dongguan, Qingyuan and Shaoguan)(Table S1). Samples were from different ages of sick pigs with reproductive failure, respiratory, neurological symptoms and so on.

Primers design and synthesize

Multiple sequence alignments were performed using PPV NS1 gene, PRV gE gene, and PCV3 Cap gene in Genbank. We used the Clustal W algorithm of the Megalign program in DNAstar 7.1 software to confirm the highly conserved regions within the PRV gE, PPV NS1 and PCV3 Cap genes (Fig. S1). Primer Premier 5.0 software was used to design three pairs of primers. The primer sequences are shown in Table 1. These primers were synthesized by Sangon Biotech.

Table 1.

Primers for multiplex real-time PCR

Primer Name Primer sequences (5’ to 3’) Gene Length (bp)
PPV-F TTTAGCCTTGGAGCCGTGGAGCG NS1 83
PPV-R TTGCTGAATCTGGCGGTGTTGGA
PRV-F TCACCCCGGAGCGGT gE 80
PRV-R GTCGTGCAGCGTGTAG
PCV3-F GGCTCCAAGACGACCCTTATGCGG Cap 86
PCV3-R TTTGGGGGTGAAGTAACGGCTGTG

Viral nucleic acid extraction and construction of standard plasmids

Total nucleic acid was extracted from the samples using the Axygen® body fluid viral DNA/RNA Miniprep Kit (Corning, CA, USA), according to the manufacturer's instructions. PCR amplification of the PRV gE gene, the PPV NS1 gene or the PCV3 Cap gene was performed using the LA Taq PCR kit (Takara, Dalian, China). The PCR reaction was carried out in a 25 μL volume, comprising 0.25 μL LA Taq (5U/μL), 2 μL of DNA template, 12.5 μL 2 × GC buffer II, 4 μL dNTP mixture (2.5 mM each), 2 μL of each primer (10 μM) and 4.25 μL of ddH2O, with the following program: 94 °C for 1 min, 35 cycles of 94 °C for 30 s, 65 °C for 20 s, 72 °C for 20 s; and a final step of 72 °C for 5 min.

The purified PRV, PPV or PCV3 PCR product was respectively cloned into the pMD18-T vector (Takara, Dalian, China) for sequencing. These positive plasmids (pMD-PRV, pMD-PPV and pMD-PCV3) were then quantified by determining OD260 and OD280 using the microfluorescence spectrophotometer (Denovix, DE, USA), and the number of copies of each standard plasmid was calculated as the following formula: copies/μL = (6.02 × 1023 × plasmid DNA concentration (ng/μL) × 10−9) / plasmid length (bp) × 660. Ten-fold serial dilutions of each standard plasmid were prepared in DEPC water and stored at −80 °C until further analysis.

Development and optimization of multiplex real-time PCR assay

Single real-time PCR assays to detect PRV, PPV and PCV3 were first developed and optimized on an AriaMx real-time PCR system (Agilent technologies, CA, USA). The multiplex real-time PCR assay was optimized to get the best amplification results, including primer concentrations, reagents, and PCR cycling parameters. The fluorescence measurement of the SYBR Green I signals was recorded after extension in each cycle, and the melting curves were obtained by monitoring the fluorescence from 65 °C to 95 °C with an increase rate of 0.5 °C/cycle to identity the separate amplicons of PRV, PPV and PCV3. The specific amplified products were identified by their melting peaks.

Development of conventional PCR assay

The conventional PCR assay was developed specifically for this study, and the corresponding primers are the same as those used in the multiplex real-time PCR. The conventional PCR reaction system for PPV, PRV, and PCV3, with a total volume of 20 μL, comprising: 10 μL of 2 × Premix Taq (Takara, Dalian, China), 1 μL of each primer (10 μM), 2 μL of DNA template, and 6 μL of ddH₂O. The amplification conditions were as follows: an initial denaturation at 95 °C for 1 min, followed by 40 cycles of 95 °C for 30 s, 65 °C for 20 s, 72 °C for 20 s, and a final extension step at 72 °C for 5 min.

Evaluation of the specificity, sensitivity and reproducibility of multiplex real-time PCR assay

To determine the specificity of the multiplex real-time PCR assay, nucleic acids from porcine viral pathogens (including PRV, PPV, CSFV, PRRSV, PCV3 and PCV2) were tested. To assess the sensitivity of this assay, pMD-PRV, pMD-PPV and pMD-PCV3 were serially diluted 10 times from 4.67 × 106 copies/μL to 4.67 × 100 copies/μL, 3.67 × 106 copies/μL to 3.67 × 100 copies/μL and 3.07 × 106 copies/μL to 3.07 × 100 copies/μL, respectively. Ten-fold serial dilutions of three standard plasmids were prepared in DEPC water. The minimum concentration that can be detected will provide the sensitivity of this assay. Three dilutions (3.83 × 108, 3.83 × 106 and 3.83 × 104 copies/μL) of three standard plasmids were chosen and amplified as DNA templates, in triplicate, and the experiment was repeated with an interval of one week between two adjacent trials. The reproducibility and coefficients of variation (CVs) of the Ct values was calculated for different concentrations of the samples from three tests.

Detection of clinical samples by multiplex real-time PCR and conventional PCR

A total of 81 clinical samples were collected from pig farms in nine different regions of Guangdong Province and then detected in parallel using the multiplex real-time PCR and conventional PCR for PRV, PPV and PCV3, individually. Furthermore, all positive samples estimated by the multiplex real-time PCR assay were reconfirmed by gel electrophoresis on 2% agarose gel. Ten positive samples were randomly selected and validated by sequencing.

Statistical analysis

To assess the statistical significance of the multiplex real-time PCR assay compared to conventional PCR, we performed t-test using the GraphPad software. A paired t-test was performed to compare the Ct values obtained by the multiplex PCR assay and conventional PCR for each target gene.

Results

Optimization of multiplex real-time PCR assay

Single real-time PCR assays were first developed to analyze the specificity of each pair of primers for PRV, PPV and PCV3. The analysis of the melt curve showed that the PRV specific melting peak value was 90 °C (Fig. 1A), the PPV specific melting peak value was 84 °C (Fig. 1B) and the PCV3 specific melting peak value was 80 °C (Fig. 1C). Standard plasmids were used as templates to optimize the reaction conditions of multiplex real-time PCR assay. The final reaction of the multiplex real-time PCR with a total volume of 20 μL contained the following: 10 μL 2 × TB Green Mix, 0.4 μL PPV primers (10 μM), 1.2 μL PRV primers (10 μM), 0.6 μL PCV3 primers (10 μM), 2 μL DNA and 3.6 μL DEPC water (Table 2). The amplification conditions were as follows: predenaturation at 95 °C for 30 s, then 40 cycles of denaturation at 95 °C for 5 s, and annealing and extension at 65 °C for 35 s (Table 2). Therefore, the target fragments of multiplex real-time PCR could easily be distinguished by the specific melting peak values of PRV, PPV and PCV3 at 90 °C, 84 °C and 80 °C, respectively.

Fig. 1.

Fig. 1

Melting curve analysis of the SYBR Green I-based real-time PCR assay. A PRV was detected with specific amplification of the Tm value at 90 °C. B PPV was detected with a specific amplification of the Tm value at 84 °C. C PCV3 was detected with a specific amplification of the Tm value at 80 °C

Table 2.

Optimization of reaction conditions for multiplex real-time PCR assay

graphic file with name 12917_2024_4440_Tab2_HTML.jpg

Establishment of PRV, PPV and PCV3 standard curves

The standard curves of multiplex real-time PCR were established by serial tenfold dilutions of pMD-PRV, pMD-PPV and pMD-PCV3 ranging from 4.67 × 108 copies/μL to 4.67 × 102 copies/μL, 3.67 × 108 copies/μL to 3.67 × 102 copies/μL and 3.07 × 109 copies/μL to 3.07 × 102 copies/μL as templates. As a result, the PRV standard curve was determined to be y = −3.274X + 40.76, with correlation coefficient (R2) value of 0.998; PPV standard curve was determined to be y = −3.124X + 37.52, with R2 values of 0.999; PCV3 standard curve was determined to be y = −3.091X + 39.04, with R2 values of 0.995; The amplification efficiencies (E) of the standard curves were 102.05%, 108.99% and 110.61% for PRV, PPV and PCV3, respectively (Fig. 2).

Fig. 2.

Fig. 2

Preparation of the plasmid standards. A-C Amplifaction curves (X-axis: cycle, Y-axis: fluorescence) of PRV, PPV and PCV3 for each plasimid standard with concentrations from 4.67 × 108 to 4.67 × 102 copies/μL, 3.67 × 108 to 3.67 × 102 copies/μL and 3.07 × 109 to 3.07 × 102 copies/μL, respectively. D-F Standard curves of PRV, PPV and PCV3 plasmid standards

Specificity, sensitivity and reproducibility of multiplex real-time PCR

To evaluate the specificity of this multiplex real-time PCR assay, DNA or cDNA from several swine viruses (PCV2, PRV, PCV3, PPV, CSFV and PRRSV) were used as templates and tested using the multiplex real-time PCR assay. As a result, only PRV, PPV, and PCV3 showed the specific melting curve peaks at 90 °C, 84 °C, and 80 °C, respectively. However, other swine viruses or DEPC water displayed a nonspecific melting curve at 81.5 °C, but this can be separated from the specific melting curve peaks (Fig. 3).

Fig. 3.

Fig. 3

Melting curve analysis of the specificity of multiplex real-time PCR assay. Viral nucleic acids including PRV, PPV, CSFV, PRRSV, PCV3 and PCV2, were tested by multiplex real-time PCR. From the fluorescence signals collected, PRV, PPV and PCV3 had specific melting peaks. However, other viruses showed nonspecific melting peaks (ns.), but these can be separated from the specific melting curve peaks

For the sensitivity assessment, pMD-PRV, pMD-PPV and pMD-PCV3 were serially diluted 10 times from 4.67 × 106 copies/μL to 4.67 × 100 copies/μL, 3.67 × 106 copies/μL to 3.67 × 100 copies/μL and 3.07 × 106 copies/μL to 3.07 × 100 copies/μL to determine the detection limits of multiplex real-time PCR. The detection limits of multiplex real-time PCR assay were 4.76 copies/μL, 3.67 copies/μL and 3.07 copies/μL for PRV, PPV and PCV3, respectively (Fig. 4A-C). While the detection limit for the conventional PCR was 4.67 × 102 copies/μL, 3.67 × 102 copies/μL and 3.07 × 101 copies/μL for PRV, PPV and PCV3, respectively (Fig. 4D-F). These results indicated that multiplex real-time PCR was more sensitive than conventional PCR. When the mixture of three standard plasmids was used as a template, the detection limits were 1.87 × 102 copies/μL for the three mixed plasmids (Fig. 4G-H).

Fig. 4.

Fig. 4

Sensitivity of the multiplex real-time PCR and conventional PCR assay. pMD-PRV (A, D), pMD-PPV (B, E), pMD-PCV3 (C, F), and a mixture of three standard plasmids (G, H) were used as templates and diluted from 4.67 × 106 to 4.67 × 100 copies/μL, 3.67 × 106 to 3.67 × 100 copies/μL, 3.07 × 106 to 3.07 × 100 copies/μL, and 1.87 × 107 to 1.87 × 101 copies/μL, respectively. A-C were the detection limits of PRV, PPV or PCV3 in multiplex real-time PCR reaction system. D-F were the detection limit of the conventional PCR. G-H were the detection limits of a mixture of three standard plasmids in multiplex real-time PCR reaction system. The gels were cropped. Full-length gels are presented in Fig. S1. M, DL500 marker; NC, negative control

In order to evaluate the intra- and inter-assay reproducibility, three concentrations of 3.83 × 108, 3.83 × 106 and 3.83 × 104 copies/μL of standard plasmids were subjected to three parallel experiments under the same conditions, respectively. The results showed that the intra-assay CVs were below 0.97%, while that of inter-assay CVs were below1.44% (Table 3). Therefore, the multiplex real-time PCR assay was highly reproducible. The results showed a statistically significant difference (p < 0.05) between the two methods, indicating the superior sensitivity of the multiplex assay.

Table 3.

Intra- and Inter-assay reproducibility of the multiplex real-time PCR

Number of DNA Copies (copies/μL) Intra-assay Inter-assay
Mean Ct SD CV(%) Mean Ct SD CV(%)
3.83 × 108 8.58 0.08 0.97 8.56 0.12 1.44
3.83 × 106 13.52 0.11 0.8 13.37 0.16 1.22
3.83 × 104 19.94 0.13 0.63 19.96 0.12 0.62

Evaluation of multiplex real-time PCR assay in clinical samples

A total of 81 clinical tissue samples were tested by multiplex real-time PCR, PRV, PPV and PCV3 infection rates were 19.8% (16/81), 22.2% (18/81) and 16.0% (13/81), respectively. Meanwhile, the co-infection rates of PRV and PPV, PRV and PCV3, PPV, and PCV3 were 2.5% (2/81), 2.5% (2/81) and 7.4% (6/81), respectively (Table 4). These results were consistent with those detected by single real-time PCR assays. Although the infection rate of conventional PCR was lower than that of multiplex real-time PCR (Table 4), which indicated that multiplex real-time PCR was more sensitive than conventional PCR.

Table 4.

Detection results of clinical samples by multiplex real-time PCR and conventional PCR

Regions Number of samples The multiplex real-time PCR The conventional PCR
PPVa PRVa PCV3a PRV + PPV PRV + PCV3 PPV + PCV3 PRV + PPV + PCV3 PPVa PRVa PCV3a PRV + PPV PRV + PCV3 PPV + PCV3 PRV + PPV + PCV3
Foshan 17 7/17 6/17 7/17 2/17 1/17 2/17 1/17 6/17 5/17 5/17 1/17 1/17 2/17 1/17
Yangjiang 8 1/8 2/8 0/8 0/8 1/8 0/8 0/8 1/8 1/8 0/8 0/8 1/8 0/8 0/8
Jiangmen 9 2/9 1/9 0/9 0/9 0/9 1/9 0/9 2/9 1/9 0/9 0/9 0/9 1/9 0/9
Maoming 11 2/11 1/11 2/11 0/11 0/11 1/11 0/11 2/11 1/11 2/11 0/11 0/11 1/11 0/11
Zhongshan 4 0/4 1/4 0/4 0/4 0/4 0/4 0/4 0/4 1/4 0/4 0/4 0/4 0/4 0/4
Guangzhou 10 2/10 2/10 2/10 0/10 0/10 1/10 0/10 1/10 2/10 1/10 0/10 0/10 0/10 0/10
Dongguan 5 1/5 0/5 0/5 0/5 0/5 0/5 0/5 1/5 0/5 0/5 0/5 0/5 0/5 0/5
Qingyuan 10 2/10 2/10 2/10 0/10 0/10 1/10 0/10 1/10 1/10 1/10 0/10 0/10 0/10 0/10
Shaoguan 7 1/7 1/7 0/7 0/7 0/7 0/7 0/7 1/7 0/7 0/7 0/7 0/7 0/7 0/7
Total 81

18/81

(22.2%)

16/81

(19.8%)

13/81

(16.0%)

2/81

(2.5%)

2/81

(2.5%)

6/81

(7.4%)

1/81

(1.2%)

15/81

(18.5%)

12/81

(14.8%)

11/81

(13.6%)

1/81

(1.2%)

2/81

(2.5%)

4/81

(4.9%)

1/81

(1.2%)

aThe date include co-infections

Discussion

Currently, the attenuated PRV vaccine, characterized by the deletion of the gE gene, is widely used in China to prevent PRV infection in swine herds. This study leveraged the gE gene as a target in our multiplex real-time PCR assay, enabling the differentiation of vaccine strains from wild-type strains. To ensure specificity, we analyzed conserved regions within the gE gene of PRV, the NS1 gene of PPV, and the Cap gene of PCV3, and designed specific primers. Furthermore, considering the GC/AT ratio, length, and sequence of the amplicons, we identified distinct melting curve peak values for each target: 90 °C for PRV, 84 °C for PPV, and 80 °C for PCV3. This unique melting curve profile enabled the development of a SYBR Green I-based multiplex real-time PCR assay for the simultaneous detection and differentiation of these three common swine reproductive failure viruses.

Several multiplex real-time PCR assays have been developed for the simultaneous detection of PRV, PPV, or PCV3. Pérez et al. developed a SYBR Green I-based multiplex PCR assay capable of differentiating PCV2, PPV, PRV, TTSuV1, and TTSuV2, but its limit of detection ranged from 3.65 × 103 to 5.04 × 103 copies of DNA template per reaction [23]. Tian et al. developed a SYBR Green I-based duplex PCR assay to differentiate PRV and PCV3, but it only distinguished these two viruses associated with porcine reproductive failure [17]. While Wu et al. established a TaqMan-based multiplex PCR assay to distinguish PRRSV-NA, PRV, CSFV, PPV1, and JEV in two separate tubes, and Liu et al. developed a TaqMan-based multiplex PCR assay for the simultaneous detection of ASFV, PCV2, and PRV, these TaqMan-based assays, despite their higher sensitivity, are more expensive than SYBR Green I-based assays [24, 25]. This study aimed to develop a cost-effective SYBR Green I-based multiplex real-time PCR assay for the simultaneous detection and differentiation of PRV, PPV, and PCV3. Our assay exhibited high sensitivity and was able to detect the corresponding viruses with reliable accuracy.

While TaqMan-based real-time PCR assays generally exhibit higher specificity compared to SYBR Green I-based assays, the latter can be cost-effective. In multiplex SYBR Green I-based PCR, non-specific amplification and melting curve peaks can arise due to the presence of multiple primers in a single reaction. In our study, although a non-specific melting curve peak was observed at 81.5 °C, it was readily distinguishable from the specific melting curve peaks of PRV, PPV, and PCV3 (90 °C, 84 °C, and 80 °C, respectively). This allowed for accurate differentiation and reliable diagnosis in the analysis of 81 clinical samples. While this multiplex real-time PCR assay shows significant advantages in terms of efficiency and accuracy, it is essential to acknowledge potential limitations. The use of SYBR Green I dye, while advantageous for its cost-effectiveness, raises the possibility of false positives due to non-specific binding. Furthermore, the detection of low-copy numbers of viral DNA in the presence of high-copy competitors might be challenging, requiring careful optimization and interpretation of results.

This study analyzed 81 clinical samples collected from pig farms in nine distinct regions of Guangdong Province using both the developed multiplex real-time PCR assay and conventional PCR assays. The single infection rate and co-infection rate observed in this study were lower compared to previous studies [17, 26, 27]. This discrepancy could be attributed to the fact that not all samples were collected from pigs exhibiting reproductive failure, as our sampling strategy focused on a broader range of clinical presentations. Additionally, the slightly lower positive rates observed in conventional PCR compared to our multiplex assay could be related to its lower sensitivity. Despite the lower overall prevalence observed in this study, the detection of PRV, PPV, and PCV3 infections in these samples highlights their continued presence in Chinese swine farms. Considering the potential harm posed by PCV3 and the substantial economic losses caused by PRV and PPV, strengthening clinical diagnosis and surveillance of these viruses is crucial for effective disease management and prevention.

Conclusions

This study successfully developed a SYBR Green I-based multiplex real-time PCR assay for the simultaneous detection of PRV, PPV, and PCV3. This novel assay offers a rapid, sensitive, and specific approach for the detection of multiple swine reproductive failure viruses. Its high efficiency and accuracy make it a valuable tool for large-scale clinical diagnosis and ongoing monitoring of PRV, PPV, and PCV3 infections in swine populations, aiding in effective disease management and prevention.

Supplementary Information

Supplementary Material 1. (15.7KB, docx)
Supplementary Material 2. (260.4KB, pdf)
Supplementary Material 3. (105.8KB, pdf)

Acknowledgements

We thank Hou Bo Ph. D for proofreading the manuscript.

Authors’ contributions

The study was conceived, designed by GJY, and critically revised by CLH. LWK and LAQ developed the multiplex real-time PCR assay and wrote the manuscript. ZF and WF analyzed data. YS collected clinical samples. HSJ revised the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by Guangdong Basic and Applied Basic Research Foundation (Grant No. 2019A1515110785 and 2022A1515140057). The funder played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

This study was approved by the Research Ethic Committee of the College of Life Science and Engineering, Foshan University. Experimental protocols for acquiring swine clinical samples were performed in strict accordance with the Chinese Regulations of Laboratory Animals. All of the farm owners provided written informed consent to collect the samples which were used in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Lihua Cao, Wenke Lv and Anqi Li contributed equally to this work.

References

  • 1.Ouyang T, Niu G, Liu X, Zhang X, Zhang Y, Ren L. Recent progress on porcine circovirus type 3. Infect Genet Evol. 2019;73:227–33. [DOI] [PubMed] [Google Scholar]
  • 2.Tan L, Yao J, Yang Y, Luo W, Yuan X, Yang L, Wang A. Current Status and Challenge of Pseudorabies Virus Infection in China. Virol Sin. 2021;36(4):588–607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rajkhowa S, Choudhury M, Pegu SR, Sarma DK, Hussain I. Development of a rapid loop-mediated isothermal amplification (LAMP) assay for visual detection of porcine parvovirus (PPV) and its application. Braz J Microbiol. 2021;52(4):1725–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lin J, Li Z, Feng Z, Fang Z, Chen J, Chen W, Liang W, Chen Q. Pseudorabies virus (PRV) strain with defects in gE, gC, and TK genes protects piglets against an emerging PRV variant. J Vet Med Sci. 2020;82(6):846–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sun Y, Liang W, Liu Q, Zhao T, Zhu H, Hua L, Peng Z, Tang X, Stratton CW, Zhou D, et al. Epidemiological and genetic characteristics of swine pseudorabies virus in mainland China between 2012 and 2017. PeerJ. 2018;6: e5785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Opriessnig T, Halbur PG. Concurrent infections are important for expression of porcine circovirus associated disease. Virus Res. 2012;164(1–2):20–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.An TQ, Peng JM, Tian ZJ, Zhao HY, Li N, Liu YM, Chen JZ, Leng CL, Sun Y, Chang D, et al. Pseudorabies virus variant in Bartha-K61-vaccinated pigs, China, 2012. Emerg Infect Dis. 2013;19(11):1749–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wang W, Cao L, Sun W, Xin J, Zheng M, Tian M, Lu H, Jin N. Sequence and phylogenetic analysis of novel porcine parvovirus 7 isolates from pigs in Guangxi, China. PLoS ONE. 2019;14(7): e0219560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mai J, Wang D, Zou Y, Zhang S, Meng C, Wang A, Wang N. High Co-infection Status of Novel Porcine Parvovirus 7 With Porcine Circovirus 3 in Sows That Experienced Reproductive Failure. Front Vet Sci. 2021;8: 695553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang Y, Yang KK, Wang J, Wang XP, Zhao L, Sun P, Li YD. Detection and molecular characterization of novel porcine parvovirus 7 in Anhui province from Central-Eastern China. Infect Genet Evol. 2019;71:31–5. [DOI] [PubMed] [Google Scholar]
  • 11.Wen S, Song Y, Lv X, Meng X, Liu K, Yang J, Diao F, He J, Huo X, Chen Z, et al. Detection and Molecular Characterization of Porcine Parvovirus 7 in Eastern Inner Mongolia Autonomous Region. China Front Vet Sci. 2022;9: 930123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Phan TG, Giannitti F, Rossow S, Marthaler D, Knutson TP, Li L, Deng X, Resende T, Vannucci F, Delwart E. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol J. 2016;13(1):184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Geng S, Luo H, Liu Y, Chen C, Xu W, Chen Y, Li X, Fang W. Prevalence of porcine circovirus type 3 in pigs in the southeastern Chinese province of Zhejiang. BMC Vet Res. 2019;15(1):244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Chen Y, Xu Q, Chen H, Luo X, Wu Q, Tan C, Pan Q, Chen JL: Evolution and Genetic Diversity of Porcine Circovirus 3 in China. Viruses 2019, 11(9). [DOI] [PMC free article] [PubMed]
  • 15.Chen GH, Tang XY, Sun Y, Zhou L, Li D, Bai Y, Mai KJ, Li YY, Wu QW, Ma JY. Development of a SYBR green-based real-time quantitative PCR assay to detect PCV3 in pigs. J Virol Methods. 2018;251:129–32. [DOI] [PubMed] [Google Scholar]
  • 16.Pan Y, Qiu S, Chen R, Zhang T, Liang L, Wang M, Baloch AR, Wang L, Zhang Q, Yu S. Molecular detection and phylogenetic analysis of porcine circovirus type 3 in Tibetan pigs on the Qinghai-Tibet Plateau of China. Virol J. 2022;19(1):64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tian RB, Jin Y, Xu T, Zhao Y, Wang ZY, Chen HY. Development of a SYBR green I-based duplex real-time PCR assay for detection of pseudorabies virus and porcine circovirus 3. Mol Cell Probes. 2020;53: 101593. [DOI] [PubMed] [Google Scholar]
  • 18.Ge M, Ren J, Xie YL, Zhao D, Fan FC, Song XQ, Li MX, Xiao CT. Prevalence and Genetic Analysis of Porcine Circovirus 3 in China From 2019 to 2020. Front Vet Sci. 2021;8: 773912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zheng LL, Chai LY, Tian RB, Zhao Y, Chen HY, Wang ZY. Simultaneous detection of porcine reproductive and respiratory syndrome virus and porcine circovirus 3 by SYBR Green I-based duplex real-time PCR. Mol Cell Probes. 2020;49: 101474. [DOI] [PubMed] [Google Scholar]
  • 20.Li YD, Yu ZD, Bai CX, Zhang D, Sun P, Peng ML, Liu H, Wang J, Wang Y. Development of a SYBR Green I real-time PCR assay for detection of novel porcine parvovirus 7. Pol J Vet Sci. 2021;24(1):43–9. [DOI] [PubMed] [Google Scholar]
  • 21.Tombácz D, Tóth JS, Petrovszki P, Boldogkoi Z. Whole-genome analysis of pseudorabies virus gene expression by real-time quantitative RT-PCR assay. BMC Genomics. 2009;10:491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yang ZZ, Habib M, Shuai JB, Fang WH. Detection of PCV2 DNA by SYBR Green I-based quantitative PCR. J Zhejiang Univ Sci B. 2007;8(3):162–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Pérez LJ, Perera CL, Frías MT, Núñez JI, Ganges L, de Arce HD. A multiple SYBR Green I-based real-time PCR system for the simultaneous detection of porcine circovirus type 2, porcine parvovirus, pseudorabies virus and Torque teno sus virus 1 and 2 in pigs. J Virol Methods. 2012;179(1):233–41. [DOI] [PubMed] [Google Scholar]
  • 24.Wu H, Rao P, Jiang Y, Opriessnig T, Yang Z. A sensitive multiplex real-time PCR panel for rapid diagnosis of viruses associated with porcine respiratory and reproductive disorders. Mol Cell Probes. 2014;28(5–6):264–70. [DOI] [PubMed] [Google Scholar]
  • 25.Liu H, Zou J, Liu R, Chen J, Li X, Zheng H, Li L, Zhou B: Development of a TaqMan-Probe-Based Multiplex Real-Time PCR for the Simultaneous Detection of African Swine Fever Virus, Porcine Circovirus 2, and Pseudorabies Virus in East China from 2020 to 2022. Vet Sci 2023, 10(2). [DOI] [PMC free article] [PubMed]
  • 26.Song C, Zhu C, Zhang C, Cui S. Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene. Virol J. 2010;7:353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yuan L, Liu Y, Chen Y, Gu X, Dong H, Zhang S, Han T, Zhou Z, Song X, Wang C. Optimized real-time fluorescence PCR assay for the detection of porcine Circovirus type 3 (PCV3). BMC Vet Res. 2020;16(1):249. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (15.7KB, docx)
Supplementary Material 2. (260.4KB, pdf)
Supplementary Material 3. (105.8KB, pdf)

Data Availability Statement

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES