AAV2-PDE6B restores retinal structure and function in the retinal degeneration 10 mouse model of retinitis pigmentosa by promoting phototransduction and inhibiting apoptosis

Abstract

Retinitis pigmentosa is a group of inherited diseases that lead to retinal degeneration and photoreceptor cell death. However, there is no effective treatment for retinitis pigmentosa caused by PDE6B mutation. Adeno-associated virus (AAV)-mediated gene therapy is a promising strategy for treating retinitis pigmentosa. The aim of this study was to explore the molecular mechanisms by which AAV2-PDE6B rescues retinal function. To do this, we injected retinal degeneration 10 (rd10) mice subretinally with AAV2-PDE6B and assessed the therapeutic effects on retinal function and structure using dark- and light-adapted electroretinogram, optical coherence tomography, and immunofluorescence. Data-independent acquisition-mass spectrometry-based proteomic analysis was conducted to investigate protein expression levels and pathway enrichment, and the results from this analysis were verified by real-time polymerase chain reaction and western blotting. AAV2-PDE6B injection significantly upregulated PDE6β expression, preserved electroretinogram responses, and preserved outer nuclear layer thickness in rd10 mice. Differentially expressed proteins between wild-type and rd10 mice were closely related to visual perception, and treating rd10 mice with AAV2-PDE6B restored differentially expressed protein expression to levels similar to those seen in wild-type mice. Kyoto Encyclopedia of Genes and Genome analysis showed that the differentially expressed proteins whose expression was most significantly altered by AAV2-PDE6B injection were enriched in phototransduction pathways. Furthermore, the phototransduction-related proteins Pde6α, Rom1, Rho, Aldh1a1, and Rbp1 exhibited opposite expression patterns in rd10 mice with or without AAV2-PDE6B treatment. Finally, Bax/Bcl-2, p-ERK/ERK, and p-c-Fos/c-Fos expression levels decreased in rd10 mice following AAV2-PDE6B treatment. Our data suggest that AAV2-PDE6B-mediated gene therapy promotes phototransduction and inhibits apoptosis by inhibiting the ERK signaling pathway and upregulating Bcl-2/Bax expression in retinitis pigmentosa.

Introduction

Retinitis pigmentosa (RP) has a worldwide prevalence of 0.025%−0.04%, and as such is one of the leading causes of severe low vision or incurable blindness among people aged 20 to 60 years (Parmeggiani, 2011; Dias et al., 2018). The initial symptom is night blindness, which occurs because of rod cell dysfunction (Voisin et al., 2023; García-Ayuso et al., 2024). As the disease progresses, progressive degeneration of rod photoreceptors leads to the gradual loss of peripheral vision (Kaur and Singh, 2023). Subsequently, central vision declines, leading to severe visual impairment or even complete blindness, because of cone cell loss, either as a direct result of disease progression or secondary to rod cell death (Parmeggiani, 2011; Daiger et al., 2013). RP can be autosomal dominant (15%–25%), autosomal recessive (5%–20%), X-linked (5%–15%), or simplex/multiplex (40%–50%) (Berson, 1996). Among patients with autosomal recessive RP (arRP), mutation of the PDE6B gene encoding the β subunit of the rod cGMP phosphodiesterase 6 (PDE6) accounts for 5%–8% of cases (Kim et al., 2019).

Photon absorption triggers rhodopsin to activate the phototransduction cascade by facilitating the exchange of GTP for GDP, which in turn activates PDE in rod cells by promoting release of the inhibitory PDEγ subunit. PDE activation leads to rapid decline in cytoplasmic cGMP levels, closure of Ca²⁺ channels, and hyperpolarization of the rod plasma membrane (Chen, 2005). The absence of PDE6 activity due to PDE6B mutation significantly alters the expression of genes closely related to visual perception and phototransduction, as determined by RNA sequencing (Karademir et al., 2022; Xu et al., 2022b), thereby disrupting the phototransduction cascade (Das et al., 2022). PDE6 dysfunction results in cGMP and Ca²⁺ accumulation, increased Bax/Bcl-2 expression, and, ultimately, rod and cone cell apoptosis (Newton and Megaw, 2020; Das et al., 2022; Yamoah et al., 2023).

Recently, progress has been made in using adeno-associated virus (AAV)-mediated gene therapy to restore retinal function and remaining photoreceptor structure (Basavarajapp et al., 2023). Delivery of AAV-PDE6B to retinal degeneration 10 (rd10) mice significantly preserves the structure of the outer nuclear layer (ONL), elevates electroretinogram (ERG) b-wave amplitudes, and improves behavioral performance in dim lighting conditions (Pang et al., 2008; Allocca et al., 2011). While these studies suggested that the phototransduction cascade was disrupted at the gene expression level in rd10 mice, it remains unclear whether expression of the associated proteins is also altered. Furthermore, it is not known whether the expression of photoreceptor-associated proteins other than PDE6β is altered following AAV-mediated gene therapy. In this study, we verified the structural and functional recovery of the retina after injecting rd10 mice with AAV2-PDE6B, explored the protein networks and underlying pathways involved in this process by data-independent acquisition (DIA)-mass spectrometry (MS)-based proteomic analysis, and confirmed the results using molecular biology methods.

Methods

Plasmid construction and preparation of adeno-associated virus vector

Synthesized PDE6B-P2A was cloned into pAAV-CMV-MCS-EGFP-3FLAG-tWPA (referred as AAV2-EGFP; Additional Figure 1 ^{(690KB, tif)} A), yielding pAAV-CMV-PDE6B-P2A-EGFP-3FLAG-tWPA (referred as AAV2-PDE6B; Additional Figure 1 ^{(690KB, tif)} B). AAV vectors were obtained from the supernatants of HEK293T cells co-transfected with pHelper, pAAV-RC, and AAV2-EGFP/AAV2-PDE6B. Two rounds of CsCl gradient centrifugation and one round of ultrafiltration were performed to purify the AAV vectors. Physical titers were determined by PCR quantification (Wang et al., 2021).

Animal experiments

Female and male wild-type (WT) C57BL/6J mice were purchased from Beijing Vital River Laboratory Animal Technologies Co. Ltd. (Beijing, China, license No. SCXK (Jing) 2021-0006). Female and male rd10 mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA, Cat# JAX 004297, RRID: IMSR_JAX:004297). All experimental procedures involving animals were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved by Animal Ethics Committee of Henan Eye Hospital/Henan Eye Institute on June 28, 2021 (approval No. HNEECA-2021-10). Mice were housed with a 12/12-hour light/dark cycle at 22 ± 2°C with 50% ± 5% humidity and had ad libitum access to food and water. A maximum of five mice housed in each cage.

WT C57BL/6J mice and rd10 mice at postnatal day (P) 7 were randomly divided into three groups (n = 15–19 mice per group): (1) WT + AAV2-EGFP: one eye was subretinally injected with 1 μL of AAV2-EGFP (containing 3.61 × 10⁹ vg); (2) rd10 + AAV2-EGFP: one eye was subretinally injected with 1 μL of AAV2-EGFP (containing 3.61 × 10⁹ vg); (3) rd10 + AAV2-PDE6B: one eye was subretinally injected with 1 μL of AAV2-PDE6B (containing 3.61 × 10⁹ vg). To administer the subretinal injections, the mice were anesthetized by intraperitoneal injection of 1.25% tribromoethanol (0.2 mL/10 g, Nanjing AIBI Bio-technology Co., Ltd, Nanjing, China, Cat# M2920), and an incision was made to the skin between the upper and lower lids. Then, a Hamilton syringe with a 32-gauge blunt needle (Hamilton Medical, Bonaduz, Switzerland) was inserted through the aperture, and the relevant virus was injected into the subretina. After injection, the mice were maintained in a dark environment for 2 weeks, then returned to the normal 12/12-hour light/dark cycle for another week.

Real-time polymerase chain reaction

Total RNA was extracted from HEK293T cells (Shanghai QuiCell Biotechnology Co., Ltd., Shanghai, China, Cat# QuiCell-2342) and mouse retinas utilizing TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA, Cat# 15596026). HEK293T is a commonly used mammalian cell line that is easy to transfect, making it a good choice for a wide variety of studies (Cao et al., 2021; Chi et al., 2021). In this study, HEK293T cells were used to determine the transduction efficiency of AAV vectors; the results are shown in Additional Figure 2 ^{(883.7KB, tif)} . Complementary DNA was generated by using a PrimeScript® RT kit (Takara Biotechnology, Dalian, China, Cat# RR047A). Real-time polymerase chain reaction was performed using 20 μL of PowerUp^TM SYBR® Green Master Mix (Thermo Fisher Scientific, Cat# A25742) and an ABI Prism 7500 system (Applied Biosystems, Thermo Fisher Scientific). The cycling conditions were as follows: 50°C for 2 minutes, then 95°C for 2 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. mRNA expression levels were normalized to β-actin, and all samples were detected in triplicate. Relative quantification was performed using the comparative 2^–ΔΔCt method. The primer sequences are shown in Additional Table 1.

Additional Table 1.

Sequence of primers used in this study

Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
Pde6b	GACATCAAAGTCATTCCCACAC	GATAAAGCCACTTTCTGCTACG
Pde6a	ACTAACAACCGCAAGGAATGGAAGG	CTGCCTGCTGCTTCTGCTTCTC
Rom1	CAAACGTCTGATGGATGAGTTG	GGGACGCCATCAATCAGATATA
Rho	CCATCAACTTCCTCACGCTCTACG	GTGGTGGTGAATCCTCCGAAGAC
Aldhlal	TTAATGGAGAGAGATCGTCTGC	AAATCCGACAAGTATGCATTGG
Necab2	AAGGTGTATGAAGGTGGGAGCAATG	CTGAGCAGCGACTGGATCTGATTG
Sec63	GACGGGAGTGATGCCAACAAGATC	TGCTTCTGCTGCTTTGCCTGAG
Rbp1	CTGAGCAATGAGAATTTCGAGG	CCTGTCAGATCTTCCTCAAACT
Bcl2	GATGACTTCTCTCGTCGCTAC	GAACTCAAAGAAGGCCACAATC
Bax	TTGCCCTCTTCTACTTTGCTAG	CCATGATGGTTCTGATCAGCTC
Actb	CTACCTCATGAAGATCCTGACC	CACAGCTTCTCTTTGATGTCAC

Western blotting

Total protein was extracted from HEK293T cells and mouse retinas with Lysis Buffer for WB/IP Assays (Yesen Biotechnology, Shanghai, China, Cat# 20118ES60) containing 1% protease inhibitor cocktail (ApexBio Technology, Houston, TX, USA, Cat# K1019). The lysed samples were centrifuged at 12,000 × g for 15 minutes, and the supernatants were collected. The protein concentrations were determined using a bicinchoninic acid (BCA) protein kit (Beyotime Biotechnology, Shanghai, China, Cat# P0011). Equal amounts (30–40 μg) of protein for each sample were separated on 10% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Burlington, VT, USA, Cat# IPVH00010). The membranes were blocked with 5% non-fat milk for 1.5 hours and incubated with specific primary antibodies overnight at 4°C. The antibodies were as follows: rabbit anti-PDE6B antibody (1:500, Thermo Fisher Scientific, Cat# PA1-722, RRID: AB_2161443), rabbit anti-PDE6A antibody (1:500, Thermo Fisher Scientific, Cat# PA1-720, RRID: AB_2268019), rabbit anti-Rom1 antibody (1:1000, Cusabio, Wuhan, China, Cat# CSB-PA344843ESR2HU, RRID: AB_3076310), rabbit anti-Efcbp2 antibody (1:1000, Novus Biologicals, CO, USA, Cat# Nbp1-84002, RRID: AB_11028373), rabbit anti-Aldh1a1 antibody (1:500, Huabio, Hangzhou, China, Cat# ET1605-24, RRID: AB_3069708), rabbit anti-Rhodopsin antibody (Rho; 1:1000, Huabio, Cat# ET1704-12, RRID: AB_3070464), rabbit anti-Sec63 antibody (1:500, Proteintech, Wuhan, China, Cat# 13978-1-AP, RRID: AB_2186546), rabbit anti-Rbp1 antibody (1:1000, Proteintech, Cat# 22683-1-AP, RRID: AB_11182381), mouse anti-Bcl2 antibody (1:1000, Proteintech, Cat# 60178-1-LG, RRID: AB_10734459), rabbit anti-Bax antibody (1:1000, Abcam, Cambridge, MA, USA, Cat# ab32503, RRID: AB_725631), rabbit anti-ERK1/2 antibody (1:1000, Cell Signaling Technology, Danvers, CO, USA, Cat# 4695, RRID: AB_390779), rabbit anti-phospho-ERK1/2 antibody (1:2000, Cell Signaling Technology, Cat# 4370, RRID: AB_2315112), rabbit anti-c-Fos antibody (phospho Ser32, 1:500, Immunoway, Plano, TX, USA, YP0442, RRID: AB_3076316), rabbit anti-c-Fos antibody (1:500, Huabio, Cat# ET1701-95, RRID: AB_3070261), rabbit anti-GAPDH antibody (1:1000, Proteintech, Cat# 10494-1-AP, RRID: AB_2263076), and rabbit anti-β-actin antibody (1:1000, Cell Signaling Technology, Cat# 4970, RRID: AB_2223172). After washing, the membranes were incubated with goat anti-rabbit IgG-HRP (1:10000, Absin Bioscience, Cat# abs20040, RRID: AB_2938713) and goat anti-mouse IgG-HRP (1:10000, Absin Bioscience, Shanghai, China, Cat# abs20039, RRID: AB_3076309) at room temperature for 2 hours. Signals were developed with an ECL kit (Millipore, Cat# WBKLS0500). Band intensity was quantified using ImageJ software (version 2.14.0; National Institutes of Health, Bethesda, MD, USA, RRID: SCR_003070; Rueden et al., 2017). The relative protein expression levels were normalized to GAPDH or β-actin.

4,6-Diamino-2-phenyl indole staining

Eyes were collected 3 weeks after subretinal injection and immersed in 4% paraformaldehyde for 4 hours, then embedded in optimum cutting temperature compound (Sakura Finetek., Tokyo, Japan, Cat# 4583) at –80°C. Frozen sections (with a thickness of 6–8 μm) were taken through the cornea-optic nerve axis. The nuclei were stained with 4,6-diamino-2-phenyl indole (DAPI, Beyotime Biotechnology, Cat# C1002) at room temperature for 0.5 hours in the dark. Fluorescence of the frozen sections was evaluated using a fluorescence microscope (Olympus, Tokyo, Japan).

Electroretinography

Three weeks after subretinal injection, retinal function after overnight dark adaption was evaluated by ERG following a previously described procedure (Lei et al., 2017). Mice were anesthetized by intraperitoneal injection of 1.25% tribromoethanol (Nanjing AIBI, Cat# M2920) at 0.2 mL/10 g of body weight in the dark under red dim light illumination. Each pupil was dilated with tropicamide phenylephrine eye drops (Santen Pharmaceutical, Osaka, Japan). A small gold-wire loop electrode was placed on each mouse cornea, a reference electrode was subcutaneously inserted into the back, and a ground electrode was inserted into the tail. A visual electrophysiology system (RetiMINER System; AiErXi Medical Equipment, Chongqing, China) was used to record the traces. Dark-adapted ERG was recorded with stimulus intensities ranging from –3 to 1 log cd·s/m², and light-adapted ERG was recorded at 0 and 1 log cd·s/m² after light adaption for 5 minutes. Responses to brief flashes were analyzed by measuring the amplitudes of the a- and b-waves. The amplitude of the a-wave was measured from the baseline to the nadir of a-wave, and the b-wave was measured from the nadir of the a-wave to the apex of the b-wave peak.

Optical coherence tomography

Three weeks after subretinal injection, retinal structure was measured by swept-source optical coherence tomography (VG200D SVision Imaging, Henan, China) (Guo et al., 2022). Mice were anesthetized by intraperitoneal injection of 1.25% tribromoethanol solution (Nanjing AIBI, Cat# M2920) at 0.2 mL/10 g of body weight. Mouse pupils were dilated with tropicamide phenylephrine eye drops.

Sample preparation for proteomics analysis

Retina samples were lysed for 5 minutes, followed by sonication for 2 minutes at 35% power, with 3-second pulses followed by 3-second pauses (Fisherbrand^TM Model 120 Sonic Dismembrator, 120 watt, Thermo Fisher Scientific). The samples were centrifuged at 14,000 × g for 10 minutes, and the supernatants were collected and centrifuged again at 14,000 × g for 10 minutes. The protein concentration in the resulting supernatants was determined using a BCA protein kit (Solarbio, Beijing, China, Cat# PC0020) and a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific). Equal amounts (100 μg) of protein from each sample were reduced with dithiothreitol (Sigma, St. Louis, MO, USA, Cat# 43815) at a final concentration of 10 mM for 1 hour at 37°C, and then alkylated with iodoacetamide (Sigma, Merck, St. Louis, MO, USA, Cat# 16125) at a final concentration of 40 mM in the dark at room temperature for 1 hour. The alkylated proteins were washed three times with 50 mM NH₄HCO₃ (Sigma, Cat# 5.33005) at 14,000 × g for 15 minutes. Trypsin (Promega, Madison, WI, USA) and 80 μL 50 mM NH₄HCO₃ (Sigma, Cat# 5.33005) were added to the samples at a 50:1 protein-to-enzyme ratio in new tubes and incubated for 12–16 hours at 37°C. After centrifuging at 14,000 × g for 20 minutes, the digested peptides were washed twice with 50 mM NH₄HCO₃ (Sigma, Cat# 5.33005). The digestion was stopped by adding 1% formic acid (FA, Sigma, Cat# 5.33002), followed by vacuum drying at 60°C. The peptides were then resuspended in 30 μL 0.1% FA, and the peptide concentration in each sample was determined using a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific). Finally, 10 μg of peptides from each sample were combined and analyzed to build a spectral library.

Label-free proteomic analysis by liquid chromatography tandem mass spectrometry

An Ekspert NanoLC 415 (AB Sciex, Framingham, MA, USA) coupled with a Triple TOF 6600 mass spectrometer (AB Sciex) was used to perform the proteomic analysis. The peptides (10 μg) were resuspended in buffer A (0.1% FA, 2% acetonitrile (Sigma, Cat# 1.00029), 97.9% H₂O) and desalted on a C18 trap column (10 mm × 0.3 mm, particle size: 5 μm, 120 A) at a flow rate of 10 μL/min. Then the trap column was eluted with a nonlinear increasing concentration of buffer B (97.9% acetonitrile, 2% H₂O, 0.1% FA) at a flow rate of 5 μL/min. The buffer B gradient was as follows: 0 minutes-5%, 1 minute-6%, 40 minutes-22%, 52 minutes-80%, 55 minutes-80%, 56 minutes-5%, 60 minutes-5%. The peptides were then passed through an analytical C18 column (150 mm × 0.3 mm, particle size: 3 μm, 120 A) after which they were subjected to liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis.

The mass spectrometer was operated in positive mode using data-dependent acquisition (DDA) to build a spectral library for protein identification and quantification (Jin et al., 2022). For DDA, TOF MS accumulation time was set as 0.25 seconds with a mass range of 300–1500 Da. The selected charge state was set at +2 to +5. Mass tolerance was set as less than 50 ppm. A maximum of 60 candidate ions were selected during each cycle, and former target ions were excluded for 15 seconds, with the “rolling collision energy” used as the collision energy. The product ion accumulation time was set to 32 ms, coupled with a high sensitivity scan mode. DIA was used to analyze the samples. For the DIA analysis, the TOF MS accumulation time was set to 0.25 seconds, with a mass range of 100–1500 Da. A variable window calculator (AB Sciex; version 1.1) was used to optimize the 100 scanning windows. The accumulation time for each window was set as 32 ms. Ion spray voltage floating was set at 2300 V.

Data processing

The database of the raw data collected by MS was processed using Proteinpilot software (AB Sciex; version 5.0.1). Trypsin/P was chosen as the enzyme digestion option, allowing up to two missed cleavages sites, as previously described (Jin et al., 2022). Peptides and proteins were identified by searching the Uniprot mouse database (17,050 entries, 2020.03; https://www.uniprot.org/), and these search results were then processed using PeakView software (AB Sciex; version 2.2) to generate the final database. Six peptides were chosen for each protein, and six transitions for each peptide. The confidence for peptide identification was set at 99%. False discovery rate thresholds for protein, peptide, and modification site were set to 1%. Modified peptides were excluded. The mass error tolerance was set to 50 ppm. The retention time was corrected by choosing two endogenous peptides every 10 minutes. The quantitative value was set as the prominent peak area. All of the data included in the database according to these criteria were statistically analyzed, the proteins with quantitative values (less than 33% missing values in each group) were identified, and the protein expression P values were calculated by Student’s t-test. Differentially expressed proteins (DEPs) were defined as those with a fold change (FC) > 1.5 and P < 0.05. These DEPs were then subjected to further bioinformatics analysis. Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genome (KEGG) pathway, and Reactome pathway analyses were performed with clusterProfiler (http://www.bioconductor.org/packages/release/bioc/html/clusterProfiler, RRID: SCR_016884).

Statistical analysis

No statistical methods were used to predetermine sample sizes; however, our sample sizes are similar to those reported in previous publications (Roybal et al., 2018; Xu et al., 2022a, b; Aryal et al., 2023). Results are expressed as mean ± standard error of the mean. All statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, San Diego, CA, USA, RRID: SCR_002798). Experimental data were analyzed by one-way or two-way analysis of variance followed by the Bonferroni correction. P < 0.05 was considered statistically significant.

Results

Injection with AAV2-PDE6B preserves retinal structure

Three weeks after subretinal injection, retinas were isolated for real-time PCR and western blotting analysis. PDE6B mRNA expression level and PDE6β increased significantly in rd10 mice following subretinal injection with AAV2-PDE6B (Figure 1A and B). Retinal structure was assessed by immunofluorescence and OCT. Rd10 mice that were injected subretinally with AAV2-PDE6B exhibited a greater number of photoreceptor nuclei in the ONL than did mice in the rd10 + AAV2-EGFP group (Figure 1C). The OCT results demonstrated a thinner ONL in the rd10 + AAV2-EGFP group compared with that in the WT + AAV2-EGFP group (Figure 1D). In contrast, AAV2-PDE6B-treated eyes showed significant preservation of ONL thickness (Figure 1D and Additional Figure 3 ^{(273.7KB, tif)} ). Overall, these findings suggest that AAV2-PDE6B injection contributed to substantial preservation of the retinal structure, especially the ONL.

Figure 1.

Subretinal injection of AAV2-PDE6B into retinal degeneration 10 (rd10) mice significantly increases ONL thickness and dark- and light-adapted ERG responses.

Wild-type (WT) mice and rd10 mice were subretinally injected with AAV2-EGFP or AAV2-PDE6B (3.61 × 10⁹ vg/eye, n = 6–8 mice per group). (A) The Pde6b mRNA level in mouse retinas was detected 3 weeks after injection (n = 3 retinas). (B) The PDE6β protein level in mouse retinas was detected 3 weeks after injection (n = 4 retinas). DAPI staining (nuclei) of representative retinal sections (C, image magnification, 200×) and OCT results (D, scale bar: 200 μm) from WT mice and rd10 mice subretinally injected with AAV2-EGFP or AAV2-PDE6B. (E) ERG responses of WT + AAV2-EGFP group, rd10 + AAV2-EGFP group and rd10 + AAV2-PDE6B group were presented. Summary of ERG amplitudes versus flash intensity profiles for the dark-adapted a-wave (F), dark-adapted b-wave (G), and light-adapted b-wave (H). The results are shown as the mean ± SEM. **P < 0.01, ***P < 0.001, vs. rd10 + AAV2-EGFP group (two-way analysis of variance followed by Bonferroni correction). AAV: Adeno-associated virus; DAPI: 4′,6-diamidino-2-phenylindole; EGFP: enhanced green fluorescent protein; ERG: electroretinogram; GCL: ganglion cell layer; INL: inner nuclear layer; OCT: optical coherence tomography; ONL: outer nuclear layer; PDE6B: phosphodiesterase 6B; PDE6β: rod cGMP-specific 3′,5′-cyclic phosphodiesterase subunit beta.

Injection with AAV2-PDE6B protects retinal function

Three weeks after subretinal injection, the electrophysiological function of the mice in the three different groups was determined by dark- and light-adapted ERGs. The a- and b-wave amplitudes represent the function of photoreceptors and postsynaptic cells, mainly bipolar cells. Rd10 mice showed minimal dark- and light-adapted ERG responses, suggesting severely impaired retinal function (Figure 1E). However, when the stimulus intensity was 0 log cd·s/m², the average dark-adapted ERG a-wave and b-wave amplitudes in the rd10 + AAV2-PDE6B group were 33.8 μV and 144.9 μV, respectively, which were 87.8% and 78.2% of the corresponding wave amplitudes in the WT + AAV2-EGFP group (Figure 1F and G). The average dark-adapted ERG a-wave and b-wave amplitudes were 36.3 μV and 153.3 μV at 1 log cd·s/m² after injection with AAV2-PDE6B, which were 64.4% and 79.6% of the corresponding wave amplitudes in the WT + AAV2-EGFP group (Figure 1F and G). As for the light-adapted ERG b-wave, the average amplitude in the rd10 + AAV2-PDE6B group was 28.9 μV at 1 log cd·s/m², which was 63.9% of the corresponding wave amplitude in the WT + AAV2-EGFP group (Figure 1H). Overall, the a- and b-wave amplitudes induced by different stimulus intensities increased significantly after subretinal injection with AAV2-PDE6B. These results indicate that AAV2-PDE6B injection preserved retinal function in rd10 mice.

Overview of the proteomics analysis

Quantitative proteomics were performed by liquid chromatography tandem mass spectrometry in DIA mode, with three biological repeats, to identify changes in retinal protein expression among the three different groups (Figure 2A). A total of 4147 proteins were identified in all samples (n = 9), and the expression levels of 4128 of them were quantified. Among these 4128 proteins, 206 DEPs (FC > 1.5, P < 0.05) were identified between the rd10 + AAV2-EGFP and WT + AAV2-EGFP groups, with 112 down-regulated proteins and 94 up-regulated proteins (Figure 2B). There were 59 DEPs between the rd10 + AAV2-PDE6B and rd10 + AAV2-EGFP groups, with 27 down-regulated proteins and 32 up-regulated proteins (Figure 2C). Notably, one of the DEPs, Pde6β, was down-regulated in the rd10 + AAV2-EGFP group compared with the WT + AAV2-EGFP group, but up-regulated after subretinal injection of AAV2-PDE6B, as shown in the volcano plots (Figure 2B and C). The data shown in the volcano plots confirmed successful transduction and expression of AAV2-PDE6B.

Figure 2.

Overview of the proteomics analysis.

(A) Workflow of sample preparation for DIA-MS-based proteomic analysis. After subretinal injection of different vectors, wild-type (WT) mice and retinal degeneration 10 (rd10) mice were housed in the dark for 2 weeks, then moved to a normal 12/12-hour light/dark cycle for another 1 week. Retinas were obtained and processed for proteomics analysis (n = 3 retinas per group). (B, C) Volcano plots of DEPs (FC > 1.5, P < 0.05) between different groups. Pde6β is indicated in both plots. AAV: Adeno-associated virus; DEPs: differentially expressed proteins; DIA: data-independent acquisition; EGFP: enhanced green fluorescent protein; FC: fold change; G: rd10 + AAV2-EGFP group; MS: mass spectrometry; P: rd10 + AAV2-PDE6B group; PDE6B: phosphodiesterase 6B; PDE6β: rod cGMP-specific 3′,5′-cyclic phosphodiesterase subunit beta; W: WT + AAV2-EGFP group; WT: wild-type.

AAV2-PDE6B treatment rescues expression levels of retinal proteins

The expression levels of 35 DEPs in rd10 mice were restored to levels comparable to those seen in WT mice after subretinal injection of AAV2-PDE6B. Among these, 16 proteins that were up-regulated in the rd10 mice were down-regulated after subretinal injection with AAV2-PDE6B. The other 19 proteins showed the opposite expression pattern (Figure 3A). Aldehyde dehydrogenase1A1 (Aldh1a1), aided by retinol-binding protein 1 (Rbp1), oxidizes retinal to retinoic acids. Rbp1 also acts as carrier enzyme, transporting retinol from liver storage site to peripheral tissue. Aldh1a1 and Rbp1 were both up-regulated in the rd10 + AAV2-EGFP group, where they presumably consumed retinal, interfered with rhodopsin (Rho) synthesis, and disrupted visual cycle (Napoli, 2017; Goto et al., 2018). The expression of one of the other 19 proteins, Pde6 alpha (Pde6α), which is a subunit of PDE6 holoenzyme tetramer in the rod outer segment (OS), was up-regulated after treatment with AAV2-PDE6B (Figure 3A).

Figure 3.

Subretinal injection of rd10 mice with AAV2-PDE6B restores the expression levels of DEPs.

(A) Heatmaps showing DEPs (FC > 1.5, P < 0.05) that were dysregulated in rd10 mouse retinas and whose expression was restored by subretinal injection with AAV2-PDE6B. (B) Subcellular localization (photoreceptor OS, IS, or axon) of DEPs between the G and W groups. (C) Intensities of DEPs located in the photoreceptor OS. The results are shown as the mean ± SEM. *P < 0.05, **P < 0.01, vs. rd10 + AAV2-EGFP group (two-way analysis of variance followed by Bonferroni correction).

AAV: Adeno-associated virus; CC: connecting cilium; DEPs: differentially expressed proteins; EGFP: enhanced green fluorescent protein; FC: fold change; IS: inner segment; OS: outer segment; PDE6B: phosphodiesterase 6B; rd10: retinal degeneration 10; WT: wild-type.

Differentially expressed proteins primarily locate in the photoreceptor outer segment

The eye is a highly organized organ whose integrated tissues work together to capture and process visual information. Photoreceptors, which degenerate in arRP, are composed of an OS, connecting cilium (CC), inner segment (IS), cell body, and synaptic terminal. As a photosensitive component, the OS is formed by multiple stacks of discs, which containing proteins directly related to the phototransduction cascade. Since rd10 mice showed severe visual impairment, the subcellular localization of DEPs between WT and rd10 mice was analyzed by GO-cellular component (CC) analysis. The results showed that DEPs between WT and rd10 mice were located in the photoreceptor OS, photoreceptor IS, lysosome, and other components (Table 1). Some DEPs, for example Pde6β, rod outer segment membrane protein 1 (Rom1), and Rho, were primarily located in the photoreceptor OS (Figure 3B). Injection with AAV2-PDE6B significantly increased Pde6β, Rom1, and ATP-binding cassette transporter A4 (Abca4) (Figure 3C). The expression of other proteins, such as cyclic nucleotide-gated channel A1, increased to different degrees. GO-CC analysis also showed that the proteins whose normal expression levels were restored after AAV2-PDE6B treatment were primarily located in the photoreceptor OS (Table 2).

Table 1.

Cellular component terms enriched in differentially expressed proteins between the rd10 + AAV2-EGFP and WT + AAV2-EGFP groups

ID	Description	Gene ratio	P value	q value	Gene ID
GO:0001750	Photoreceptor outer segment	21/191	2.18E-26	5.33E-24	Abca4/Arr3/Bbs4/Cnga1/Gnat1/Gnat2/Gnb1/Gngt1/Grk1/Guca1b/Opn1mw/Opn1sw/Pdc/Pde6b/Prom1/Prph2/Rgs9/Rgs9bp/Rho/Rom1/Sag
GO:0001917	Photoreceptor inner segment	11/191	8.53E-13	4.17E-11	Arr3/Bbs4/Gnat1/Gnat2/Gnb1/Gngt1/Guca1b/Reep6/Rgs9/Rho/Sag
GO:0005764	Lysosome	17/191	9.99E-08	3.15E-06	Anxa2/Anxa6/Apoe/Ctsb/Ctsh/Ctsz/Gfap/Grn/Hexb/Lgmn/Naga/Rnaset2b/Sec13/Snx6/Sqstm1/Stx3/Tnfaip3
GO:0000323	Lytic vacuole	17/191	1.03E-07	3.15E-06	Anxa2/Anxa6/Apoe/Ctsb/Ctsh/Ctsz/Gfap/Grn/Hexb/Lgmn/Naga/Rnaset2b/Sec13/Snx6/Sqstm1/Stx3/Tnfaip3
GO:0019897	Extrinsic component of plasma membrane	11/191	3.91E-07	1.06E-05	Anxa2/Apoe/Ctnnd1/Gnat1/Gnat2/Gnaz/Gnb1/Gngt1/Kpna2/S100a6/Scrib
GO:0032432	Actin filament bundle	8/191	1.12E-06	2.72E-05	Anxa2/Daam1/Flna/Lcp1/Limch1/Myh9/Pdlim4/Pdlim5
GO:0062023	Collagen-containing extracellular matrix	14/191	1.60E-06	3.55E-05	Alb/Anxa2/Anxa6/Bgn/Ctsb/Ctsz/Rbp3/S100a6/Serpinc1/Serpinh1/Sparc/Spon1/Tgm2/Vwa5a
GO:1905360	GTPase complex	5/191	6.73E-06	0.00010268	Gnat1/Gnat2/Gnaz/Gnb1/Gngt1
GO:0034364	High-density lipoprotein particle	3/191	0.0008368	0.00659234	Apoe/Clu/Pon1
GO:0150034	Distal axon	10/191	0.0009377	0.00699855	Clu/Cnga1/Ctnnd1/Ctsz/Flna/Glul/Ncs1/Opn1sw/Stx3/Zpr1
GO:0043204	Perikaryon	5/191	0.0053588	0.02566018	Ckmt1/Dhx36/Glul/Slc12a5/Zpr1
GO:0005902	Microvillus	4/191	0.0065838	0.02725151	Bbs2/Msn/Prom1/Vcam1

AAV: Adeno-associated virus; EGFP: enhanced green fluorescent protein; rd10: retinal degeneration 10; WT: wild-type.

Table 2.

Cellular component terms enriched in differentially expressed proteins between the rd10 + AAV2-PDE6B and rd10 + AAV2-EGFP groups

ID	Description	Gene ratio	P value	q value	Gene ID
GO:0001750	Photoreceptor outer segment	5/56	1.28E-06	0.00016952	Abca4/Gngt1/Pde6b/Prom1/Rom1
GO:0035371	Microtubule plus-end	2/56	0.0013738	0.03036823	Mapre2/Mapre3
GO:0005925	Focal adhesion	5/191	0.0082355	0.03142507	Anxa6/Gsn/Lcp1/Msn/Myh9
GO:0022627	Cytosolic small ribosomal subunit	3/191	0.0097448	0.03305238	Fau/Rps10/Rps28

AAV: Adeno-associated virus; EGFP: enhanced green fluorescent protein; PDE6B: phosphodiesterase 6B; rd10: retinal degeneration 10; WT: wild-type.

Changed pathways and biological processes in rd10 mice

KEGG and GO enrichment analysis were performed to explore the changed pathways and biological processes in rd10 mice. KEGG analysis showed that the phototransduction pathway exhibited the most significant changes between rd10 mice and WT mice that both received AAV2-EGFP (Figure 4A). Visual perception, sensory perception of light stimulus, detection of light stimulus, and retina development in camera-type eye dominated the list of biological processes (BPs) that were altered in rd10 mice compared with WT mice, according to GO analysis (Figure 4B). Consistent with this, a recent RNA-seq study reported that visual perception and phototransduction were dysregulated in mice with Pde6b mutations (Xu et al., 2022b). In addition, the WNT signaling pathway was reported to be dysregulated in rd1 mice (Xu et al., 2022b), and we found that the expression levels of related proteins (Daam1, Gngt1, and Pde6β) were altered, as shown in Additional Tables 2 ^{(576.8KB, pdf)} –4 ^{(580.6KB, pdf)} . In addition to metabolic processes, cellular calcium ion homeostasis was disrupted in rd10 mice (Figure 4B).

Figure 4.

Functional analysis of DEPs (FC > 1.5, P < 0.05).

(A) KEGG pathway enrichment analysis of retinal DEPs between the G and W groups. Pathways with a P-value < 0.01 are shown. (B) GO database BP term enrichment analysis of retinal DEPs between the G and W groups. The top 10 BPs are shown. (C) KEGG pathway enrichment analysis between the P and G groups. Pathways with a P-value < 0.01 are shown. (D) GO database BP term enrichment analysis of retinal DEPs between the P and G groups. The top 10 BPs are shown. (E) PPI network of DEPs enriched in visual perception and phototransduction (left) and cellular calcium ion homeostasis (right). G/W (left) and P/G (right) ratios were calculated. The Z score is shown in the square beside the DEP name. Up-regulated and down-regulated DEPs are shown in red and blue, respectively. AAV: Adeno-associated virus; BP: biological process; DEPs: differentially expressed proteins; EGF: epidermal growth factor; EGFP: enhanced green fluorescent protein; FC: fold change; G: rd10 + AAV2-EGFP group; GO: gene ontology; KEGG: Kyoto Encyclopedia of Genes and Genome; NSM: nucleobase-containing small molecule; P: rd10 + AAV2-PDE6B group; PDE6B: phosphodiesterase 6B; PPI: protein-protein interaction; PST: postsynaptic signal transmission; rd10: retinal degeneration 10; SRPCP: SRP-dependent co-translational protein; W: WT + AAV2-EGFP group; WT: wild-type.

AAV2-PDE6B treatment restores the dysregulated pathways and biological processes in rd10 mice

To explore the function of the rescued retinal proteins by AAV2-PDE6B treatment, KEGG and GO enrichment analysis was performed. KEGG enrichment analysis showed that the pathway that was most altered after injection with AAV2-PDE6B was the phototransduction and visual phototransduction pathway (Figure 4C). The expression levels of proteins involved in the beta-catenin–independent WNT signaling and canonical WNT signaling pathways were also restored to WT levels when rd10 mice were injected with AAV2-PDE6B (Figure 4C). AAV2-PDE6B treatment resulted in enrichment of the GO-BP terms visual system development, eye development, sensory system development, visual perception, and photoreceptor cell maintenance (Figure 4D). GO-BP analysis revealed that the expression levels of proteins involved in visual perception and related development were rescued by subretinal injection with AAV2-PDE6B. The GO-BP and KEGG analysis results not only verified visual function recovery at the molecular level, but also suggested that visual perception/phototransduction may be the key mechanism by which AAV2-PDE6B rescues visual function.

Protein–protein interaction network

DEPs enriched in visual perception and phototransduction, and cellular calcium ion homeostasis were selected and used to construct a protein-protein interaction network (Figure 4E). Of particular interest were the proteins that were up-regulated in response to treatment with AAV2-PDE6B: Rho, short-wavelength opsin 1, middle-wavelength opsin 1 (Opn1mw), Abca4, Pde6α, and Rom1. Rho enhances retinal sensitivity to light under dark conditions. Pde6α and Rom1 play essential roles in the structural and functional maintenance of rod photoreceptors (Clarke et al., 2000; Nair et al., 2017). Other DEPs such as retinoid-binding protein (Rbp3) were rescued by AAV2-PDE6B delivery (den Hollander et al., 2009). The association of Pde6β with all 26 phototransduction-related proteins in the PPI suggested that Pde6β interacts functionally with these other proteins. GO-BP analysis revealed that Pde6b mutation in rd10 mice also dysregulated calcium-associated proteins, disrupting cellular Ca²⁺ homeostasis (Figure 4B and E). Significantly increased expression of protein-apolipoprotein E (ApoE) in rd10 mice when compared to WT mice, causing mitochondrion dysfunction, contributed to photoreceptor cell death in rd10 mice (Yin and Wang, 2018). Changes in the expression levels of calcium-associated proteins such as phospholipase C delta 1 (Plcd1) and transglutaminase type 2 (Tgm2) were reversed to different degrees by subretinal delivery of AAV2-PDE6B (Figure 4E). Dysregulation of intracellular Ca²⁺ homeostasis activates the ERK1/2-mediated pathway, triggering cell apoptosis (Patergnani et al., 2020; Song et al., 2020; Zhao et al., 2021). Therefore, it is reasonable to suppose that changing Pde6β expression levels alters the expression levels of other proteins, further regulating phototransduction and mediating apoptosis.

Treating rd10 mice with AAV2-PDE6B rescues phototransduction defects

Western blotting was carried out to confirm the proteomics data and verify the efficacy of AAV2-PDE6B in rescuing visual function. The mRNA and protein levels of Rho, Pde6α, and Rom1 in the rd10 + AAV2-EGFP group were significantly reduced compared with the WT + AAV2-EGFP group. However, subretinal injection with AAV2-PDE6B reversed this effect, inducing clear increases in both mRNA and protein expression levels (Figure 5A). Previous studies have reported that overexpression of Rbp1 and Aldh1a1 consumes excessive amounts of retinal, interferes with Rho synthesis, disrupts visual cycle (Napoli, 2017; Goto et al., 2018). Western blotting analysis showed that Aldh1a1 and Rbp1 were expressed at significantly higher levels in the rd10 + AAV2-EGFP group than in the WT + AAV2-EGFP group. Subretinal injection with AAV2-PDE6B induced a notable decrease in the mRNA and protein levels of Aldh1a1 and Rbp1 (Figure 5A). Western blotting analysis confirmed the proteomics results, indicating a close association between restoration of phototransduction with the ability of AAV2-PDE6B to rescue visual function.

Figure 5.

Expression levels of mRNAs and proteins associated with phototransduction (A) and anti-apoptotic signaling (B) in mouse retinas.

The results are shown as the mean ± SEM; n = 6–8 mice per group. *P < 0.05, **P < 0.01, ***P < 0.005, vs. rd10 + AAV2-EGFP group (one-way analysis of variance followed by Bonferroni correction). AAV: Adeno-associated virus; EGFP: enhanced green fluorescent protein; PDE6B: phosphodiesterase 6B; rd10: retinal degeneration 10; WT: wild-type.

ERK1/2 pathway and Bcl-2 help mediate the anti-apoptotic effects of AAV2-PDE6B

Deletion of Sec63 in podocytes activates endoplasmic reticulum (ER) stress, causing apoptosis (Hassan et al., 2016). To confirm the proteomics data and investigate whether anti-apoptosis takes part in the effects of AAV2-PDE6B, western blotting and real-time PCR were performed. Significantly decreased Sec63 expression was detected in the rd10 + AAV2-EGFP group (Figure 5B). Decreasing the ratio of Bcl-2 to Bax promotes apoptosis (Artur et al., 2018; Song et al., 2020), and this ratio was significantly reduced in the rd10 + AAV2-EGFP group than in the WT + AAV2-EGFP group (Figure 5B). Furthermore, considering the close relation between dysregulated intracellular Ca²⁺ homeostasis and apoptosis, apoptosis may play a role in photoreceptor cell death in rd10 mice. Interestingly, the anti-apoptotic genes sensitive to apoptosis (Sag) and ATPase phospholipid transporting 8a2 (Atp8a2) (Liu et al., 2020; Heidari et al., 2021) were up-regulated in rd10 mice (Figure 4E and Additional Tables 2 ^{(576.8KB, pdf)} –4 ^{(580.6KB, pdf)} ). The expression levels of other anti-apoptotic genes (Gadd45b, Clu, Cerkl, Krt18) were also significantly increased in rd10 mice than in WT mice (Karademir et al., 2022). Negative feedback regulation may explain the increased expression of these proteins. AAV2-PDE6B administered by subretinal injection clearly increased Sec63 expression and the Bcl-2/Bax ratio (Figure 5B), indicating an anti-apoptotic effect.

The expression of N-terminal EF-hand Ca²⁺-binding protein 2 (Necab2), which activates the ERK1/2 pathway in response to certain stimuli (Canela et al., 2007; Zhang et al., 2018), was significantly increased in the rd10 + AAV2-EGFP group by comparing to the WT + AAV2-EGFP group (Figure 5B). Given that the ERK1/2 pathway plays a role in apoptosis, stress, and other pathological processes, we verified changes in the expression levels of certain proteins in this pathway by western blotting. Necab2, the ratio of phosphorylated ERK1/2 to ERK1/2, and the ratio of phosphorylated c-Fos to c-Fos were significantly higher in the rd10 + AAV2-EGFP than in the WT + AAV2-EGFP group (Figure 5B). AAV2-PDE6B treatment clearly reduced Necab2 expression and the aforementioned ratios, demonstrating an inhibitory effect on the ERK1/2 pathway (Figure 5B).

Discussion

RP is a rare and incurable form of hereditary retinal dystrophy that affects approximately 1.5 million people worldwide (Cong et al., 2021). However, despite the large number of affected patients, there is no effective treatment for arRP caused by PDE6B mutation. Using murine models, several promising vectors for gene therapy for this condition have been developed (Pang et al., 2008; Allocca et al., 2011). While, the mechanism underlying visual recovery was not fully understood. Here we reported for the first time protein expression differences in rd10 mice and “gain-of-function” proteomic profile changes following AAV2-PDE6B administration.

In rd10 mice, DEPs were primarily located in the photoreceptor OS, where phototransduction occurs. Consistent with this, visual perception and phototransduction were the most significantly damaged biological process and pathway, respectively, in rd10 mice. These pathways were also shown to be damaged in a mutated Pde6b mouse model (Chen et al., 2022; Xu et al., 2022b). Disruption of the phototransduction cascade because of protein expression dysregulation could explain the symptoms of RP, such as night blindness, and loss of central vision (Mendes et al., 2005). AAV2-PDE6B treatment rescued visual perception and phototransduction, as well as the expression of phototransduction-related proteins. These results link recovery visual function to regulation of phototransduction.

Cyclic nucleotide-gated (CNG) channel plays a crucial role in the visual signal transduction pathway. As the major components, downregulation of Cnga1 impacts phototransduction, and increases Ca²⁺ influx, leading to disrupted cellular Ca²⁺ homeostasis in rd10 mice (Xue et al., 2021; Karademir et al., 2022). Consistent with this, Pde6b mutant mice show decreased Cnga1 expression, evident calcium dysregulation (Chen et al., 2022; Jiang et al., 2022; Karademir et al., 2022). Elevated cellular Ca²⁺ levels increase ATP consumption, activate mitogen-activated protein kinases (MAPKs) and ERKs through protein kinase C, leading to apoptosis (Newton and Megaw, 2020; Song et al., 2020; Chen et al., 2022). AAV2-PDE6B treatment reversed the dysregulated expression of apoptosis-related proteins, suggesting the anti-apoptotic effect, which further explained the preservation of ONL thickness following AAV2-PDE6B administration.

ERG and OCT are standard ophthalmic tests used to assess retinal function and structure (Motz et al., 2020). In agreement with the OCT and ERG results, GO-BP and KEGG analyses showed that AAV2-PDE6B treatment rescued phototransduction recovery and phototransduction-related protein expression. The ERG, OCT, and immunofluorescence results did not explain why the retinal electrophysiological function and structure did not fully recover to levels comparable to those seen in WT mice. Therefore, we performed proteomics analysis, a powerful and high-throughput technology, to identify and characterize disease-related proteins (Chularojanamontri et al., 2019; Peerapen and Thongboonkerd, 2021). The expression levels of some of the DEPs (for example, Cdc42bpb and Cdc42ep1) did not recover in response to AAV2-PDE6B treatment. A potential explanation for this is that Cdc42 activity is subject to dynamic spatiotemporal control (Miller et al., 2020). The treatment timepoint used in this study (P7) and the time needed for the AAV vector to be expressed may not have been optimal for restoring Cdc42 expression. In addition, surgically opening the eyelids and performing the subretinal injection induce some morbidity; and while we did our best to minimize trauma to the experimental animals and perform all procedures in the same way, some differences in technique were unavoidable. This could explain why the expression of proteins associated with the GO-BP term responses to wounding was dysregulated in rd10 mice and did not recover in response to AAV2-PDE6B treatment.

There were some limitations to our study. First, although it does not occur as early as photoreceptor degeneration in rd1 mice, the loss of photoreceptors in rd10 mice begins at P15, making it challenging to deliver gene therapy vectors within an effective timeframe. We elected to inject the mice at P7; however, this inevitably resulted in some trauma, as the eyes were not yet open. Second, due to time limitations, the effects of different vectors were only determined 3 weeks after injection. Longer observation periods would be helpful for detecting the function persistence of the vector, and will be incorporated into future studies.

In summary, our structural, electrophysiological, and proteomics findings confirmed the protective effects of subretinal AAV2-PDE6B administration on retinal degeneration. The mechanism underlying this therapeutic effect is not solely attributable to increased PDE6B expression, but also to restoring the expression levels of many other photoconduction-related proteins and exerting anti-apoptotic effects by inhibiting ERK1/2 signaling and increasing the Bcl-2/Bax ratio.

Additional files:

Additional Figure 1 ^{(690KB, tif)} : Plasmids map of pAAV-CMV-MCS-EGFP-3FLAG-tWPA (AAV2-EGFP, A) and pAAV-CMV-PDE6B-P2A-EGFP-3FLAG-tWPA (AAV2-PDE6B, B).

Additional Figure 1

Plasmids map of pAAV-CMV-MCS-EGFP-3FLAG-tWPA (AAV2-EGFP, A) and pAAV-CMV-PDE6B-P2A-EGFP-3FLAG-tWPA (AAV2-PDE6B, B).

Additional Figure 2 ^{(883.7KB, tif)} : Successful transduction of AAV vectors into HEK293T cells.

Additional Figure 2

Successful transduction of AAV vectors into HEK-293T cells.

(A) Fluorescence intensity of HEK-293T cells transduced with/without AAV2-EGFP or AAV2-PDE6B (MOI: 1 × 10⁵ vg/cell) for 5 days (GFP, green). Image magnification 100×. (B) PDE6B mRNA level in HEK-293T cells transduced with/without AAV2-EGFP or AAV2-PDE6B (MOI: 1 × 10⁵ vg/cell) for 5 days, respectively. (C) PDE6β protein level in HEK-293T cells transduced with/without AAV2-EGFP or AAV2-PDE6B (MOI: 1 × 10⁵ vg/cell) for 5 days, respectively. AAV: Adeno-associated virus; EGFP: enhanced green fluorescent protein; GFP: green fluorescent protein; PDE6B: phosphodiesterase 6B; PDE6β: rod cGMP-specific 3’,5’-cyclic phosphodiesterase subunit beta.

Additional Figure 3 ^{(273.7KB, tif)} : ONL and whole-retina thickness 300 µm away from the optic nerve.

Additional Figure 3

ONL and whole-retina thickness 300 μm away from the optic nerve.

The results are shown as the mean ± SEM (n=10–12 retinas from each group). ^***P < 0.001 (one-way analysis of variance followed by Bonferroni correction). ONL: outer nuclear layer.

Additional Table 1: Sequence of primers used in this study.

Additional Table 2 ^{(576.8KB, pdf)} : Quantitative proteomic data of the retinal proteins between the rd10+AAV2-EGFP and WT+AAV2-EGFP groups.

Additional Table 2

Quantitative proteomic data of the retinal proteins between the rd10+AAV2-EGFP and WT+AAV2-EGFP groups

Additional Table 3 ^{(577.5KB, pdf)} : Quantitative proteomic data of the retinal proteins between the rd10+AAV2-PDE6B and rd10+AAV2-EGFP groups.

Additional Table 3

Quantitative proteomic data of the retinal proteins between the rd10+AAV2-PDE6B and rd10+AAV2-EGFP groups

Additional Table 4 ^{(580.6KB, pdf)} : Quantitative proteomic data of the retinal proteins between the rd10+AAV2-PDE6B and WT+AAV2-EGFP groups.

Additional Table 4

Quantitative proteomic data of the retinal proteins between the rd10+AAV2-PDE6B and WT+AAV2-EGFP groups

Funding Statement

Funding: This study was supported by the National Natural Science Foundation of China, Nos. 82071008 (to BL) and 82004001 (to XJ); Medical Science and Technology Program of Health Commission of Henan Province, No. LHGJ20210072 (to RQ); and Science and Technology Department of Henan Province, No. 212102310307 (to XJ).

Data availability statement:

The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the iProX partner repository with the dataset identifier PXD033560. The data used to support the findings of this study are available within this manuscript and its supplementary information or from the corresponding authors on request.