Maternal derived antibodies and avian β-defensins expression patterns and their correlation in the yolk sac tissue of different chicken breeds (Gallus gallus)

Abstract

The expression of maternal derived antibodies (MDAs) and avian β-defensins (AvBDs) in yolk sac tissue may be age-specific and influenced by breed, thereby immunological window difference in hatchlings. This study investigated the mRNA expression of MDAs and AvBDs in the yolk sac tissues of Beijing You and Hy-Line Gray chickens from the embryonic day (ED)7 to 3 days after hatch (DAH). Hy-Line showed a higher embryo bodyweight and a lower residual yolk weight at ED17 (P < 0.05). The expression of IgY and FcRY was higher in the Hy-Line (P < 0.05). In Beijing You, IgA level decreased from ED15 to 19 but peaked from day old hatch to 3 DAH. In Hy-Line, IgA increased from ED19 to 3 DAH (P < 0.05). IgY increased from ED17 to day old hatch (DOH), but declined from DOH to 3 DAH in Beijing You, whereas in Hy-Line, it declined from ED9 to 15 and ED19 to 3 DAH (P < 0.05). FcRY expression declined from DOH to 3 DAH in Beijing You and from ED19 to 3 DAH in Hy-Line (P < 0.05). The expression of AvBD5 increased from ED7 to 13 and ED19 to 3 DAH, and decreased from ED13 to 19 in both breeds. A similar expression patterns of AvBD10 was observed in breeds, increased from ED7 to 11, followed by a decline after ED11. AvBD12 expression peaked at ED17 in Beijing You and from ED15 to 17 in Hy-Line (P < 0.05), then declined from ED17 to 3 DAH in both breeds. The study observed temporal expression development patterns of AvBD5 and AvBD10 in both breeds and AvBD12 in Beijing You, with a correlation coefficient of R² > 0.5. Overall, the lower yolk residue for faster growth of chickens compromised the expression of MDAs and AvBDs, except for IgA and AvBD5. These results suggest a broader immunological window and highlight the need to focus on maintaining specific MDAs and AvBDs in the strategies of embryonic feeding.

Introduction

Chicken embryos are exposed to various pathogens from the moment of egg oviposition and remain highly susceptible to diseases during the early post-hatch period due to their immature adaptive immune system (Alkie et al., 2019; Hincke et al., 2019; Orakpoghenor et al., 2023; Wlazlak et al., 2023). Despite this exposure, the remarkable viability of newly hatched chicks is primarily attributed to the harmonious and integral role of essential innate immune functions in the yolk sac tissue (YST) (Wong and Uni, 2021). YST plays an important role in immune function during embryonic development in eggs, serving as a transporter of maternal-derived antibodies (MDAs) from the egg yolk to the embryo (Bar-Shira et al., 2014; Hincke et al., 2019; Wong and Uni, 2021; Orakpoghenor et al., 2023). Additionally, it is a primary site for the expression of most avian β-defensins (AvBDs) during the embryogenesis of chicks (Zhang and Wong, 2019). However, the embryo shows signs of immune expression and is capable of mounting innate responses to different pathogens at embryonic age (Davison, 2003; Schilling et al., 2018). An immunological window can be observed due to the depletion of innate immune components before achieving immune independence during the late stage of incubation or in neonatal chicks (Bar-Shira et al., 2014; Jia et al., 2023). This depletion of innate immune components would be associated with the degradation of the YST and the lowering of the residual yolk.

The protective roles of MDAs in avian embryo are indeed contingent upon the types and amounts present in the egg (Friedman et al., 2012; Agrawal et al., 2016; Wong and Uni, 2021). The chicken egg contains 3 types of antibody; IgY, which is prevalent in the yolk (Kaspers et al., 1991; Hamal et al., 2006); IgA and IgM are predominantly found in the albumen of embryonic eggs (Rose and Orlans, 1981; Rose et al., 1974; Hamal et al., 2006; Wong and Uni, 2021). Moreover, expression levels and effectiveness of chick MDAs against pathogens are influenced by the hen's specific antigenic profile during transfer period (Bar-Shira et al., 2014). The hen's antibodies are directly related to the prevailing pathogens in rearing environment and to the genetics (Lemke and Lange, 1999; Gasparini et al., 2001; Lemke et al., 2003). Furthermore, the amount of IgY transferred to the egg yolk has been shown to be proportional to the IgY concentrations in maternal serum (Al-Natour et al., 2004). However, the expression level of IgY-Fc receptor (FcRY) in the YST of embryo could influence the IgY level in the offspring, as it plays a role in the transportation and protection of antibodies (Okamoto et al., 2024), while the association of antibodies and FcRY need further investigation. IgA expression also different in the egg yolk and egg white of two meat type of chicken lines (Hamal et al., 2006). Inclusively, these studies suggests that neonate chicks from certain breed lines may show a lower maternal derived antibody levels and a faster decline patterns compared with chicken from other breed lines, thereby more vulnerable to pathogens.

AvBDs are a major class of host defense peptides (HDPs) that play crucial role as components of innate immunity during the earlier stage of chick development (Rehault-Godbert et al., 2011; Hamad et al., 2017; Hincke et al., 2019; Alford et al., 2020; Mookherjee et al., 2020; Yoshimura et al., 2024). Moreover, AvBDs have antimicrobial activities and immunomodulatory properties (Meade et al., 2009; Hamad et al., 2017; van Dijk et al., 2018). It also contributes to boost adaptive immunity by promoting the chemotaxis of lymphocytes (Hamad et al., 2017). In chickens, 14 AvBDs (AvBDs1-14) have been identified and show a broad spectrum of antimicrobial activity against gram-negative, gram-positive bacteria, and fungi (Lee et al., 2016). Among these, AvBD5, 8, 10, and 12 demonstrate the greatest antimicrobial activity (Cuperus et al., 2013; Jang et al., 2020). However, these crucial safeguarding roles are influenced by the developmental and profiles of AvBDs (Levy, 2007; Jiao et al., 2009; Thaiss et al., 2016). The mRNA expression levels of AvBD10 and CATH reached peak during mid-embryogenesis embryonic days (ED)9 to 13 and subsequently declined during late incubation in the YST of both broilers and layers (Jia et al., 2023). These authors also indicated that the broilers exhibited lower mRNA levels of AvBD10, CATH1, and CATH2 compared to layer chickens. However, previous studies are insufficient to explain the reason for these differences in immune expression patterns among breeds; this may be attributed to trait preferences and/or genetics factors. Thus, further research to investigate the patterns of MDAs and AvBDs gene expression associated with embryonic growth and yolk utilization in different breed lines and ages of chicks could be necessary. This will provide insights into the immunological windows of specific target immune genes, which can serve as a theoretical foundation for the strategic manipulation of targeted innate immunity through in ovo feeding during the embryonic stage of chickens.

Therefore, this study investigated the comparable insights of Beijing You, a local slow-growing chicken breed (Ni et al., 2023) and Hy-Line Gray layer (a commercial layer breed) regarding the mRNA expression patterns of MDAs (IgA and IgY) and AvBDs (AvBD5, 8, 10, 12) from ED7 to 3 days after hatch (DAH).

Materials and methods

Ethics approval and protocol

The animal experiment design and procedures were approved by the Animal Care and Use Committee of the Institute of Feed Research, Chinese Academy of Agricultural Sciences. Accordingly, the field experiment was conducted ethically, with appropriate management and care provided throughout the study.

Egg incubation and experimental design

A total of 480 fertile eggs (n = 240 eggs/breed) from 45-week-old Beijing You and Hy-Line Gray chicken breeds were incubated. These eggs were sourced from commercial farms by taking into account the historical data of the two breed lines for the similarity of flock management in the farms. The selected average egg weight of Beijing You (58.7 ± 0.5 g) and Hy-Line breed (60.7 ± 0.5 g) were not statistically significant different. The eggs were stored in an egg storage facility under commercial conditions (12.8 °C dry bulb and 10.4 °C wet bulb temperatures) for 48 h, and were warmed to room temperature (23.9 °C dry bulb) for 4 h before being seat in incubation, as a procedure described by Zhang et al. (2018). Each breed of eggs was randomly divided and placed into eight trays, as replicate groups (30 eggs/tray) and incubated with a microcomputer automatic-controlled incubator (Model: BLFJ3520, Chengdu Beili Agricultural Technology Co., Ltd. Chengdu, China) set at 37.8 °C temperature, 90 degrees rotation every 2 h, and 60 % relative humidity. Prior to sampling, incubated eggs were candled at 7, 12, and 17 days of incubation to discard non-abundant and dead embryonic eggs.

Yolk sac tissue sample collection

From each breed, eight viable embryos at embryonic days ED7, ED9, ED11, ED13, ED15, ED17, ED19, and eight viable chicks at day old hatch (DOH) and at 3 DAH were randomly selected (one sample from each breed of replicate) and euthanized by cervical dislocation for the bodyweight growth performance and gene expression analysis. The YST was collected with a microcentrifuge tube by rinsed with cold PBS, immediately frozen in liquid nitrogen, and stored at -80°C refrigerator until further analysis of mRNA expression of the proposed genes.

Embryos and chicks growth performance analysis

The comparative growth of Beijing You and Hy-Line chickens was assessed by measuring yolk free body weight of embryos (YFBW) from ED7 to ED19 and body weight (BW) of chicks at DOH and 3 DAH. Moreover, yolk residual weight from ED17 to 3 DAH, the ratio of yolk residue to YFBW at ED17 and 19, and the ratio of yolk residue to BW of chicks at DOH and 3 DAH were analyzed. Yolk free BW of chick at post-hatch was calculated as live weight of chick minus residual yolk weight.

RNA extraction and gene expression analysis

The mRNA expression analysis of targeted MDAs and AvBDs from the collected YST was performed with qPCR procedure. The total RNA was isolated using TRIzol reagent (Invitrogen, thermo Fisher Scientific, Shanghai, China) according to the manufacturer's recommendation. Approximately 50 mg of tissue was homogenized with 1 mL of TRIzol reagent, and phase-separated using chloroform (200 μL). RNA was precipitated using isopropanol (400 μL), washed with 75 % ethanol, and solubilized with 30 μL nuclease-free water. The RNA concentration and purity were assessed by evaluating the optical density (OD) ratio at 260 nm to 280 nm using a Nanodrop-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). After extraction, a total of 1.5 μg RNA from each sample was reverse transcribed into complementary DNA (cDNA) using the EasyScript All-in-One First Strand cDNA synthesis SuperMix Kit (TransGen Biotech Co., Ltd, Beijing, China), following the manufacturer's protocol. The resulting cDNA was stored at -80 °C refrigerator.

Quantitative PCR (qPCR) reactions were performed with 5 μL of Fast SYBR Green Master mix (without ROX) (Applied Biosystems), 0.5 μL each of forward and reverse primers (10 μM), 2 μL of cDNA, and 2 μL of DEPC water. The duplicate biological qPCR reactions were conducted using an Applied Biosystems 7500 Fast Real-Time PCR system (Thermo Fisher Scientific) using the default fast program: 95 °C for 20 sec, 40 cycles of 90 °C for 3 sec and 60 °C for 30 sec. The primers for the both target and reference genes were designed using NCBI BLAST and Primer3 tools (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) (Xie et al., 2012), as shown in Table 1. The validation and stability of mRNA expression of both target and reference genes were tested using RefFinder (http://www.ciidirsinaloa.com.mx/RefFinder-master/?type=reference#tabs-1), as described (Xie et al., 2012). The GAPDH reference genes were used for relative gene expression analysis due to their greater expression stability across different sampling points during validation. The delta CT (ΔCT) was calculated by subtracting the CT value of reference gene from the CT value of target gene (Rao et al., 2013). The average ΔCT for embryos at ED7 was used as the calibrator. The relative mRNA expression levels of target genes were calculated using the 2^-ΔΔCT method (Livak and Schmittgen, 2001).

Table 1.

Primers sequences for real time quantitative PCR.

Gene	Forward primer (5’to 3’)	Reverse primer (5’to 3’)	Amplicon size (bp)	Accession number
IgA	ACCACGGCTCTGACTGTACC	CGATGGTCTCCTTCACATCA	100	S40610.1
IgY	GAATGGTTGGTGGACGGAGT	ACCTCTCCCCGGATAACCAA	457	LC706201.1
FcRY	GCAGTAGATACGACGGGTCC	TTTGATCCAGGGAACATTACTCTC	794	AY450642.1
AvBD5	CGGTGGTGTCAGGGATACTG	GAGTCAGGATCTGCATGGCT	149	NM_001001608.2
AvBD8	CATGCGCGTACCTAACAACG	CTGAGGTCCTGGCGAACATT	157	NM_001001781.1
AvBD10	TGGGGCACGCAGTCCACAAC	CAATCAGCTCCTCAAGGCAGTG	300	NM_001001609.3
AvBD12	AACCACGACAGGGGATTGTG	CTTGGTGGGAGTTGGTGACA	117	NM_001397753.2
GAPDH	CAGAACATCATCCCAGCGTCCA	ACGGCAGGTCAGGTCAACAA	135	NM_204305.1

Abbreviations: IgA, immunoglobulin A; IgY, immunoglobulin Y; FcRY, IgY-Fc immunoglobulin receptor; AvBD, avian b-defensin with their respective numbers; GAPDH, glyceraldehyde-3-phosphate dehydrogenase

Statistical analysis

The data were organized and analyzed using SPSS software package (SPSS 23.0 for Windows, SPSS Inc., Chicago, IL, USA). The Shapiro-Wilk test was employed to assess the normality and distribution of the data. Body weight of embryos and chicks, yolk utilization, and relative gene expression differences between breeds along their age were analyzed by two-way ANOVA. Furthermore, the mean differences between the breeds were computed using post-hoc procedure of Tukey test. Each targeted parameters was subjected to second-order polynomial regression (quadratic) analysis to show the growth and genes expression trend of the breed's over age. The correlations of BW, MDAs, and AvBDs mRNA genes expression in YST of two chicken breeds were performed with spearman correlation procedure. The analyses were considered significant at P < 0.05.

Results

Growth performance of embryos and hatched chicks

From ED7 to ED11, the YFBW of the embryos did not show significant changes in either breed line. However, the YFBW of the Hy-Line at ED11 was significantly higher compared to the YFBW of the Beijing You at ED7 (P < 0.05). From ED11 to 3 DAH, both breed lines quadratic increase in BW on consecutive sampling days of the embryonic chicks' age (every two days) (P < 0.05) Fig. 1 (A and B). At same age, the Hy-Line embryo demonstrated a higher BW compared with the Beijing You at ED17 (P < 0.05). However, there were no significant change observed in the next subsequent developmental age between the two breeds. At ED17, the Hy-Line breed showed significantly lower yolk weight and a reduced ratio of yolk weight to embryonic BW, as illustrated in Fig. 1 (C and E). The second-order polynomial regression curve indicates a sharp decline in yolk residue from ED17 to ED19 in both breeds.

Fig. 1.

Growth performance of embryos and hatched chicks; A) Body weight; B) yolk weight; C) Yolk weight ratio to embryo weight; prediction models of body weight, yolk weight, and yolk weight to body weight ratio of the two breed strains from age explanation are presented in fig B, D, and F, respectively, including coefficients of determination (R² = R square) for the fitted functions in age; different letters (a-i) in the bar graphs indicate significant difference in the two breeds along their age (P < 0.05); BW, body weight; g, gram; ED, embryonic day; DOH, day old hatch; DAH, days after hatch; d, days (age of embryonic chicks); Bars show mean ± SEM for each examined parameter (n = 8 embryos from ED7 to 19 and 8 chicks at DOH and 3 DAH for each breed in every sampling day).

Maternal antibody and AvBDs mRNA expression level

The relative mRNA expression levels of maternal-derived antibodies (IgA and IgY), the FcRY receptor, and AvBDs (AvBD5, AvBD8, AvBD10, and AvBD12) in the yolk sac tissue of Beijing You and Hy-Line chickens were analyzed, as shown in Table 2. The levels of IgY and FcRY mRNA expression were significantly higher in the Hy-Line breed (P < 0.05). However, the mRNA expression levels of all the examined AvBDs and IgA were not significantly different between the two breed lines. Furthermore, mRNA expression of all the examined MDAs and AvBDs was significantly different due to the interaction between age and breed (P < 0.05).

Table 2.

Maternal derived antibodies & β defensins mRNA expression in the yolk sac tissue of Beijing You and Hy-Line chickens.

	Genes
	IgA	IgY	FcRY	AvBD5	AvBD8	AvBD10	AvBD12
Breed1
Beijing You	5.95	1.74b	1.13b	6.79	0.78	6.58	6.71
Hy-Line	5.51	2.31a	1.36a	7.97	0.77	5.14	6.76
SEM	0.47	0.14	0.05	0.39	0.02	0.43	0.41
P-value	0.637	0.039	0.031	0.132	0.769	0.09	0.959
Age2
ED7	1.26e	0.85b	0.93b	1.23f	0.45c	0.86ef	2.13e
ED9	1.02e	3.17a	1.68a	3.26e	0.80b	11.13b	2.80e
ED11	0.97e	1.72b	1.01b	6.13d	0.75b	14.38a	3.18e
ED13	1.13e	1.38b	1.13b	8.67c	0.64bc	10.19b	2.87e
ED15	6.88c	1.43b	0.96b	7.58cd	0.71b	8.73c	13.36b
ED17	7.89c	0.94b	0.81b	6.17d	1.06a	4.40d	16.23a
ED19	3.83d	4.15a	1.95a	3.98e	0.79b	1.69e	8.67c
DOH	12.65b	3.81a	2.05a	13.25b	1.03a	0.76f	6.34d
DAH 3	15.96a	0.80b	0.70b	16.14a	0.78b	0.60f	5.04d
SEM	0.47	0.14	0.05	0.39	0.02	0.43	0.41
P-value	<0.0001	<0.0001	<0.0001	<0.0001	<0.0001	<0.0001	<0.0001
Breed × Age interaction
P-value	<0.0001	<0.0001	<0.0001	<0.0001	<0.0001	<0.0001	<0.0001

Abbreviations: IgA, immunoglobulin A; IgY, immunoglobulin Y; FcRY, IgY-Fc immunoglobulin receptor; AvBD, avian b-defensin with their respective numbers; ED, embryonic day for each respective number; DOH, day old hatch; DAH, days after hatch; SEM, standard error of mean; Different letters (a-f) indicate differences between breeds or ages(P < 0.05); chick ages included embryonic days (ED) 7-19; n = 8 sample per breed in every sampling day.

¹Main effects of breed: average value of all ages for each breed.

²Main effects of age: the relative gene expression average values of both breeds for each age group.

Maternal derived antibody influenced with breed and age interaction

From ED7 to ED13, the levels of IgA expression were not significantly changed in either of the breed lines. However, at ED11, the level of IgA expression in Beijing You was higher than that in Hy-Line (P < 0.05). Both breeds demonstrated similar trends in the expression of IgA Fig. 2B, showing an increase from ED13 to ED17, a decrease from ED17 to ED19, followed by an increase from ED19 to 3 DAH. However, IgA expression was significantly higher, peaking in the Hy-Line at 3 DAH and from DOH to 3 DAH in the Beijing You (P < 0.05). Moreover, the IgA expression was significantly higher in the Beijing You at ED15 (Fig. 2A) (P < 0.05). At ED15, IgA expression in Beijing You was significantly higher compared the expression at ED17 (P < 0.05).

Fig. 2.

Maternal derived antibodies expression level and pattern in the embryonic chicks; relative mRNA expression level of IgA; IgY; FcRY are illustrated in the bar graphs (fig A, C, and E), respectively; prediction models mRNA expression patterns of IgA, IgY, and FcRY of the two breed strains from age explanation are presented in fig B, D, and F, respectively, including coefficients of determination (R² = R square) for the fitted functions in age; different letters (a-h) in the bar graphs indicate significant difference in the two breeds along their age (P < 0.05); IgA, immunoglobulin A; IgY, immunoglobulin Y; FcRY, IgY-Fc immunoglobulin receptor; BW, body weight; g, gram; ED, embryonic day; DOH, day old hatch; DAH, days after hatch; d, days (age of embryonic chicks); Bars show mean ± SEM for each examined parameter (n = 8 embryos from ED7 to 19 and 8 chicks at DOH and 3 DAH for each breed in every sampling day).

The levels of both IgY and FcRY expression peaked at ED9 in the Hy-Line, whereas in the Beijing You breed, the peak occurred at DOH (P < 0.05). Furthermore, compared to Beijing You, the Hy-Line breed showed significantly higher IgY mRNA expression at ED11 and ED19, as well as FcRY expression at ED11 (P < 0.05) (Fig. 2C and E). Conversely, the Beijing You showed significantly higher IgY expression at ED15. Both IgY and FcRY expression showed development-specific quadratic trends, with variations observed between the two breeds (Fig. 2D and F). In Hy-Line, both showed a decline from ED9 to ED17, an increase from ED17 to ED19, followed by a decrease from ED19 to 3 DAH (P < 0.05). In Beijing You, there was increase patterns from ED9 to ED15 and from ED17 to DOH, followed by a decrease pattern from DOH to 3 DAH (P < 0.05).

AvBDs mRNA expression influenced with breed and age interaction

Beijing You and Hy-Line showed similar quadratic expression patterns of AvBD5 across their age Fig. 3 (B), with levels increasing from ED7 to 13, decreasing from ED13 to 19, increasing again from ED19 to 3 DAH, and reach a peaked at 3 DAH in both breeds. At a similar age, Hy-Line showed significantly higher AvBD5 expression from ED19 to 3 DAH, while Beijing You exhibited significantly higher expression at ED11 (P < 0.05), as shown in Fig. 3A.

Fig. 3.

The AvBDs expression level and patterns in the embryonic chicks; A) AvBD5; C) AvBD8; E) AvBD10; G) AvBD12; prediction models of AvBD5; AvBD8; AvBD10; AvBD12 expression patterns of the two breed strains from age explanation are presented in fig B, D, and F, and H, respectively, including coefficients of determination (R² = R square) for the fitted functions in age; different letters (a -i) in the bar graphs indicate significant difference in the two breeds along their age (P < 0.05); IgA, immunoglobulin A; IgY, immunoglobulin Y; FcRY, IgY-Fc immunoglobulin receptor; AvBD, avian beta-defensin with their respective number (5, 8, 10, and 12); BW, body weight; g, gram; ED, embryonic day; DOH, day old hatch; DAH, days after hatch; d, days (age of embryonic chicks); Bars show mean ± SEM for each examined parameter (n = 8 embryos from ED7 to 19 and 8 chicks at DOH and 3 DAH for each breed in every sampling day).

The AvBD8 gene was detected at ED7, although its expressions level was low, as presented in Table 2. The expression patterns of AvBD8 was not development specific (Fig. 3D). At a similar age, the expression of AvBD8 did not vary between the two breeds (Fig. 3C). Furthermore, the expression of AvBD8 in Hy-Line at 3 DAH was not significantly different compared to its expression at ED7.

The expression level of AvBD10 was significantly higher at the earlier stages of embryonic development (ED9 to 13), peaking at ED11 in Beijing You, and at both ED9 and ED11 in Hy-Line (Fig. 3E and F). Compared to Hy-Line, Beijing You showed significantly higher AvBD10 expression at ED11, 13, and 17. However, both breeds showed similar AvBD10 expression patterns throughout their developmental stage; an increasing trend from ED7 to 11, a decreasing trend from ED11 to DOH, and a constant level from DOH to 3 DAH.

Regardless of breed, AvBD12 expression was significantly higher and peaked at ED17. Both Beijing You and Hy-Line showed a similar AvBD12 expression development pattern, with a decline from ED17 to 3 DAH. However, a significantly lower expression was observed in Hy-Line at ED19 and 3 DAH. Moreover, AvBD12 expression was significantly influenced by the interaction between breed and age; it peaked at ED17 in Beijing You, and at ED15 and ED17 in Hy-Line (Fig. 3G and H).

Maternal derived antibodies and AvBDs expression correlation

A correlation matrix was used to examine the relationships between the expression of MDAs and AvBDs and the body weight of embryo and chicks over their ages, as illustrated in Fig. 4. The body weight of the embryo and chick showed a significant positive correlation with the expression levels of IgA, AvBD5, and AvBD8, while exhibiting a negative correlation with AvBD10 in both breed lines (P < 0.05). Both FcRY and IgY showed a negative correlation with body weight in Hy-Line chickens, but a positive correlation in Beijing You. However, the expression of FcRY and IgY showed a highly significant positive association in both breeds (P < 0.01), with correlation coefficients of R = 0.869 for Beijing You and R = 0.944 for Hy-Line. Irrespective of breed, IgA, AvBD5, AvBD8, and AvBD12 were a highly significantly associated with body weight (P < 0.01).

Fig. 4.

Maternal derived antibodies (MDAs), avian beta-defensins (AvBDs), and bodyweight correlation along the development age of chicks in Beijing You and Hy-Line breeds; Pearson's correlation coefficient (R); *, **, and *** indicate significant correlations at P < 0.05, P < 0.01, and P < 0.001, respectively. BYou, Beijing You; HY, Hy-Line; IgA, immunoglobulin A; IgY, immunoglobulin Y; FcRY, IgY-Fc immunoglobulin receptor; AvBD5, avian beta-defensin 5; AvBD8, avian beta-defensin 8, and AvBD10, avian beta-defensin 10; AvBD12, avian beta-defensin 12.

The expression levels of IgY, FcRY, AvBD8, and AvBD12 had a significantly positive association with age in both breed lines (P < 0.05). Irrespective of breed, the expression of AvBD10 had negative correlation with the age of the embryo or chick. Regardless of breed, IgA, IgY, FcRY, AvBD8, and AvBD12 were a highly significantly association with age in the embryo or chick (P < 0.01).

Discussion

The developmental success of embryo and post-hatch performance of avian are influenced by the endogenous nutrients present in the egg (Yadgary and Uni, 2012; der Wagt, et al., 2020; Jia et al., 2023). In fact, the amount and type of nutrients in the egg change dynamically during chicken embryogenesis to meet the nutritional demands at different stages of development and body growth of embryo. Yolk lipids contribute approximately 90 % of the total energy produced by the embryo and hatchling for maintenance and embryonic body growth and development (Speake et al., 1998; Sato et al., 2006; der Wagt et al., 2020). Variation in egg yolk composition, influenced by factors such as breed, strain, age, and egg size of hens or breeders, can possibly influence yolk utilization, and consequently, embryonic development (Wolanski et al., 2006; Nangsuay et al., 2015; der Wagt et al., 2020; Jia et al., 2023). Likely, the current finding indicated that yolk utilization at ED17 was higher in the Hy-Line breed compared with in the Beijing You, while eggs weight of the two breeds was not significant different at the start of incubation. This suggests that the increased growth rate of the Hy-Line embryo at ED17 might be due to their increase embryonic metabolism, which is enhanced by their genetic selection (der Wagt, et al., 2020). However, a higher metabolic rate during incubation would imply a lower residual yolk weight and possibly a lower energy reserve for the hatchling, which ultimately might affect the subsequent stage of development and growth performance (Mudalal et al., 2014; der Wagt, et al., 2020). This could be one of the possible reasons why, after observing the faster growing of Hy-Line embryo with a more rapid decline of yolk residues at ED17, the growth rate of Hy-Line embryos and hatchlings was not significantly different from that of Beijing You in the subsequent stages of development in this study. Thus, providing exogenous nutrients to meet the increased nutritional needs of Hy-Line embryos through in-ovo feeding may be beneficial for supporting their faster embryonic development and growth performance (Maiorano et al., 2011; Dankowiakowska et al., 2019; Fatemi et al., 2021; Ayalew et al., 2023).

Maternal derived antibodies protection in Gallus is absolutely dependent on the types of antibodies and their differential prevalent placement in the egg (Friedman et al., 2012; Agrawal et al., 2016; Wong and Uni, 2021). The differential prevalent placement of antibody types, including IgY in the yolk and IgA and IgM in the albumen (Rose and Orlans, 1981; Rose et al., 1974; Hamal et al., 2006; Wong and Uni, 2021), has resulted in variation to transportation mechanisms and expression levels in the embryo (Friedman et al., 2012). This variation may leads to differences in the protective efficiency of antibodies at different development stages of offspring. IgA is freely transported in the sero-amniotic fluid and yolk of embryonic eggs from ED12 onward (Kaspers et al., 1996), following the rupture of the sero-amniotic raphe by ED11, makes free exchange of antibody isotypes occurs between the albumen and yolk (Rose and Orlans, 1981). This may be one possible reason for the significantly lower expression of IgA in the yolk sac until ED13, followed by an increase from ED19 to 3 DAH in both breeds in the current study. Other insights indicate that IgA is not transferred into fetal circulation; instead, it is transferred to the embryonic gut as part of the egg white through the yolk sac (Rose and Orlans, 1981; Kaspers et al., 1996). Therefore, a rapid expression and protective role of maternal IgA is expected around the hatchling period due to a rapid colonization of the gut by commensal bacteria, as well as the potential entry of pathogenic bacteria into the gut of hatchling (Friedman et al., 2012). However, the IgA expression at ED15 was comparable with expression at DOH in the Beijing You, indicates a better protective role of IgA at earlier embryonic life in the Beijing You breed line.

IgY is the predominant maternally derived immunoglobulin, exhibited a structural similar to that of immunoglobulin G (IgG) found in mammals (Hincke et al., 2019; Orakpoghenor et al., 2023). In avian species, IgY is transported from the egg yolk to the embryo via the YST through a receptor-mediated transcytotic process (Wong and Uni, 2021; Jia et al., 2023). In addition to its role in transporting IgY-Fc receptors (FcRY), this receptor also involved in protecting antibodies from degradation, particularly IgY (He and Bjorkman, 2011; Okamoto, et al., 2024). This may explain the significant positive correlation observed between IgY and FcRY in the YST of both chicken breeds investigated in this study. Moreover, in the Hy-Line breed, both IgY and FcRY expression levels were significantly higher compared with Beijing You. This suggests that the increased FcRY expression contributes to enhance the transportation of IgY from the egg yolk and the more protection role in IgY degradation. While the faster decline of IgY in Hy-Line observed during at day old hatch (DOH) is supported by Grindstaff et al. (2003), it has been reported that faster-developing species catabolize maternal antibodies more quickly than slowly-developing species. The IgY expression patterns in Beijing You in this study is align with the findings of Kramer and Cho (1970), Kowalczyk et al. (1985), West et al. (2004), and Tesar et al. (2008). These studies reported that IgY expression begins around at ED7 in the chicken embryos, and with a dramatic increase observed from ED19 to DOH. However, the Hy-Line embryos showed peak IgY expression at an earlier stage of embryonic development (ED9) in this study. The differences in developmental timing for reaching peak IgY expression between the two studied breed lines, as well as in comparison to previous reports, may be attributed to variations in maternal serum IgY concentration (Loeken and Roth, 1983; Al-Natour et al., 2004) and prior natural infections or active immunizations of the hens (Kowalczyk, et al., 1985; Agrawal et al., 2016). This suggests that further research is needed to investigate the complete historical profile of MDAs and AvBDs in relation to the development of offspring from their mothers.

The avian β-defensins (AvBDs) is one of the key components of innate immunity that provide protection against pathogenic in avian species (Meade et al., 2009; Zhang and Wong, 2019); function as the first line of defense with potent antimicrobial and immunomodulatory activities (Yoshimura et al., 2024). For instance, ABD1 and ABD2 are effective in eliminating S. enteriditis, C. albicans, and C. jejuni (Evans et al., 1995). However, the crucial functional roles of AvBDs during earlier age of embryonic chicks depend on their expression profile (Levy, 2007; Jiao et al., 2009; Thaiss et al., 2016; Zhang and Wong, 2019), which influenced with breeds, tissue, and development specific (Zhang and Wong, 2019; Li et al., 2020). Thus, this study compared the expression profile of AvBD5, AvBD8, AvBD10, and AvBD12 in Beijing You and Hy-Line chicken breeds in the age range of ED7 to 3 DAH. All these examined AvBDs were detected at ED7 with no significant variation in expression observed between the two embryonic breed lines. A previous study conducted by Meade et al., (2009) also demonstrated that most AvBDs (AvBD5, AvBD9, and AvBD10) were identified at ED3 in the whole Cobb embryo, with the exception of AvBD11, which appeared after ED9. Similarly, the temporal mRNA expression of AvBD10 and CATHs were detected at ED7 in the YST of broiler and layer chicken embryos, showing an increase from ED7 to ED9/ED11 (Jia, et al., 2023). Inclusively, most AvBDs detected in embryonic chicks at ED9-12, AvBD9 at ED17-21, and AvBD1, 2, 4, and 6 at 2–3 weeks of post hatch; however, their expression patterns were not similar (Alkie et al., 2019). Regardless of chicken breeds, the detection of various AvBD profiles before mid-embryogenesis may indicate a combined antimicrobial action and immune function in the YST at earlier embryonic stages, as well as their greatest sequence identity (Zhang and Sunkara, 2014).

This study demonstrated that the mRNA expression of AvBD5, AvBD10, and AvBD12 showed development stage-specific trends in both chicken breeds. This finding aligns with the report by Zhang and Wong (2019), which indicated that the mRNA levels of AvBD1, AvBD2, AvBD7, and AvBD10 were low at ED7, increased from ED9 to ED13, and then declined to ED19 in the chicken yolk sac. The current study found that AvBD5 expression peaked at 3 DAH in both breed lines when a lower yolk residue was observed, possibly due to their similar developmental transcription levels and post-translational processing regulatory activities of this specific AvBD (van Dijk et al., 2018). During mid-embryogenesis (ED9 to ED13), the peak expression profile of AvBD10 was observed in the YST of both Beijing You and Hy-Line breeds in the current study, as well as in broiler and layer chickens reported by Jia et al. (2023). It implies its age specific mRNA expressional development, rather than the breeds and trait selection preference influences, and shows its protective role in all avian embryos against pathogens during this early embryonic stage, as the embryos' immune organs are in the process of development and maturation (Alkie et al., 2019). Though the Beijing You and the Hy-Line breeds did not showed similar developmental AvBD12 expression patterns; the peak expression of AvBD12 were observed after mid-embryogenesis (ED15-17) in both breeds. These result suggest that the occurrence of AvBD12 and AvBD10 immunological protection role difference along the embryonic age of chicks. In this current study, the expression of AvBD12 exhibited a declining trend started during the late incubation and continued at the post hatch of chicks, which would be associated with the internalization and degradation of the YST (Jia, et al., 2023). However, the significantly faster declined trends of AvBD12 in Hy-Line during the period of post-hatch might be the expense of AvBD to meet the energy requirements necessary for the rapid growth of chicken embryo (van Dijk et al., 2018; der Wagt et al., 2020). Similarly, a lower expression profile mRNA host defense peptides (AvBD10, CATH1 and CATH2) was observed in the YST of broilers compared to that of the layers (Jia et al., 2023). Thus, all these results suggest that the occurrence of immunological window in the embryonic chick starting the late embryonic stage, which might be higher in chicks with having faster growth rate due to diminishing of specific AvBDs for demanding high energy requirements (Sunkara et al., 2011).

Conclusion

This study revealed that there was no variation in AvDBs expressions levels between the genetic groups; however, IgY and FcRY were highly expressed in the Hy-Line breed. In both breed lines, most examined MDAs and AvBDs showed temporal expression development patterns, showed a decline trend during the late embryonic period, while the trend of IgY and AvBD8 expression showed a lower regression with age (R² less than 0.5). AvBD12 demonstrated a more rapid decline in the Hy-Line chicks during the post-hatch period, which may be associated with the necessity of this immune component for the nutritional partitioning required for the faster growth of embryo. Thus, the data from this study may provide novel insights into embryonic nutrition strategies that are tailored to the developmental changes in MDAs and AvBDs in developing chicks.

Data availability

All datasets generated for this study are available within the article

Authors contributions

HA and CX carried out the animal experiment and sample collection; HA did data analysis and wrote the draft manuscript; HZ and HA conceived, designed, and reviewed the manuscript; QL, TW, JW, SW, KQ, and GQ revised and edited the manuscript. All authors contributed to the manuscript revision, read, and approved the submitted version.

Disclosures

The authors declare that there is no any a conflict interest in terms of financial or personal relationships that could have appeared to influence the publication of this work.