Skip to main content
Eukaryotic Cell logoLink to Eukaryotic Cell
. 2002 Jun;1(3):448–457. doi: 10.1128/EC.1.3.448-457.2002

Divergent Subunit Interactions among Fungal mRNA 5′-Capping Machineries

Toshimitsu Takagi 1,†, Eun-Jung Cho 1,2, Rozmin T K Janoo 3, Vladimir Polodny 1, Yasutaka Takase 1,‡, Michael-C Keogh 1, Sue-Ann Woo 1,§, Lucille D Fresco-Cohen 1, Charles S Hoffman 3, Stephen Buratowski 1,*
PMCID: PMC118010  PMID: 12455993

Abstract

The Saccharomyces cerevisiae mRNA capping enzyme consists of two subunits: an RNA 5′-triphosphatase (RTPase) and GTP::mRNA guanylyltransferase (GTase). The GTase subunit (Ceg1) binds to the phosphorylated carboxyl-terminal domain of the largest subunit (CTD-P) of RNA polymerase II (pol II), coupling capping with transcription. Ceg1 bound to the CTD-P is inactive unless allosterically activated by interaction with the RTPase subunit (Cet1). For purposes of comparison, we characterize here the related GTases and RTPases from the yeasts Schizosaccharomyces pombe and Candida albicans. Surprisingly, the S. pombe capping enzyme subunits do not interact with each other. Both can independently interact with CTD-P of pol II, and the GTase is not repressed by CTD-P binding. The S. pombe RTPase gene (pct1+) is essential for viability. Pct1 can replace the S. cerevisiae RTPase when GTase activity is supplied by the S. pombe or mouse enzymes but not by the S. cerevisiae GTase. The C. albicans capping enzyme subunits do interact with each other. However, this interaction is not essential in vivo. Our results reveal an unexpected diversity among the fungal capping machineries.


The “cap” structure is a specific modification of the 5′ end of mRNA found in eukaryotic cells and most of their viruses. It consists of a 7-methylguanosine moiety attached to the 5′ terminus via a 5′-5′ linkage. Cellular mRNA capping enzyme is bifunctional, consisting of RNA 5′-triphosphatase (RTPase) and GTP::mRNA guanylyltransferase (GTase) activities. In the first step of capping, RTPase removes the γ-phosphate from the 5′ end of the RNA substrate to leave a diphosphate end. GTase subsequently transfers GMP from GTP to form the structure GpppN1-. The third activity, RNA (guanine-7-)-methyltransferase, adds a methyl group to the N-7 position of the guanine cap to form the “cap 0” structure, m7GpppN1-. (13, 42).

Capping enzyme from Saccharomyces cerevisiae is a complex of RTPase and GTase subunits (27). These polypeptides are encoded by the CET1 and CEG1 genes, respectively, and both are essential for cell viability (41, 49). Mammalian capping enzyme is a single bifunctional polypeptide composed of an amino-terminal RTPase domain and a carboxyl-terminal GTase domain. The mammalian gene complements null and conditional mutants of CEG1 and/or CET1 (25, 26, 29, 51, 54). Ceg1 has a high degree of amino acid similarity to the GTase proteins/domains from viruses and metazoans, and all are thought to use a common reaction mechanism (16, 50). In contrast, Cet1 does not resemble viral or metazoan phosphatases. The metazoan RTPase domain is a member of the protein tyrosine phosphatase (PTP) superfamily (31, 46, 50, 51, 54).

Cellular capping enzymes are recruited to the phosphorylated carboxyl-terminal domain of the largest subunit of RNA polymerase (pol) II (CTD-P) (5, 31, 54; for review, see references 18, 40, and 42). S. cerevisiae Ceg1 binds directly to CTD-P (6, 31) but is inactive for covalent enzyme-GMP complex formation unless also bound to Cet1 (6). The carboxyl-terminal region (amino acids [aa] 265 to 549) of Cet1 is sufficient for catalytic activity, while its middle part (aa 235 to 265) binds and increases the activity of Ceg1 bound to CTD-P (6, 48). The mammalian GTase domain interacts with CTD-P, whereas the RTPase domain does not (26, 54). In contrast to the S. cerevisiae GTase inhibition (6), the mouse GTase activity is stimulated by binding to CTD-P (19).

In the present study, we characterize and compare the GTases and RTPases from the fungi Schizosaccharomyces pombe and Candida albicans using both biochemical and genetic approaches. An S. pombe homolog of CEG1 (pce1+) and C. albicans homologs of CEG1 (CGT1) and CET1 (CaCET1) have been isolated and function in S. cerevisiae (43, 52, 53). More recently, an S. pombe RTPase gene (pct1+) was isolated and characterized (35). pct1 resembles the catalytic region of Cet1 and CaCet1 but lacks the conserved region for binding the GTase (6, 39, 48). Deletion of the pct1+ gene in S. pombe is lethal. pct1 supports the cell viability of an S. cerevisiae Δceg1 Δcet1 strain when coexpressed with either pce1 or Cgt1 but not with Ceg1. Therefore, some species-specific interactions between capping enzyme subunits must exist. Unlike the S. cerevisiae and C. albicans GTases and RTPases, no tight association between pct1 and pce1 was observed. pct1 binds to CTD-P independently of pce1, and pce1 does not require allosteric activation by RTPase. C. albicans GTase and RTPase do interact, but unlike S. cerevisiae capping enzyme, the subunit interaction is not absolutely required for their functions in vivo. This study reveals an unexpected diversity among the fungal mRNA capping systems.

MATERIALS AND METHODS

DNA cloning.

All cloning was carried out using standard techniques (2). PCR was carried out with Vent DNA polymerase (New England BioLabs). Oligonucleotides used in this study are listed in the Appendix (see Table A1). Also listed in the Appendix are plasmids used for subcloning and recombinant protein expression (see Table A2) and for expression of proteins in yeast (see Table A3).

TABLE A1.

Oligonucleotides used in this study

Name Oligonucleotide sequence
CET1 (5′SalNco) 5′-♣♣♣GTCGAC♣♣♣TGCCATGGGTTACACTGACAACCCTCCTCAAACA-3′ (SalI site in small capitals, NcoI site underlined)
CET1 (3′ Sacl) 5′-GAGCTCAAGGGCATTTGCTTAT-3′ (SacI site shadowed)
SpCET 1start 5′-GCGTCGACAGGATCCATGGACCTTAAAGGTTTATTA-3′ (SalI site in small capitals, BamHI site boldfaced, NcoI site underlined)
SpCET 1stop 5′-GCGGATCCGAGCTCTTAAGAATGCTCTCGTCTCAA-3′ (SacI site in small capitals, BamHI site boldfaced)
SpCET 1 (40Met) 5′-GCGTCGACAGGATCCATGGCAAAGATAGAAATGAACTT-3′ (SalI site in small capitals, BamHI site boldfaced, NcoI site underlined)
CGT1-5′brf 5′-GCGGATCCATGGTTCAATTAGAAGAAAGAGAAATT-3′ (BamHI site boldfaced, NcoI site underlined)
CGT1-3′brf 5′-GCGGATCCTTATTCGTCGTCACTATCTTCATAAGT-3′ (BamHI site boldfaced)
CaCET1-5′brf 5′-GCGGATCCATGGATGTTGGATCTATTTTAAATGAC-3′ (BamHI site boldfaced, NcoI site underlined)
CaCET1-3′brf 5′-GCGGATCCTAGCAAATCTTGTTCAATCTATTATT-3′ (BamHI site boldfaced)
CaCET1-5′SalI 5′-ACGCGTCGACCATGGATGTTGGATCTATTTTAAATGA-3′ (SalI site in small capitals, NcoI site underlined)
CaCET1 (203) 5′-ACGCGTCGACCATGGAAACACCTCCAATTTGGGCCCAGA-3′ (SalI site in small capitals, NcoI site underlined)
CaCET1 (229) 5′-ACGCGTCGACCATGGAAGCCATAACTAGACTTTCTGAA-3′ (SalI site in small capitals, NcoI site underlined)
CaCET1 (251) 5′-ACGCGTCGACCATGGAGTGTAGTATTACTGGTATGATA-3′ (SalI site in small capitals, NcoI site underlined)
CaCET1 (269) 5′-ACGCGTCGACCATGGAATGGGTGTATGCCAATTTTTCCA-3′ (SalI site in small capitals, NcoI site underlined)
CaCET1-3 SacI 5′GCGGATCCGAGCTCTAGCAAATCTTGTTCAATCTATT-3′ (BamHI site boldfaced, SacI site in small capitals)
McE-GTNdeI 5′-GGATCCATATGGAACCAGGGTCAAGTGCAT-3′ (BamHI site boldfaced, NdeI site underlined)
McE-B 5′-GGATCCTAGGTTGGCCGATGCAGTCTTTTGG-3′ (BamHI site boldfaced)
KO1 5′ GTACGAATTCATCACGAATGGACCTTAAAGGTTTATTACATGAAGAAAACGAACTGCCTTCTATTGCGGATCCCCGGGTTAATTAA 3′
KO2 5′ ACATTCTGATGCAAAGCAAGGAACAATTATTAAGAAATGACTTAAGAATGTCAAATAAGTAGCGAATTCGAGCTCGTTTAAAC 3′

TABLE A2.

Plasmids for E. coli used in this study

Plasmid Construction Source of reference
pBS-CET1orf (version 2) 1.7-kb fragment was amplified from pBS-CET1 orf (6) using CET1 (5′ SalNco) and CET1 (3′ Sac). This product was ligated into the SrfI site of pCR-Script SK(+) (Stratagene) This study
pCR-CaCET1orf See Materials and Methods This study
pGEM-CaCET1 1.56-kb BamHI fragment from pCR-CaCET1orf was subcloned into the BamHI site of pGEM-3zf(+) (Promega) This study
pBS-CaCET1 1.56-kb fragment was amplified from pGEM-CaCET1 using oligonucleotides CaCET1-5′ SalI and CaCET1-3′ SacI. This product was ligated into the SrfI site of pCR-Script SK(+) This study
pBS-CaCET1 (203-520) 0.96-kb fragment was amplified from pGEM-CaCET1 using oligonucleotides CaCET1 (203) and CaCET1-3′ SacI. This product was ligated into the SrfI site of pCR-Script SK(+) This study
pBS-CaCET1 (229-520) 0.88-kb fragment was amplified from pGEM-CaCET1 using oligonucleotides CaCET1 (229) and CaCET1-3′ SacI. This product was ligated into the SrfI site of pCR-Script SK(+) This study
pBS-CaCET1 (251-520) 0.81-kb fragment was amplified from pGEM-CaCET1 using oligonucleotides CaCET1 (251) and CaCET1-3′ SacI. This product was ligated into the SrfI site of pCR-Script SK(+) This study
pBS-CaCET1 (269-520) 0.76-kb fragment was amplified from pGEM-CaCET1 using oligonucleotides CaCET1 (269) and CaCET1-3′ SacI. This product was ligated into the SrfI site of pCR-Script SK(+) This study
pCR-pct1+ See Materials and Methods This study
pCR-pct1+ (43-303) See Materials and Methods This study
pSBEThis7-pct1+ 0.9-kb NcoI-BamHI fragment of pCR-prt1+ was subcloned into NcoI-BamHI sites of pSBEThis7 (37) This study
pSBEThis7-pct1+ (43-303) 0.8-kb NcoI-BamHI fragment of pCR-prt1+ was subcloned into NcoI-BamHI sites of pSBEThis7 This study
pCR-CGT1orf See Materials and Methods This study
pSBEThis7CGT1 1.4-kb NcoI-BamHI fragment from pCR-CGT1orf was subcloned into the NcoI-BamHI sites of pSBEThis7 This study
pSBEThis7pce1+ 1.4-kb NcoI-NheI (blunted) fragment from pET-PCE1 (43) was subcloned into the NcoI-EcoRV sites of pSBEThis7 This study
pBS-MCE (211-597) 1.2-kb fragment was amplified from pG-MCE (54) using MCE-GTNdeI and MCE-B. This fragment was ligated into the SrfI site of pCR-Script SK(+) This study

TABLE A3.

Plasmids for S. cerevisiae and S. pombe used in this study

Plasmid Relevant features Construction Source or reference
pAD5-CET1 2μm, LEU2, ADH1 promoter-driven HA-taggedCET1 1.7-kb SalI-SacI fragment from pBS-CET1orf version 2 was subcloned into the SalI and SacI sites of pAD5-pct1+ This study
pRS313-cet1-401 CEN/ARS, HIS3, cet1-401 (D422A) See reference 48
pRS313-cet1-438 CEN/ARS, HIS3, cet1-438 (C330W) See reference 48
pRS313-cet1-446 CEN/ARS, HIS3, cet1-446 (P245A, W247A) See reference 48
pRS423-CET1 (Pro + 265-549) 2μm, HIS3, CET1 (265-549) See reference 48
pAD5-CaCET1 2μm, LEU2, HA-tagged CaCET1, ADH1 promoter-driven 1.6-kb SalI-SacI fragment from pBS-CaCET1 was subcloned into the SalI and SacI sites of pAD5-CET1 This study
pAD5-CaCET1 (203-520) 2μm, LEU2, HA-tagged CaCET1 (203-520), ADH1 promoter-driven 1.0-kb NcoI-SacI fragment from pBS-CaCET1 (203-520) was subcloned into the NcoI and SacI sites of pAD5-CET1 (1-265)-CTL1 (T. Takagi, unpublished data) This study
pAD5-CaCET1 (229-520) 2μm, LEU2, HA-tagged CaCET1 (229-520), ADH1 promoter-driven 0.9-kb NcoI-SacI fragment from pBS-CaCET1 (229-520) was subcloned into the NcoI and SacI sites of pAD5-CET1 (1-265)-CTL1 This study
pAD5-CaCET1 (251-520) 2μm, LEU2, HA-tagged CaCET1 (251-520), ADH1 promoter-driven 0.8-kb NcoI-SacI fragment from pBS-CaCET1 (251-520) was subcloned into the NcoI and SacI sites of pAD5-CET1 (1-265)-CTL1 This study
pAD5-CaCET1 (269-520) 2μm, LEU2, HA-tagged CaCET1 (269-520), ADH1 promoter-driven 0.8-kb NcoI-SacI fragment from pBS-CaCET1 (251-520) was subcloned into the NcoI and SacI sites of pAD5-CET1 (1-265)-CTL1 This study
pAD5-pct1+ 2μm, LEU2, HA-tagged pct1+, ADH1 promoter-driven 0.9-kb SalI-SacI fragment from pCR-pct1+ was subcloned into the SalI and SacI sites of pAD5 (48) This study
pAD5H-pct1+ 2μm, leu2::HIS3/KanR, HA-tagged pct1+, ADH1 promoter-driven LEU2 marker of pAD5-pct1+ was swapped with HpaI-XhoI fragment from pLH7 (6) carrying leu2::HIS3/KanR This study
pRS423-pct1+ 2μm, HIS3, pct1+, CET1 promoter-driven 0.9-kb NcoI-SacI fragment from pRS423-CET1 (Pro + 265-549) was replaced with 0.9-kb NcoI-SacI fragment from pSBEThisl-Pct1 (43-303) This study
pRS423-pct1+ (43-303) 2μm, HIS3, pct1+ (43-303), CET1 promoter-driven 0.9-kb NcoI-SacI fragment from pRS423-CET1 (Pro + 265-549) was replaced with 0.8-kb NcoI-SacI fragment from pSBEThis7-Pct1 (43-303) This study
pSLF273-pct1+ ars1+, ura4+, (HA)3-tagged pct1+, weak nmt1 promoter-driven 0.9-kb BamHI fragment from pCR-pct1+ was subcloned into the BamHI site of pSLF273 (10) This study
pSGP73-pct1+ ars1+, LEU2, (HA)3-tagged pct1+, nmt1 promoter-driven 0.9-kb BamHI fragment from pCR-pct1+ was subcloned into the BamHI site of pSGP73 (kindly supplied by S. Forsburg). This study
pRS425-CEG1 2μm, LEU2, CEG1 See reference 48
pRSH-CEG1 2μm, ura3::HIS3/KanR, CEG1 URA3 marker of pRS426-CEG1 (48) was swapped with SmaI fragment from pUH7 (6) carrying ura3::HIS3/KanR This study
pRS-CGT1 2μm, URA3, CGT1 See Materials and Methods This study
pRSH-CGT1 2μm, ura3::HIS3/KanR, CEG1 URA3 marker of pRS-CGT1 was swapped with SmaI fragment from pUH7 (6) carrying ura3::HIS3/KanR This study
pRSL-CGT1 2μm, ura3::LEU2/KanR, CGT1 URA3 marker of pRS-CGT1 was swapped with SmaI fragment from pUH9 (6) carrying ura3::LEU2/KanR This study
pDB20-pce1+ 2μm, URA3, pce1+, ADH1 promoter-driven See Materials and Methods This study
pDB20L-pce1+ 2μm, LEU2, pce1+, ADH1 promoter-driven 3.6-kb BamHI fragment of pDB20LADA1 (26) was replaced with 3.7-kb BamHI fragment of pDB20-pce1+ This study
pDB20H-pce1+ 2μm, ura3::HIS3/KanR, pce1+, ADH1 promoter-driven URA3 marker of pDB20-pce1+ was swapped with SmaI fragment from pUH7 carrying ura3::HIS3/KanR This study
pDB20-MCE (211-597) 2μm, URA3, MCE (211-597), ADH1 promoter-driven 1.2-kb EcoRV-NotI (blunted) fragment from pBS-MCE (211-597) was subcloned into the NolI (blunted) site of pDB20 (4) This study
pDB20H-MCE (211-597) 2μm, HIS3, MCE (211-597), ADH1 promoter-driven URA3 fragment of pDB20-MCE (211-597) was swapped with SmaI fragment from pUH7 carrying ura3::HIS3/KanR This study
pAD5-MCE (211-597) 2μm, LEU2, HA-tagged MCE (211-597), ADH1 promoter-driven See reference 48

Genetic manipulations of S. cerevisiae and S. pombe.

S. cerevisiae and S. pombe strains used in this study were YSB244 (MATa ura3-52 leu2-3,112 his3Δ200 ceg1Δ1::HIS3 [pRS316-CEG1] [11]), YSB230 (MATa ura3-52 leu2-3,112 his3Δ200 ceg1Δ1::HIS3 [pRS315-ceg1-63] [12]), YSB533 (MATa ura3-52 leu2Δ1 trp1Δ63 his3Δ200 lys2Δ202 cet1Δ1::TRP1 [pRS316-CET1] [48]), YSB719 (MATα ura3-52 leu2Δ1 trp1Δ63 his3Δ200 lys2Δ202 cet1Δ1::TRP1 ceg1Δ3::LYS2 [pRS316-CEG1-CET1] [48]), FWP101 (h+ ura4::fbp1-lacZ leu1-32 ade6-M210 his7-366), FWP112 (h− ura4::fbp1-lacZ leu1-32 ade6-M216 his7-366), and TE696 (h+ ura4-294 leu1-32 [T. Enoch, Harvard Medical School]).

Plasmids were introduced into yeast using a modified lithium acetate transformation protocol (14). Medium preparation, the plasmid-shuffling technique with 5-fluoroorotic acid (5-FOA), and other yeast manipulations were performed by standard methods (2, 15).

The experiment shown in Fig. 1A was carried out as follows. The CET1/CEG1 double shuffling strain YSB719 (48) was transformed with pRS423-pct1+ (2μm, HIS3, expressing pct1 protein from the CET1 promoter). His+ isolates were subsequently transformed with the following LEU2/2μm plasmids: vector (pRS425 [44]); CEG1 (pRS425-CEG1 [48]); MCE (211-597) (pAD5-MCE [211-597] [48]); pce1+ (pDB20L-pce1+, which expresses pce1 under the control of the ADH1 promoter); and CGT1 (pRSL-CGT1, which expresses Cgt1 from its own promoter). Leu+ His+ transformants were tested for growth in the presence of 5-FOA to shuffle out the CEG1 and CET1 genes carried on pRS316-CEG1-CET1 (48).

FIG. 1.

FIG. 1.

pct1 is an mRNA-capping RTPase but does not associate with pce1. (A) Complementation by plasmid shuffling. pct1 plus the indicated GTases were tested for the ability to replace Ceg1 and Cet1 as described in Materials and Methods. (B) Immunoprecipitation and GTase-GMP formation assay. Whole-cell extracts were prepared from strains derived from S. cerevisiae YSB719 (lanes 1 and 2) or S. pombe TE696 strain (lanes 3 to 6) expressing the indicated proteins. RTPases were immunoprecipitated (immunoblot shown in top panel) and pellets were tested for the presence of GTase (bottom panel), as described in Materials and Methods. The asterisk denotes radioactive phosphate.

The experiment shown in Fig. 3D was performed as follows. YSB719 (Δceg1 Δcet1) was transformed with LEU2 plasmids expressing various GTases: Ceg1 (pRS425-CEG1); MCE (211-597) (pAD5-MCE[211-597]); pce1 (PDB20L-pce1+); and Cgt1 (pRSL-CGT1). Leu+ isolates were subsequently transformed with HIS3 plasmids that carry different alleles of CET1 (48): cet1 (265-549) (pRS423-CET1[Pro + 265-549]); cet1-446 (pRS313-cet1-446 [P245A, W247A]); cet1-401 (pRS313-cet1-401 [D422A]); or cet1-438 (pRS313-cet1-438 [C330W]). Leu+ His+ transformants were grown in the presence of 5-FOA to shuffle out pRS316-CEG1-CET1.

FIG. 3.

FIG. 3.

The interaction between Cgt1 and CaCet1 is not absolutely required for their function in vivo. (A) Sequence alignment between CaCet1 (GenBank accession number O93813, residues 193 to 292) and Cet1 (O13297, residues 232 to 310). Protein sequence similarity searching was carried out on the National Center for Biotechnology Information Web server using the BLAST algorithm (1), and sequence alignments were made using SEQVU. Letters represent the single-letter amino acid code, and numbers represent the positions of the amino acid residues. Boxed residues denote identities, and shaded residues indicate similar amino acids. Asterisks indicate the residues that are important for the Cet1-Ceg1 interaction (48). The residues used for the deletion of Cet1 and CaCet1 are shown. (B) Deletion analysis of CaCet1. The indicated deletions of CaCet1 were tested for the ability to replace Cet1 (see Materials and Methods) in the presence of Ceg1 or Cgt1. Plates are shown after 3 days at 30°C. (C) Immunoprecipitation and GTase-GMP formation assay for CaCet1 derivatives and Cgt1, respectively (see Materials and Methods). Upper panel, immunoblotting with 12CA5; and lower panel, autoradiography. (D) Coexpression of Cet1 mutants and various GTases in S. cerevisiae. Plasmid shuffling with the indicated genes was carried out as described in Materials and Methods. After 2 days, 5-FOA-resistant cells were spotted on new plates and were further incubated either at 30 or 37°C. + indicates that the cells form colonies after 3 days. − indicates that colonies were not observed after 7 days. Note that the mouse capping enzyme results are from Takase et al. (48).

Isolation of guanylytransferase genes from S. pombe and C. albicans.

YSB230, which carries the ceg1-63 conditional allele (12), was transformed with an S. pombe cDNA library cloned into plasmid pDB20 for S. cerevisiae expression (4, 9). Approximately 200,000 Ura+ transformants were screened for restoration of growth at the restrictive temperature. Five transformants were selected after 2 or 3 days at 37°C. As all five positive clones displayed identical restriction patterns, one representative clone was sequenced and designated pDB20-pce1+.

The C. albicans CEG1 homolog was isolated similarly, screening 63,000 Ura+ transformants of YSB230 (ceg1-63) for rescue at the restrictive temperature. A C. albicans genomic DNA library was used (30). Six Ura+ transformants were selected and rescreened. All six proved to be independent but overlapping genomic isolates by restriction analysis. One clone was processed for subcloning and sequencing and was designated pRS-CGT1. We note that other groups have also used a similar approach to clone pce1+ (43) and CGT1 (53).

The open reading frame (ORF) of CGT1 was amplified from a C. albicans genomic DNA library (30) with oligonucleotide primers CGT1-5′orf and CGT1-3′orf. A 1.4-kb amplified fragment was subcloned into pCR-Blunt II-TOPO (Invitrogen) (pCR-CGT1orf).

Isolation of the S. pombe RNA triphosphatase gene.

A 0.9-kb fragment carrying the ORF of the pct1+ gene (GenBank accession number AL355012) was amplified from an S. pombe cDNA library (9) using oligonucleotide primers SpCET1start and SpCET1stop. For the amplification of a 0.8-kb fragment carrying the ORF that lacks the residues 1 to 42, SpCET1 (40Met) replaced SpCET1start. The 0.9- and 0.8-kb PCR products were subcloned into pCR-Blunt II-TOPO to generate pCR-pct1 and pCR-pct1 (43-303), respectively.

Disruption of the pct1+ gene.

The S. pombe pct1 ORF was disrupted using a PCR-based approach as described by Bahler et al. (3). Oligonucleotides KO1 and KO2 (see Table A1 in Appendix) were used to PCR amplify a kanMX6-containing fragment from pFA6a-3HA-kanMX6. The amplified fragment was used to transform a diploid S. pombe strain (derived from mating FWP101 and FWP112) to G418 resistance, thus replacing one wild-type allele of prt1 with a kanMX6-marked disruption allele. Homologous recombination at the prt1 locus was confirmed by both PCR analysis and Southern blotting. Azygotic asci were dissected on yeast extract agar (YEA) medium to determine the phenotype of the disruption in haploid progeny.

Isolation of the RNA triphosphatase gene of C. albicans.

The CaCET1 ORF was amplified from a C. albicans genomic DNA library (30) with oligonucleotides CaCET1-5′orf and CaCET1-3′orf derived from the published sequence (52). A 1.56-kb amplified fragment was subcloned into pCR-Blunt II-TOPO (pCR-CaCET1orf).

Preparation of recombinant protein expressed in Escherichia coli.

Polyhistidine-tagged full-length pct1 (his7-pct1) and the residues 43 to 303 of pct1 (his7-pct1 [43-303]) were expressed in E. coli strain BL21(DE3) transformed with pSBEThis7-pct1 and pSBEThis7-pct1 (43-303), respectively. Proteins were purified from soluble extracts (100,000 × g, supernatant fraction) through Ni2+-nitrilotriacetic acid (NTA)-agarose (Qiagen) and CM-Sephadex C-50 (Pharmacia) resins as described previously for the purification of his7-Cet1 (265-549) (37).

Plasmids pSBEThis7-pce1, pSBEThis7-Cgt1, and pSBEThis7-CaCet1 were used to express polyhistidine-tagged pce1, Cgt1, and CaCet1, respectively, in BL21(DE3). his7-pce1, his7-Cgt1, and his7-CaCet1 were purified from soluble extracts by Ni2+-NTA-agarose (37). Polyhistidine-tagged GTase and RTPase subunits of S. cerevisiae (his7-Ceg1 and his7-Cet1) were expressed and purified as previously described (6, 11).

RTPase and NTPase assay.

RTPase assays were carried out with [γ-32P]ATP-terminated dimer RNA (pppApC; boldface denotes radioisotope) or [α-32P]ATP-terminated trimer RNA (pppApCpC) prepared with T7 bacteriophage DNA primase as described earlier (47). Nucleotide phosphohydrolase (NTPase) activity was assayed with [γ-32P]ATP (NEN/DuPont).

Yeast whole-cell extract preparation and protein analysis.

Preparation of whole-cell extracts from S. cerevisiae and S. pombe, immunoprecipitation, and subsequent enzyme-GMP formation assays were carried out as described earlier (48).

The experiment shown in Fig. 1B was performed as follows. For lane 1, pAD5-CET1 (2μm, LEU2, of ADH1 promoter driving HA-tagged Cet1) and pRSH-CGT1 (2μm, HIS3, CGT1) were shuffled into YSB719. For lane 2, pAD5H-pct1+ (2μm, HIS3, expressing HA-tagged Pct1 protein from the ADH1 promoter) and pDB20L-pce1+ were shuffled into YSB719. For experiments with S. pombe, strain TE696 was transformed with pSLF273 (ura4+ [10]) (lane 3), pSLF273-pct1+ (ura4+, nmt1 promoter expressing triple-HA-tagged pct1 protein) (lane 4); pSGP73 (LEU2) (lane 5); and pSGP73-pct1+ (LEU2, nmt1 promoter expressing triple-HA-tagged pct1 protein) (lane 6). Transformants were grown in Edinburgh minimal medium with leucine (lanes 3 and 4) or uracil (lanes 5 and 6) at 30°C, and whole-cell extracts were prepared. Immunoprecipitations were carried out with 20 μg of whole-cell extract protein and monoclonal antibody 12CA5 bound to protein A-Sepharose beads. Precipitates were incubated for 10 min at 30°C with 3 μM [α-32P]GTP and were then analyzed by SDS-PAGE. Proteins were transferred to nitrocellulose membranes and analyzed by immunoblotting with 12CA5 (upper panel) and PhosphorImager (lower panel).

The results shown in Fig. 3B and C were obtained as follows. YSB719 was transformed with HIS3/2μm plasmids expressing Ceg1 (pRSH-CEG1) or Cgt1 (pRSH-CGT1). His+ isolates were subsequently transformed with LEU2/2μm plasmids expressing wild-type or the indicated truncation mutants of CaCET1. CaCet1 and its derivatives were HA tagged and expressed from the ADH1 promoter. Leu+ His+ transformants were analyzed for the ability to replace Ceg1 and Cet1 by plasmid shuffling.

Whole-cell extracts were prepared from cells expressing Cgt1 and the derivatives of CaCet1 (see Fig. 3B, lane 2, full-length CaCet1; lane 3, 203-520; lane 4, 229-520; and lane 5, 251-520). Lane 1 (vector) represents cells before plasmid shuffling, while lanes 2 to 5 show extracts from cells in which pRS316-CEG1-CET1 was shuffled out using 5-FOA. Immunoprecipitation and subsequent guanylylation assays were carried out as described for Fig. 1.

Binding experiment with CTD peptides.

Peptides with four repeats of the CTD heptapeptide consensus sequence (YSPTSPS) were synthesized at the Biopolymers Facility in the Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School. Peptides with either serine or phosphoserine at position 5 were created. Each peptide was biotinylated at the N terminus to allow binding to Streptavidin-coated magnetic beads (Dynabeads M280 Streptavidin; Dynal, Inc.). Binding to beads was performed in phosphate-buffered saline buffer plus 0.01% Triton X-100, and conjugated beads were washed several times with the same buffer to remove free peptide.

For each binding reaction, 250 μg of peptide-linked Dynabeads was incubated with 6 or 7 pmol each of polyhistidine-tagged GTase and/or RTPase protein for 1 h at room temperature in binding buffer (20 mM HEPES-KOH at pH 7.6, 1 mM EDTA, 1 mM dithiothreitol, 10% [vol/vol] glycerol, 100 mM potassium acetate, 0.1% [vol/vol] Triton X-100, 0.02% [vol/vol] NP-40, and 0.1% bovine serum albumin). After several washes with the same buffer, [α-32P]GTP and enzyme-GMP reaction buffer (5) were added to guanylylate GTase. After incubation for 50 min at room temperature, the reaction was stopped by addition of sample loading buffer. Bound proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by immunoblotting using anti-His6 monoclonal antibody (Clontech) and autoradiography to detect radiolabeled GTase-GMP intermediate (E-GMP).

RESULTS

S. pombe pct1+ is an essential gene that encodes a capping enzyme RNA triphosphatase.

We searched the S. pombe genome database (Sanger Center, Cambridge, United Kingdom) for proteins with significant similarity to the yeast capping enzyme RNA triphosphatase (49). A BLAST search found a gene fragment on chromosome I that encodes a hypothetical protein similar to the carboxyl-terminal region of Cet1 and CaCet1 from C. albicans (52). This fragment has two internal stop codons. We amplified a corresponding DNA fragment from S. pombe cDNA library and found that those stop codons are removed as part of an intron. The resulting PCR product encodes a 35.4-kDa polypeptide with 303 residues (GenBank accession number CAB90131) containing motifs conserved in fungal and viral cap RTPases (21, 23, 24). These motifs have also been found in Ctl1/Cth1, a second RTPase from S. cerevisiae that is not required for capping (33, 37), and an RTPase from Plasmodium falciparum (20, 45). While our work was in progress, the identification of the S. pombe gene was independently reported and the gene was designated pct1 (35).

We purified recombinant polyhistidine-tagged protein (his7-pct1) and carried out RTPase assays (data not shown). pct1 released [32P]Pi from a [γ-32P]ATP-terminated dinucleotide (pppApC) and trinucleotide (pppApCpC). This activity was dependent upon divalent cations, since it was seen in the presence of magnesium or manganese but was inhibited by EDTA. Other fungal RTPases are more active with magnesium than with manganese (24, 34, 37). In contrast, we found that pct1 is more active in the presence of manganese and that manganese has a lower optimal concentration than magnesium (0.2 versus 2 mM, data not shown). We found that pct1 leaves a diphosphate end, which could subsequently act as a substrate for guanylylation. Like Cet1 (24) and CaCet1 (34), pct1 hydrolyzed the β-γ phosphodiester bond of ATP in the presence of manganese but not of magnesium (data not shown). Taken together, these results demonstrate that pct1 is a metal-dependent RTPase/NTPase related to the other fungal RTPases.

The pct1 gene is essential for viability.

S. cerevisiae contains two RTPases related to pct1: the essential capping enzyme subunit Cet1 and the nonessential Ctl1/Cth1. pct1 could correspond to either of these proteins. To determine whether the pct1+ gene is essential for viability, one copy of the gene was disrupted in a diploid S. pombe strain. Tetrads dissected from this strain never produced more than two viable spores (data not shown). Furthermore, none of the viable spores contained the marker for the pct1+ deletion. Microscopic examination of the missing colonies showed that spores germinated and that colonies reached the 16-cell stage before ceasing growth. We conclude that pct1 is essential for viability and is therefore likeliest to be the true capping enzyme triphosphatase of S. pombe.

pct1 is a capping enzyme RTPase but does not associate with GTase.

To further test if pct1+ is involved in mRNA capping, it was expressed in S. cerevisiae and tested for complementation of a CET1 deletion. Unlike CaCET1 (52), pct1+ could not support viability in a CET1 deletion strain (35; data not shown). We speculated that pct1 might not be able to replace Cet1 because it does not interact with and allosterically activate Ceg1 (6). Previously a Δceg1 Δcet1 strain was used to show that Cet1 lacking the region for interaction with Ceg1 (aa 235 to 265) supported cell viability in the presence of mouse capping enzyme GTase (MCE [211-597]) but not with Ceg1 (48). We used the double deletion strain to see if pct1 could function in the presence of other GTases (Fig. 1A). Overexpression of Ceg1 and pct1 could not support cell growth. However, when Ceg1 was replaced with either MCE (211-597), the S. pombe GTase pce1, or C. albicans Cgt1, cells grew as well as the wild-type strains. pct1 (43-303) supported cell growth as well as the full-length protein did (data not shown). Therefore, we conclude that pct1+ encodes a functional cap RTPase but is unable to functionally interact with S. cerevisiae Ceg1.

We tested for an interaction between Pce1 and Pct1, the two S. pombe capping enzyme subunits. First, we coexpressed his7-pct1 and untagged pce1 in E. coli and purified them from the soluble fraction with Ni2+-NTA-agarose. This histidine-tagged pct1 bound to the agarose, but pce1 was found only in the flowthrough fraction (data not shown). Therefore, the recombinant proteins do not interact. This could be because another protein in yeast is required to mediate an interaction. To test this, we next expressed a hemagglutinin (HA) epitope-tagged pct1 in S. cerevisiae and S. pombe. We carried out immunoprecipitations of whole-cell extracts using the monoclonal antibody 12CA5 (8, 10), and these were assayed with [α-32P]GTP to detect any GTase-GMP complex (Fig. 1B, lower panel). Lane 1 shows a positive control in which HA-tagged Cet1 and Cgt1 (the C. albicans GTase) are coexpressed in the S. cerevisiae Δceg1 Δcet1 strain. Cgt1 can bind S. cerevisiae Cet1 in vivo, as previously suggested by yeast two-hybrid assay interactions (52). Under the same conditions, HA-tagged pct1 could not coprecipitate pce1 when coexpressed in S. cerevisiae (Fig. 1B, lane 2). To make sure there was not a species-specific mediator of interactions, HA-tagged pct1 was expressed in S. pombe (Fig. 1B, lanes 4 and 6). Although HA-tagged pct1 was efficiently precipitated (Fig. 1B, upper panel), no associated GTase could be detected. Based on these results, we come to the surprising conclusion that the S. pombe GTases and RTPases are not tightly associated, as they are in S. cerevisiae and C. albicans (27, 52).

Independent interactions of pce1 and pct1 with CTD-P.

It is thought that RTPases are guided to the polymerase via the interaction between the GTase and CTD-P (5, 31, 54; for review, see references 18, 40, and 42). Unlike the mammalian GTase domain (19), Ceg1 bound to CTD-P is inhibited for covalent enzyme-GMP complex formation unless Cet1 is also present (6). pce1 has been shown to bind CTD-P, but its activity was not tested in that context (31). As there was no observable interaction between pce1 and pct1 (Fig. 1B), two questions were raised. First, how is pct1 recruited to the pol II transcription complex? Second, does pce1 resemble Ceg1 in being inhibited by binding to the CTD?

The CTD is composed of a tandemly repeated heptad with the consensus sequence YSPTSPS (7). The heptapeptide consensus repeat is phosphorylated at several positions in vivo, predominantly at serines 2 and 5 (32). Genetic and in vivo cross-linking experiments showed that phosphorylation of serine 5 is critical for the recruitment of S. cerevisiae capping enzyme to the pol II complex (28, 36, 38). Accordingly, synthetic CTD peptides with four tandem repeats of heptapeptide were prepared, one unphosphorylated and one in which all serine 5 positions are phosphorylated. These were conjugated to beads and used for in vitro binding experiments with the fungal GTase and RTPases (Fig. 2). Bound proteins were assayed both by immunoblotting and by enzyme-GMP intermediate formation.

FIG. 2.

FIG. 2.

Different interaction patterns between the CTD and fungal capping enzyme subunits. CTD peptides consisting of four heptapeptide repeats were conjugated to beads. The peptides were either unphosphorylated (CTD) or phosphorylated at all four serine 5 positions (CTD-P). Beads were incubated with recombinant fungal GTases and RTPases as described in Materials and Methods. Proteins bound to peptides were incubated with [α-32P]GTP to assay guanylyltransferase activity. Bound proteins were analyzed by SDS-PAGE followed by transfer to nitrocellulose membranes. Blots were analyzed by immunoblotting with anti-His6 monoclonal antibody (upper panels) and autoradiography (bottom panel). The asterisk denotes the position of the radioactive phosphate.

First, we tested Ceg1 and/or Cet1 (Fig. 2, lanes 1 to 6). As previously demonstrated using glutathione transferase-CTD fusions (6), Ceg1 preferentially interacts with the CTD-P peptide, either alone or complexed with Cet1 (Fig. 2, lanes 4 and 6). Cet1 associated with CTD-P only via its interaction with Ceg1 (Fig. 2, compare lanes 2 and 6). Ceg1 on the CTD-P could only be labeled with [α-32P]GTP in the presence of Cet1 (Fig. 2, lower panel, lanes 4 and 6). These results confirmed our earlier finding that Cet1 positively regulates the GTase activity of Ceg1 bound to CTD-P (6).

Next, we carried out similar experiments with the GTases and RTPases from C. albicans and S. pombe. Like Ceg1, GTases from these two fungi (Cgt1 and pce1) specifically bind to CTD-P, whether or not the RTPase is present (Fig. 2, middle panel, lanes 9 to 12 and 15 to 18). In surprising contrast to Cet1 (lane 2), both RTPases (CaCet1 and pct1) can also bind directly and specifically to CTD-P, independently of the GTase subunits (Fig. 2, upper panel, lanes 8 and 14). Other species-specific differences were noted in the assay for enzyme-GMP formation (Fig. 2, lower panel). The C. albicans capping enzyme subunits behaved like those of S. cerevisiae in that Cgt1 required the presence of CaCet1 to remain active when bound to CTD-P (Fig. 2, lower panel, lanes 10 and 12). In contrast, S. pombe pce1 was efficiently guanylylated even in the absence of pct1 (compare lanes 16 and 18 with lanes 4, 6, 10, and 12).

The interaction between capping enzyme subunits in S. cerevisiae is thought to provide two functions: delivery of the RTPase to the polymerase and preservation of GTase activity on the CTD-P. We find that neither of these activities is required in the S. pombe system, supporting our proposal that these two capping activities can function in vivo without any detectable interaction (Fig. 1). The Candida system appears to be intermediate between the other yeast systems. The RTPase can independently interact with the CTD-P, but interaction between subunits stimulates GTase activity.

The interaction between Cgt1 and CaCet1 may not be absolutely required in vivo.

Both two-hybrid assays (52) and immunoprecipitation experiments (Fig. 1B, lane 1) demonstrate interactions between the RTPases and GTases from S. cerevisiae and C. albicans. The GTase interaction region of Cet1 has been localized to residues 235 to 265 (22, 48). CaCet1 closely resembles Cet1 in this region (Fig. 3A), including four residues (P245, W247, W251, and P253) known to be important for Cet1-Ceg1 association (22, 48). This region is essential for CaCet1 to support cell viability in a Δcet1 strain, i.e., when GTase activity is supplied by Ceg1 (39). Considering this and the results from Fig. 2, it would be predicted that the C. albicans capping enzyme would require the subunit interaction to support viability, just as the S. cerevisiae enzyme does. However, we found that the S. pombe RTPase, which does not have the conserved domain for GTase interaction, rescued a Δceg1 Δcet1 strain when combined with the C. albicans GTase Cgt1 (Fig. 1A). As it is extremely unlikely that pct1 interacts with Cgt1, this result suggests that Cgt1 activity may not be dependent on an interaction with an RTPase in vivo.

To address whether the Cgt1-CaCet1 interaction is essential in vivo, we tested four N-terminal deletion mutants of CaCet1 for the ability to support viability of a Δceg1 Δcet1 strain when combined with either Ceg1 or Cgt1 (Fig. 3B). CaCet1 (203-520) carries the GTase interaction region and rescued cells with both GTases. CaCet1 (229-520) and CaCet1 (251-520) lack the interaction region and could not support viability in the presence of Ceg1. However, both supported cell growth with Cgt1. CaCet1 (269-520) creates a deletion that impinges upon the catalytic domain: this deletion was not viable with either GTase and did not produce a stable protein (data not shown). Therefore, C. albicans Cgt1 can function without RTPase sequences that are essential for interaction with the S. cerevisiae Ceg1.

To be sure that the Candida capping enzyme subunits were not interacting via sequences outside of the known interaction domain, we tested for interactions in yeast lysates. The CaCet1 derivatives were HA epitope tagged, so we tested for coimmunoprecipitation of Cgt1 using the 12CA5 monoclonal antibody. Precipitates were tested for Cgt1 guanylylation by adding [α-32P]GTP to the pellets (Fig. 3C). Levels of CaCet1 and its derivatives were comparable in immunoprecipitates (Fig. 3C, upper panel). In contrast, Cgt1 was coprecipitated only with full-length CaCet1and CaCet1 (203-520). No Cgt1 was detected in association with CaCet1 (229-520) and CaCet1 (251-520) (Fig. 3C, lower panel). These results suggest that residues 203 to 229 of CaCet1, equivalent to the Ceg1 interaction region of Cet1 (aa 235 to 265), are essential for its association with Cgt1. However, unlike the situation for the S. cerevisiae enzyme, the subunit interaction of the C. albicans enzyme is not absolutely required for cell viability.

Previously, we demonstrated that the Cet1-Ceg1 interaction becomes dispensable if Ceg1 is replaced with MCE (211-597). A complete deletion or a double point mutation in the interaction region of Cet1 (Cet1 [265-549] or cet1-446) is lethal in combination with Ceg1 but supports growth when coexpressed with MCE (211-597) (48). In contrast, two other temperature-sensitive alleles mutated in the catalytic region of Cet1 (cet1-401 [D422A] and cet1-438 [C330W]) become lethal when MCE (211-597) supplied GTase activity. This is presumably because MCE (211-597) does not bind Cet1 and therefore cannot stabilize these mutants (48). We tested whether Cgt1 and pce1 behave like MCE (211-597) or Ceg1 (Fig. 3D). Both fungal GTases could support growth of cells with Cet1 (265-549) or cet1-446 at both 30 and 37°C. Somewhat surprisingly, Cgt1 could not support viability when combined with either cet1-401 (D442A) or cet1-438 (C330W), suggesting that it might not interact with Cet1 to the same extent as Ceg1. The same results were obtained with pce1, consistent with the lack of interaction between S. pombe capping enzyme subunits. The fact that Cgt1 behaves in vivo like MCE (211-597) and pce1 suggests that Cgt1 functions independently of the interaction with RTPase in vivo.

DISCUSSION

In the present study, we demonstrate that different yeasts use divergent strategies for linking transcription and the multiple reactions that make up mRNA capping. The best characterized fungal system is from the budding yeast S. cerevisiae (summarized in Table 1). In this yeast, the interaction between the Ceg1 and Cet1 subunits is essential for viability. Ceg1 carries out guanylylation of the mRNA but also interacts with Cet1 and the phosphorylated CTD, thereby targeting the capping enzyme to the transcription complex. Cet1 plays two crucial roles in capping. Its carboxyl-terminal region (aa 265 to 549) catalyzes the RTPase reaction (37, 49). A second region (aa 235 to 265) binds to Ceg1 (6, 22, 29, 48) to allosterically activate Ceg1 when it is bound to CTD-P (6). The Cet1/Ceg1 interaction can also serve to stabilize Ceg1 activity in vitro in the absence of CTD binding (17), although we have not observed significant lability of Ceg1 under our conditions (E.-J. Cho and S. Buratowski, unpublished data). Exchange of other GTases for Ceg1 show that activation of Ceg1, not delivery of Cet1 to the transcription complex, is the essential function for the Ceg1-Cet1 interaction (48).

TABLE 1.

Summary of capping enzyme subunit behavior

Organism Subunits CTD-P inter- action Stimulation of GTase by RTPase in vitro Subunit interaction in vivo
S. cerevisiae Ceg1 (GTase) + + Yes, essential
Cet1 (RTPase) −
C. albicans Cgt1 (GTase) + + Yes, nonessential
CaCet1 (RTPase) +
S. pombe pce1 (GTase) + − No
pct1 (RTPase) +

In surprising contrast to the S. cerevisiae system, the S. pombe RTPase and GTase function independently of each other. No interaction could be detected either in vitro or in vivo (Fig. 1). To our knowledge, pct1 is the first capping RTPase that is not tightly associated with a GTase, either through a covalent linkage or as part of a complex. There is no need for such an interaction to deliver pct1 to the transcript because it binds directly to the phosphorylated CTD of polymerase (Fig. 2). Also, the GTase pce1 does not require allosteric activation because it is fully active when bound to CTD-P (Fig. 2).

We and others (35) have found that pct1+ does not complement an S. cerevisiae Δcet1 strain when Ceg1 is the GTase (Fig. 1A). Since pct1 lacks the region for interaction with GTase, one interpretation is that pct1+ cannot complement the Δcet1 deletion because Ceg1 cannot guide pct1 to the pol II complex (35). Our results instead suggest that pct1 does not complement because it cannot bind and activate Ceg1. pct1 functions in Δceg1 Δcet1 cells when it is fused to MCE (211-597) (35). We find that linkage between these two proteins is unnecessary (Fig. 1A), indicating that pct1 does not require any GTase chaperone to the pol II complex.

The capping machinery from C. albicans appears to be intermediate between that of S. cerevisiae and S. pombe. CaCet1 binds to Cgt1 via an interaction domain that is conserved in S. cerevisiae (Fig. 3A). Nonetheless, deletion analysis of CaCet1 clearly demonstrated that the Cgt1-CaCet1 interaction is nonessential in vivo, at least when these proteins are expressed from high-copy-number plasmids in S. cerevisiae (Fig. 3B and C). Based on similar deletions of CaCet1, it was proposed that CaCet1 contains a second, low-affinity site distal to aa 230 for interaction with Cgt1 (39). We could detect no association of CaCet1 (229-520) or CaCet1 (251-520) with Cgt1 (Fig. 3C). Also, CaCet1 (203-520), CaCet1 (229-520), and CaCet1 (251-520) support viability of a Δcet1 Δceg1 strain when Cgt1 is replaced with pce1 or the mouse GTase domain (data not shown), indicating that those CaCet1 mutants can function in vivo without binding to a GTase.

Candida capping enzyme does not seem to require either of the two functions assigned to the RTPase-GTase interaction. Delivery of CaCet1 to the transcription complex is not an issue because CaCet1 can bind specifically to the CTD-P (Fig. 2). In vitro, the GTases from both C. albicans and S. cerevisiae are inhibited upon binding CTD-P, but this inhibition is prevented when the RTPase is also present (6; Fig. 2). In S. cerevisiae, the Cet1-Ceg1 interaction is essential primarily to activate Ceg1 on CTD-P (48). Although the Candida capping enzyme shows similar behavior in vitro, it appears that Cgt1 inhibition in the absence of CaCet1 may not be significant in vivo.

In conclusion, our experiments reveal an unexpected diversity among fungal capping enzymes. Although the basic catalytic domains are highly conserved, the interactions between RTPase and GTase subunits are not. There is no interaction between the S. pombe RTPase and GTase, whereas the interaction between S. cerevisiae subunits is essential for viability. The Candida enzyme has characteristics intermediate to the other two yeasts. This invites speculation about how capping enzymes evolved. A eukaryotic progenitor system may have had two independent enzymes, similar to S. pombe. An evolutionary advantage of coupling the RTPase and GTase may have resulted in selection for the subunit interaction seen in the other yeasts. In higher eukaryotes, similar pressure may have selected for the fusion of a PTP-like phosphatase domain to the GTase domain. It will be interesting to see if any other capping enzyme arrangements exist in other organisms.

Acknowledgments

We thank L. Guarente (Massachusetts Institute of Technology) for the S. pombe cDNA library and pDB20LADA1, G. R. Fink (Massachusetts Institute of Technology) for the C. albicans genomic DNA library, S. Shuman (The Sloan-Kettering Institute) for pET-PCE1, S. L. Forsburg (The Salk Institute) for pSLF273 and pSGP73, and T. Enoch and T. Wolkow (Harvard Medical School) for S. pombe strain TE696 and advice on working with S. pombe protein extracts.

This work was supported by NIH Grant GM56663 to S.B. S.B. is a Scholar of the Leukemia and Lymphoma Society. T.T. was funded by the American Cancer Society, Massachusetts Division, Inc. as a Senior Postdoctoral Fellow.

APPENDIX

Table A1 contains a list of oligonucleotides used in this study. Table A2 lists plasmids used for subcloning and expression of recombinant proteins in bacteria. Plasmids used for experiments in yeast are listed in Table A3.

REFERENCES

  • 1.Altschul, S. F., L. M. Thomas, A. S. Alejandro, Z. Jinghui, Z. Zheng, M. Webb, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1991. Current protocols in molecular biology. John Wiley and Sons, New York, N.Y.
  • 3.Bahler, J., J. Q. Wu, M. S. Longtine, N. G. Shah, A. McKenzie III, A. B. Steever, A. Wach, P. Philippsen, and J. R. Pringle. 1988. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14:943-951. [DOI] [PubMed] [Google Scholar]
  • 4.Becker, D. M., J. D. Fikes, and L. Guarente. 1991. A cDNA encoding a human CCAAT-binding protein cloned by functional complementation in yeast. Proc. Natl. Acad. Sci. USA 88:1968-1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cho, E.-J., T. Takagi, C. R. Moore, and S. Buratowski. 1997. mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev. 11:3319-3326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cho, E.-J., C. R. Rodriguez, T. Takagi, and S. Buratowski. 1998. Allosteric interaction between capping enzyme subunits and the RNA polymerase II carboxy-terminal domain. Genes Dev. 12:3482-3487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6a.Cross, F. R. 1997. “Marker swap” plasmids: convenient tools for budding yeast molecular genetics. Yeast 13:647-653. [DOI] [PubMed] [Google Scholar]
  • 7.Dahmus, M. E. 1996. Reversible phosphorylation of the C-terminal domain of RNA polymerase II. J. Biol. Chem. 271:19009-19012. [DOI] [PubMed] [Google Scholar]
  • 8.Field, J., J.-I. Nikawa, D. Broek, B. MacDonald, L. Rodgers, I. A. Wilson, R. A. Lerner, and M. Wigler. 1988. Purification of a RAS-responsive adenylate cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8:2159-2165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Fikes, J. D., D. M. Becker, F. Winston, and L. Guarente. 1990. Striking conservation of TFIID in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Nature 346:291-294. [DOI] [PubMed] [Google Scholar]
  • 10.Forsburg, S. L., and D. A. Sherman. 1997. General purpose tagging vectors for fission yeast. Gene 191:191-195. [DOI] [PubMed] [Google Scholar]
  • 11.Fresco, L. D., and S. Buratowski. 1994. Active site of the mRNA-capping enzyme guanylyltransferase from Saccharomyces cerevisiae: similarity to the nucleotidyl attachment motif of DNA and RNA ligases. Proc. Natl. Acad. Sci. USA 91:6624-6628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fresco, L. D., and S. Buratowski. 1996. Conditional mutants of the yeast mRNA capping enzyme show that the cap structure enhances, but is not required for, mRNA splicing. RNA 2:584-595. [PMC free article] [PubMed] [Google Scholar]
  • 13.Furuichi, Y., and A. J. Shatkin. 2000. Viral and cellular mRNA capping: past and prospects. Adv. Virus Res. 55:135-184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gietz, D., A. St. Jean, R. A. Woods, and R. Schiestl. 1992. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Guthrie, C., and G. R. Fink (ed.). 1991. Methods in enzymology, vol. 194. Guide to yeast genetics and molecular biology. Academic Press, Inc., San Diego, Calif. [PubMed]
  • 16.Hakansson, K., A. J. Doherty, S. Shuman, and D. B. Wigley. 1997. X-ray crystallography reveals a large conformational change during guanylyl transfer by mRNA capping enzyme. Cell 89:545-553. [DOI] [PubMed] [Google Scholar]
  • 17.Hausmann, S., C. K. Ho, B. Schwer, and S. Shuman. 2001. An essential function of Saccharomyces cerevisiae RNA triphosphatase Cet1 is to stabilize RNA guanylyltransferase Ceg1 against thermal inactivation. J. Biol. Chem. 276:36116-36124. [DOI] [PubMed] [Google Scholar]
  • 18.Hirose, Y., and J. L. Manley. 2000. RNA polymerase II and the integration of nuclear events. Genes Dev. 14:1415-1429. [PubMed] [Google Scholar]
  • 19.Ho, C. K., and S. Shuman. 1999. Distinct roles for CTD Ser-2 and Ser-5 phosphorylation in the recruitment and allosteric activation of mammalian mRNA capping enzyme. Mol. Cell 3:405-411. [DOI] [PubMed] [Google Scholar]
  • 20.Ho, C. K., and S. Shuman. 2001. A yeast-like mRNA capping apparatus in Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 98:3050-3055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ho, C. K., C. Gong, and S. Shuman. 2001. RNA triphosphatase component of the mRNA capping apparatus of Paramecium bursaria Chlorella virus 1. J. Virol. 75:1744-1750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ho, C. K., K. Lehman, and S. Shuman. 1999. An essential surface motif (WAQKW) of yeast RNA triphosphatase mediates formation of the mRNA capping enzyme complex with RNA guanylyltransferase. Nucleic Acids Res. 27:4671-4678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ho, C. K., A. Martins, and S. Shuman. 2000. A yeast-based genetic system for functional analysis of viral mRNA capping enzymes. J. Virol. 74:5486-5494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ho, C. K., Y. Pei, and S. Shuman. 1998. Yeast and viral RNA 5′ triphosphatases comprise a new nucleoside triphosphatase family. J. Biol. Chem. 273:34151-34156. [DOI] [PubMed] [Google Scholar]
  • 25.Ho, C. K., B. Schwer, and S. Shuman. 1998. Genetic, physical, and functional interactions between the triphosphatase and guanylyltransferase components of the yeast mRNA capping apparatus. Mol. Cell. Biol. 18:5189-5198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ho, C. K., V. Sriskanda, S. McCracken, D. Bentley, B. Schwer, and S. Shuman. 1998. The guanylyltransferase domain of mammalian mRNA capping enzyme binds to the phosphorylated carboxyl-terminal domain of RNA polymerase II. J. Biol. Chem. 273:9577-9585. [DOI] [PubMed] [Google Scholar]
  • 26a.Horiuchi, J., N. Silverman, B. Pina, G. A. Marcus, and L. Guarente. 1997. ADA1, a novel component of the ADA/GCN5 complex, has broader effects than GCN5, ADA2, or ADA3. Mol. Cell. Biol. 17:3220-3228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Itoh, N., H. Yamada, Y. Kaziro, and K. Mizumoto. 1987. Messenger RNA guanylyltransferase from Saccharomyces cerevisiae: large scale purification, subunit functions, and subcellular localization. J. Biol. Chem. 262:1989-1995. [PubMed] [Google Scholar]
  • 28.Komarnitsky, P., E. J. Cho, and S. Buratowski. 2000. Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev. 14:2452-2460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lehman, K., B. Schwer, C. K. Ho, I. Rouzankina, and S. Shuman. 1999. A conserved domain of yeast RNA triphosphatase flanking the catalytic core regulates self-association and interaction with the guanylyltransferase component of the mRNA capping apparatus. J. Biol. Chem. 274:22668-22678. [DOI] [PubMed] [Google Scholar]
  • 30.Liu, H., J. Kohler, and G. R. Fink. 1994. Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266:1723-1726. [DOI] [PubMed] [Google Scholar]
  • 31.McCracken, S., N. Fong, E. Rosonina, K. Yankulov, G. Brothers, D. Siderovski, A. Hessel, S. Foster, Amgen EST Program, S. Shuman, and D. L. Bentley. 1997. 5′-Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II. Genes Dev. 11:3306-3318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Patturajan, M., R. J. Schulte, B. M. Sefton, R. Berezney, M. Vincent, O. Bensaude, S. L. Warren, and J. L. Corden. 1998. Growth-related changes in phosphorylation of yeast RNA polymerase II. J. Biol. Chem. 273:4689-4694. [DOI] [PubMed] [Google Scholar]
  • 33.Pei, Y., C. K. Ho, B. Schwer, and S. Shuman. 1999. Mutational analyses of yeast RNA triphosphatases highlight a common mechanism of metal-dependent NTP hydrolysis and a means of targeting enzymes to pre-mRNAs in vivo by fusion to the guanylyltransferase component of the capping apparatus. J. Biol. Chem. 274:28865-28874. [DOI] [PubMed] [Google Scholar]
  • 34.Pei, Y., K. Lehman, L. Tian, and S. Shuman. 2000. Characterization of Candida albicans RNA triphosphatase and mutational analysis of its active site. Nucleic Acids Res. 28:1885-1892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Pei, Y., B. Schwer, S. Hausmann, and S. Shuman. 2001. Characterization of Schizosaccharomyces pombe RNA triphosphatase. Nucleic Acids Res. 29:387-396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rodriguez, C. R., E.-J. Cho, M.-C. Keogh, C. L. Moore, A. L. Greenleaf, and S. Buratowski. 2000. Kin28, the TFIIH-associated carboxy-terminal domain kinase, facilitates the recruitment of mRNA processing machinery to RNA polymerase II. Mol. Cell. Biol. 20:104-112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Rodriguez, C. R., T. Takagi, E.-J. Cho, and S. Buratowski. 1999. A Saccharomyces cerevisiae RNA 5′-triphosphatase related to mRNA capping enzyme. Nucleic Acids Res. 27:2181-2188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Schroeder, S. C., B. Schwer, S. Shuman, and D. Bentley. 2000. Dynamic association of capping enzymes with transcribing RNA polymerase II. Genes Dev. 14:2435-2440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Schwer, B., K. Lehman, N. Saha, and S. Shuman. 2000. Characterization of the mRNA capping apparatus of Candida albicans. J. Biol. Chem. 276:1857-1864. [DOI] [PubMed] [Google Scholar]
  • 40.Shatkin, A. J., and J. L. Manley. 2000. The ends of the affair: capping and polyadenylation. Nat. Struct. Biol. 7:838-842. [DOI] [PubMed] [Google Scholar]
  • 41.Shibagaki, Y., N. Itoh, H. Yamada, S. Nagata, and K. Mizumoto. 1992. mRNA capping enzyme: isolation and characterization of the gene encoding mRNA guanylyltransferase subunit from Saccharomyces cerevisiae. J. Biol. Chem. 267:9521-9528. [PubMed] [Google Scholar]
  • 42.Shuman, S. 2000. Structure, mechanism, and evolution of the mRNA capping apparatus. Prog. Nucleic Acids Res. Mol. Biol. 66:1-40. [DOI] [PubMed] [Google Scholar]
  • 43.Shuman, S., Y. Liu, and B. Schwer. 2050. 1994. Covalent catalysis in nucleotidyl transfer reactions: essential motifs in Saccharomyces cerevisiae RNA capping enzyme are conserved in Schizosaccharomyces pombe and viral capping enzymes and among polynucleotide ligases. Proc. Natl. Acad. Sci. USA 91:12046-12050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Sacchromyces cerevisiae. Genetics 122:19-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Takagi, T., and S. Buratowski. 2001. A Plasmodium falciparum protein related to fungal RNA 5′-triphosphatases. Mol. Biochem. Parasitol. 14:239-244. [DOI] [PubMed] [Google Scholar]
  • 46.Takagi, T., C. R. Moore, F. Diehn, and S. Buratowski. 1997. An RNA 5′-triphosphatase related to the protein tyrosine phosphatases. Cell 89:867-873. [DOI] [PubMed] [Google Scholar]
  • 47.Takagi, T., G. S. Taylor, T. Kusakabe, H. Charbonneau, and S. Buratowski. 1998. A protein tyrosine phosphatase-like protein from baculovirus has RNA 5′-triphosphatase and diphosphatase activities. Proc. Natl. Acad. Sci. USA 95:9808-9812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Takase, Y., T. Takagi, P. B. Komarnitsky, and S. Buratowski. 2000. The essential interaction between yeast mRNA capping enzyme subunits is not required for triphosphatase function in vivo. Mol. Cell. Biol. 20:9307-9316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Tsukamoto, T., Y. Shibagaki, S. Imajoh-Ohmi, T. Murakoshi, M. Suzuki, A. Nakamura, H. Gotoh, and K. Mizumoto. 1997. Isolation and characterization of the yeast mRNA capping enzyme β subunit gene encoding RNA 5′-triphosphatase, which is essential for cell viability. Biochem. Biophys. Res. Commun. 239:116-122. [DOI] [PubMed] [Google Scholar]
  • 50.Wang, S. P., L. Deng, C. K. Ho, and S. Shuman. 1997. Phylogeny of mRNA capping enzyme. Proc. Natl. Acad. Sci. USA 94:9573-9578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yamada-Okabe, T., R. Doi, O. Shimmi, M. Arisawa, and H. Yamada-Okabe. 1998. Isolation and characterization of a human cDNA for mRNA 5′-capping enzyme. Nucleic Acids Res. 26:1700-1706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Yamada-Okabe, T., T. Mio, M. Matsui, Y. Kashima, M. Arisawa, and H. Yamada-Okabe. 1998. Isolation and characterization of the Candida albicans gene from mRNA 5′-triphosphatase: association of mRNA 5′-triphosphatase and mRNA 5′-guanylyltransferase activities is essential for the function of mRNA 5′-capping enzyme in vivo. FEBS Lett. 435:49-54. [DOI] [PubMed] [Google Scholar]
  • 53.Yamada-Okabe, T., O. Shimmi, R. Doi, K. Mizumoto, M. Arisawa, and H. Yamada-Okabe. 1996. Isolation of the mRNA-capping enzyme and ferric-reductase-related genes from Candida albicans. Microbiology 142:2515-2523. [DOI] [PubMed] [Google Scholar]
  • 54.Yue, Z., E. Maldonado, R. Pillutla, H. Cho, D. Reinberg, and A. J. Shatkin. 1997. Mammalian capping enzyme complements mutant Saccharomyces cerevisiae lacking mRNA guanylyltransferase and selectively binds to the elongation form of RNA polymerase II. Proc. Natl. Acad. Sci. USA 94:12898-12903. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Eukaryotic Cell are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES