Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2025 Feb 10;6(1):103633. doi: 10.1016/j.xpro.2025.103633

Protocols for the application of human embryonic stem cell-derived neurons for aging modeling and gene manipulation

Hui Zhang 1,10, Shuhui Sun 1,10, Juan Carlos Izpisua Belmonte 9, Guang-Hui Liu 2,3,5,8,11,12,, Si Wang 4,8,∗∗, Weiqi Zhang 3,5,6,7,8,∗∗∗, Jing Qu 1,2,3,5,8,∗∗∗∗
PMCID: PMC11867521  PMID: 39932849

Summary

In vitro models of neuronal aging and gene manipulation in human neurons (hNeurons) are valuable tools for investigating human brain aging and diseases. Here, we present a protocol for applying human embryonic stem cell (hESC)-derived neurons to model aging and the further application of small interfering RNA (siRNA)-mediated gene silencing for functional investigations. We describe steps for neuronal differentiation and culture, siRNA transfection, and technical considerations to ensure reproducibility. Our protocol enables investigations of the molecular mechanism underlying neuronal aging and facilitates drug evaluation.

For complete details on the use and execution of this protocol, please refer to Zhang et al.1

Subject areas: Cell Biology, Developmental biology, Molecular Biology, Neuroscience, Stem Cells, Cell Differentiation

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • Generation of highly pure hESC-derived neurons

  • Modeling human neuronal aging via long-term culture in vitro

  • Achieve genetic manipulation in human neurons utilizing siRNA

  • Genetic or drug intervention attenuates human neuronal aging


Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.


In vitro models of neuronal aging and gene manipulation in human neurons (hNeurons) are valuable tools for investigating brain aging and disease. Here, we present a protocol for applying human embryonic stem cell (hESC)-derived neurons to model aging and the further application of small interfering RNA (siRNA)-mediated gene silencing for functional investigations. We describe steps for neuronal differentiation and culture, siRNA transfection, and technical considerations to ensure reproducibility. Our protocol enables investigations of the molecular mechanism underlying neuronal aging and facilitates drug evaluation.

Before you begin

  • 1.

    Our research falls under the ISSCR guidelines, and the cultures are not patient-derived. Ensure that all research falls under the ISSCR guidelines.

  • 2.

    Carefully review the detailed description of the steps required to successfully execute neuronal differentiation and culture. Specifically, review information about the media composition, culture timeline, as well as siRNA transfection procedures, and the optimal dosing time points.

  • 3.

    Prepare the following materials before starting cell culture. For a full list of materials and equipment, please refer to the key resources table.

  • 4.

    Perform all cell culture operations under sterile conditions in a Class II biosafety cabinet. Ensure that all cells are cultured in a 37°C, 5% CO2 incubator. All culture medium should be heated to 37°C before use.

Institutional permissions

The human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) used in this study were approved by the Use Committee of Institute of Zoology, Chinese Academy of Sciences. All researches fall under the International Society for Stem Cell Research (ISSCR) guidelines. Researchers must secure authorization from the appropriate authorities prior to initiating the experimental procedures.

Preparing a Matrigel-coated 6-well plate

Inline graphicTiming: about 12 h

In this step, a Matrigel-coated 6-well plate is prepared for differentiation of human neural stem cells (hNSCs).

  • 5.
    Prepare a Matrigel-coated 6-well plate.
    • a.
      Position the DMEM/F12 and the 6-well plate on ice to allow for cooling.
    • b.
      Make 12 mL of Matrigel working solution by adding 70 μL of Matrigel to 12 mL DMEM/F12 in a 15 mL-conical tube.
    • c.
      Use a pipette to move up and down to ensure complete mixing of the contents.2
    • d.
      Add 2 mL of Matrigel working solution to each well.
    • e.
      Gently agitate the plate to ensure the Matrigel working solution is evenly distributed along the bottom of each well.
    • f.
      Incubate the 6-well plate at 37°C for a minimum of 12 h.

Note: Extended incubation at 37°C poses a risk of reagent evaporation, which can lead to uneven substrate coverage on the plate or introduce bacterial contamination. Consequently, it is imperative to utilize the Matrigel-coated 6-well plates promptly.

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Goat polyclonal anti-SOX2 Abcam Cat# ab239218; RRID: AB_2814791
Rabbit polyclonal anti-PAX6 Covance Cat# PRB-278P; RRID: AB_ 291612
Alexa Fluo 555 Mouse monoclonal anti-NESTIN BD Biosciences Cat# 560422; RRID: AB_1645172
Rabbit polyclonal anti-Ki67 Abcam Cat# ab15580; RRID: AB_443209
Rabbit polyclonal anti-TUJ1 Sigma-Aldrich Cat# T2200; RRID: AB_262133
Mouse monoclonal anti-MAP2 Sigma-Aldrich Cat# M4403; RRID: AB_477193
Chicken polyclonal anti-MAP2 Abcam Cat# ab5392; RRID: AB_2138153
Rabbit polyclonal anti-Lamin B1 Abcam Cat# ab16048; RRID: AB_10107828
Rabbit monoclonal anti-Lamin B2 Abcam Cat# ab151735; RRID: AB_2827514
Mouse monoclonal anti-β-Amyloid (4G8) BioLegend Cat# 800701; RRID: AB_2564633
Alexa Fluo 568 donkey anti-mouse IgG (H + L) Invitrogen Cat# A-10037; RRID: AB_2534013
Alexa Fluo 568 donkey anti-rabbit IgG (H + L) Invitrogen Cat# A-10042; RRID: AB_2534017
Alexa Fluo 488 donkey anti-rabbit IgG (H + L) Invitrogen Cat# A-21206; RRID: AB_2535792
Alexa Fluor 488 donkey Anti-mouse IgG (H + L) Invitrogen Cat# A-21202; RRID: AB_141607
Alexa Fluor 488 donkey anti-goat IgG (H + L) Invitrogen Cat# A-11055; RRID: AB_2534102
Alexa Fluor 488 goat anti-chicken IgY (H + L) Invitrogen Cat# A-11039; RRID: AB_2534096
Alexa Fluo 647 donkey anti-rabbit IgG (H + L) Invitrogen Cat# A-31573; RRID: AB_2536183

Chemicals, peptides, and recombinant proteins

Gelatin Sigma-Aldrich Cat# V900863
Matrigel Corning Cat# 354230
DMEM/High glucose HyClone Cat# SH30243.01
Fetal bovine serum (FBS) Gibco Cat# 42Q7980K
0.25% Trypsin-EDTA (1×), phenol red Gibco Cat# 25200072
TrypLE Express Enzyme (1×), no phenol red Gibco Cat# 12604021
DMEM/F12 Thermo Fisher Scientific Cat# 11330057
KnockOut-SR Thermo Fisher Scientific Cat# 10828028
Non-essential amino acids (NEAA) GIBCO Cat# 11140076
GlutaMAX GIBCO Cat# 35050079
Penicillin Streptomycin (Pen Strep) Gibco Cat# 15140-163
bFGF Joint Protein Central Cat# BBI-EXP-002
2-Mercaptoethanol Gibco Cat# 21985-023
Plasmocin InvivoGen Cat# ant-mpt
Dispase Gibco Cat# 17105041
Advanced DMEM/F12 Gibco Cat# 12634-028
Neurobasal Gibco Cat# 12348-017
N2 Gibco Cat# 17502-048
B27 Gibco Cat# 17504-044
hLIF Millipore Cat# LIF1050
SB431542 Selleck Cat# s1067
CHIR99021 Tocris Cat# 252917-06-9
Dorsomorphin Sigma-Aldrich Cat# P5499
Compound E Millipore Cat# 565790
dbcAMP Sigma-Aldrich Cat# D0627
Ascorbic acid Sigma-Aldrich Cat# A8960
BDNF PeproTech Cat# 450-02
GDNF PeproTech Cat# 450-10
Accutase Cell Dissociation Reagent Gibco Cat# A1110501
Laminin Sigma-Aldrich Cat# L2020
Cytosine Arabinoside Sigma-Aldrich Cat# C6645
Hoechst 33342 Thermo Fisher Scientific Cat# H3570
4% paraformaldehyde, PFA Dingguo, China Cat# AR-0211
Triton X-100 Sigma-Aldrich Cat# T9284
Normal donkey serum Bioss Cat# C-0008
DMSO Sigma-Aldrich Cat# D2650
X-Gal Amresco Cat# 0428-25G
VECTASHIELD antifade mounting medium Vector Laboratories Cat# H-1000
UltraPure DNase/RNase-free distilled water Gibco Cat# 10977023
PBS,1× (pH 7.2–7.4, 0.01 M, cell culture) Solarbio Cat# P1020
Opti-MEM Gibco Cat# 31985070

Critical commercial assays

Lipofectamine 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000015
Proteostat Protein Aggregation Assay Enzo Cat# ENZ-51035-K100

Experimental models: Cell lines

CF1 mouse embryonic fibroblasts, MitC-treated Gibco Cat# A34959
Human: H9 hESCs WiCell Research Institute N/A
Human: H1 hESCs WiCell Research Institute N/A
Human: Male hiPSCs Ling et al.3 N/A

Oligonucleotides

Primer: GAPDH qRT-PCR forward: ACAACTTTGGTATCGTGGAAGG Zhang et al.1 N/A
Primer: GAPDH qRT-PCR reverse: GCCATCACGCCACAGTTTC Zhang et al.1 N/A
Primer: LMNB1 qRT-PCR forward: AAGCATGAAACGCGCTTGG Zhang et al.1 N/A
Primer: LMNB1 qRT-PCR reverse: AGTTTGGCATGGTAAGTCTGC Zhang et al.1 N/A
Primer: LMNB2 qRT-PCR forward: TGACCAGAACGACAAGGCG Zhang et al.1 N/A
Primer: LMNB2 qRT-PCR reverse: CCGAATGCGATCTTCAGCG Zhang et al.1 N/A
Primer: cGAS qRT-PCR forward: GGCGGTTTTGGAGAAGTTGA Zhang et al.1 N/A
Primer: cGAS qRT-PCR reverse: GCCGCCGTGGAGATATCAT Zhang et al.1 N/A
siRNA targeting sequence: negative control (NC) RiboBio Co., Ltd, China N/A
siRNA targeting sequence: LMNB1: CGAGCATCCTCAAGTCGTA RiboBio Co., Ltd, China N/A
siRNA targeting sequence: LMNB2: GGAGGATCTTTTCCACCAA RiboBio Co., Ltd, China N/A
siRNA targeting sequence: cGAS: CTAGCAACTTAATTGACAA RiboBio Co., Ltd, China N/A

Software and algorithms

ImageJ (version 1.8.0) Schneider et al.4 https://imagej.net/Welcome
ZEN 3.1 ZEISS https://www.micro-shop.zeiss.com/en/us/system/zen+software/software+zen/zen+-+basic+software/410135- 1002-310
GraphPad Prism 8.0 GraphPad Software, Inc. https://www.graphpad.com/

Other

6-well plate Corning Cat# 3516
24-well plate Corning Cat# 3524
15-mL centrifuge tube Corning Cat# 430790
Microscope cover glass Fisher Scientific Cat# 1254580
Vacuum filtration system Corning Cat# 431097

Materials and equipment

Human embryonic stem cell (hESC) medium

Reagent Final concentration Amount
DMEM/F12 (1×) 0.78× 388 mL
KnockOut-SR (1×) 0.19× 97 mL
NEAA (100×) 5 mL
GlutaMAX (100×) 5 mL
Pen Strep (100×) 5 mL
2-Mercaptoethanol (1000×) 500 μL
bFGF (50 μg/mL) 10 ng/mL 100 μL
Total N/A 500 mL

Sterilely filter and store in a dark place at 4°C for up to 2 weeks.

  • bFGF stock solution: Reconstitute 1 mg lyophilized protein in 20 mL PBS with 0.1% BSA to a concentration of 50 μg/mL, aliquot and store at −80°C for up to 6 months. Add bFGF when changing the culture medium (final concentration 10 ng/mL).

Alternatives: No alternatives.

Human neural stem cell (hNSC) maintenance medium (NSMM)

Reagent Final concentration Amount
Advanced DMEM/F12 (1×) 0.47× 235 mL
Neurobasal (1×) 0.47× 235 mL
NEAA (100×) 5 mL
GlutaMAX (100×) 5 mL
Pen Strep (100×) 5 mL
N2 (100×) 5 mL
B27 (50×) 10 mL
hLIF (50 μg/mL) 10 ng/mL 50 μL
SB431542 (10 mM) 2 μM 100 μL
CHIR99021 (10 mM) 3 μM 150 μL
Total N/A 500 mL

Sterilely filter and store at 4°C for up to 2 weeks.

  • SB431542 stock solution: Reconstitute 10 mg lyophilized powder in 2.60 mL DMSO to a concentration of 10 mM, aliquot and store at −80°C for up to 1 year.

  • CHIR99021 stock solution: Reconstitute 10 mg lyophilized powder in 2.15 mL DMSO to a concentration of 10 mM, aliquot and store at −80°C for up to 1 year.

Inline graphicCRITICAL: Handle DMSO with nitrile gloves as it is very rapidly absorbed through the skin.

Alternatives: There are no alternatives.

Neural Induction-1 (NID1) medium

Reagent Final concentration Amount
NSMM (1×) 60 mL
SB431542 (10 mM) 3 μM 6 μL
CHIR99021 (10 mM) 4 μM 6 μL
Compound E (1 mM) 0.1 μM 6 μL
Total N/A 60 mL

Sterilely filter and store at 4°C for up to 1 week.

  • Compound E stock solution: To prepare Compound E stock solution (1 mM), resuspend 1 mg lyophilized powder in 2.04 mL DMSO, aliquot and store in dark at −80°C for up to one year.

Inline graphicCRITICAL: Handle DMSO with nitrile gloves as it is very quickly absorbed through the skin.

Alternatives: There are no alternative solutions.

Neural Induction-2 (NID2) medium

Reagent Final concentration Amount
NID1 (1×) 30 mL
Dorsomorphin (10 mM) 2 μM 6 μL
Total N/A 30 mL

Sterilely filter and store at 4°C for up to 2 weeks.

  • Dorsomorphin stock solution: To prepare Dorsomorphin stock solution (10 mM), resuspend 5 mg lyophilized powder in 1.25 mL DMSO, aliquot and store in dark at −80°C for up to one year.

Inline graphicCRITICAL: Handle DMSO with nitrile gloves as it is very quickly absorbed through the skin.

Alternatives: There are no alternative solutions.

Neuron differentiation medium (NDM)

Reagent Final concentration Amount
Advanced DMEM/F12 (1×) 0.96× 191 mL
Pen Strep (100×) 2 mL
N2 (100×) 2 mL
B27 (50×) 4 mL
dbcAMP (200 mM) 400 μM 400 μL
Ascorbic acid (100 mM) 200 μM 400 μL
BDNF (10 μg/mL) 10 ng/mL 200 μL
GDNF (10 μg/mL) 10 ng/mL 200 μL
Total N/A 200 mL

Sterilely filter and store at 4°C for up to 2 weeks.

  • dbcAMP stock solution: To prepare dbcAMP stock solution (200 mM), resuspend 1 g dbcAMP in 10.18 mL UltraPure DNase/RNase-Free Distilled Water, aliquot and store at −80°C for up to one year.

  • Ascorbic acid stock solution: To prepare L-ascorbic acid-2-phosphate stock solution (100 mM), resuspend 400 mg in 13.82 mL UltraPure DNase/RNase-Free Distilled Water, aliquot and store in dark at −80°C for up to one year.

  • BDNF stock solution: Reconstitute 100 μg lyophilized protein in 10 mL PBS with 0.1% BSA to a concentration of 10 μg/ mL. Aliquot and store at −80°C for up to 6 months.

  • GDNF stock solution: Reconstitute 100 μg lyophilized protein in 10 mL PBS with 0.1% BSA to a concentration of 10 μg/mL. Aliquot and store at −80°C for up to 6 months.

Inline graphicCRITICAL: For dbcAMP, handle with nitrile gloves as skin contact may be harmful. For BDNF and GDNF, handle with care under a biological safety cabinet and use personal protection equipment. BDNF and GDNF may cause eye and skin irritation. Rinse eyes or skin with water for at least 15 min if touched. BDNF and GDNF may be harmful if inhaled or swallowed. Immediately get medical attention if inhaled or swallowed.

Alternatives: There are no alternative solutions.

Step-by-step method details

Generating embryoid bodies and initiating neural induction

Inline graphicTiming: 10 days

This step describes the generation of embryoid bodies and initiation of neural induction.

  • 1.
    Preparation of hESCs.5,6,7,8
    • a.
      One day before hESC passage, use MEF medium to seed 30,000/cm2 mitotically inactivated MEFs on a Matrigel-coated 6-well plate.
    • b.
      Use mechanical passage tools to passage hESC and transfer 5–7 hESC pieces of colonies to one well (Figure 1A).
  • 2.
    Neural induction was initiated as previously described.9,10,11,12
    Note: Based on the colony size, it is best to start on the second day after hESC passage, or the first day (Figure 1B).
    • a.
      Completely remove all medium from the plate and wash the cells with Advanced DMEM/F12.
    • b.
      Incubate with NID2 medium for 2 days and change the medium daily (Figure 1B).
    • c.
      Remove all medium from the plate and gently wash the cells with Advanced DMEM/F12.
    • d.
      Incubate with NID1 medium for 5 days and change the medium daily (Figure 1C).
      Note: After 5 days of treatment with NID1 medium, embryoid bodies (EBs) were generated. The appearance of cells at each stage is shown in Figures 1B and 1C.

Figure 1.

Figure 1

Timeline of generating hNSCs from hESCs

(A) Representative images illustrating the self-renewal growth state of H9 hESCs. Scale bars, 200 μm.

(B) Representative images depicting the neural differentiation of H9 hESCs in a 6-well plate from 0 to 2 days in vitro (DIV0-2). Scale bars, 200 μm.

(C) Representative images depicting the neural differentiation of H9 hESCs in a 6-well plate from 3 to 7 days in vitro (DIV3-7). Scale bars, 200 μm.

Generation and passage of hNSCs

Inline graphicTiming: around 3 weeks

This step describes the generation and passage of hNSCs.

  • 3.
    Passage of hNSCs.
    • a.
      Warm Accutase Cell Dissociation Reagent and hNSC media in a 37°C water bath.
    • b.
      Remove all medium from the plate and gently wash the cells with 1× PBS.
      Note: EBs are non-adherent. Gently handle the plates and be careful to avoid sucking away the cells.
    • c.
      Add 0.5 mL Accutase to a well, and incubate at 37°C for 5–7 min.
    • d.
      At the end of the incubation period, gently tap the side of the 6-well plate to facilitate the digestion and dispersion of the EBs.
    • e.
      Without aspirating Accutase, add 1 mL hNSC media to the well.
    • f.
      Use a pipette for triturating, to mechanically dissociate EBs to single cells and transfer the cell suspension to a 15-mL centrifuge tube.
    • g.
      Centrifuge for 5 min at 200 × g.
    • h.
      Remove the supernatant from the tube by gentle aspiration, suspend the cells in 1 mL hNSC medium containing 10 μM Y-27632 and count the cells.
    • i.
      Transfer 1×105 cells/cm2 into one well of a 6-well plate, replenish hNSC medium to 2 mL.
    • j.
      Add Y-27632 to a final concentration of 10 μM, shake well, and incubate the plate at 37°C with 5% CO2.
      Note: This is the passage 1 (P1) of hNSCs, and is typically enough to plate in 1–2 wells.
    • k.
      Passage the first three passages of neural stem cells with 1×105 cells/cm2 per well.
    • l.
      Add Y-27632 (10 μM) on the day of passage (Figure 2A).
      Note: When the cultured hNSCs grow to 90% confluence, as shown in Figure 2B, they can be passaged.
    • m.
      Detect hNSC markers of SOX2, PAX6 and NESTIN at passage 3 (P3) via immunofluorescence staining (Figure 2C).
    • n.
      Immunofluorescence staining.
      • i.
        Fix cells with 4% PFA for 15 min.
      • ii.
        Permeabilize with Triton X-100 (0.2% in PBS) for 10 min.
      • iii.
        Incubate with blocking buffer (10% donkey serum in PBS) for 1 h at 25°C–28°C.
      • iv.
        Dilute the primary antibodies to an appropriate concentration in 5% donkey serum.
      • v.
        Incubate cells with primary antibodies diluent for 12–18 hours (12–18 h) at 4°C.
      • vi.
        Dilute the secondary antibody in 1× PBS at a ratio of 1:500.
      • vii.
        Incubate cells with secondary antibodies diluent for 1 h at 25°C–28°C.
      • viii.
        Counterstain the nuclei with Hoechst 33342 and then mount the sections using VECTASHIELD Anti-Fade Mounting Medium.
      • ix.
        Use ZEISS LSM 900 confocal system for immunofluorescence microscopy.

Figure 2.

Figure 2

Quality controls confirming high yield and successful neural induction

(A) Brightfield images showing the morphology of hNSCs after the reattachment of dissociated EBs cells through several passages (annotated as P1, P2, P3). Scale bars, 100 μm.

(B) The density of hNSCs that can continue to be passaged. Scale bars, 100 μm.

(C) Immunofluorescence staining of hNSCs on P3 confirming the expression of hNSC markers SOX2, PAX6 and NESTIN. Scale bars, 20 μm. n = 3 biological samples. Data are represented as the mean ± SEM.

Freezing and thawing of hNSCs

Inline graphicTiming: 20 min for freezing or thawing procedure, Matrigel-coated plates are prepared 1 day before thawing

In this step, we describe how to freeze hNSCs for long-term storage in a liquid nitrogen tank, and how to thaw the hNSCs.

  • 4.
    Optimal freezing of hNSCs is achieved during the P0 to P2.
    • a.
      Add 0.5 mL Accutase to the hNSCs and incubate for 5 min at 37°C.
    • b.
      Add 1 mL hNSC medium to the well to terminate the digestion reaction.
    • c.
      Transfer the cell suspension to a 15-mL centrifuge tube.
    • d.
      Spin down hNSCs and resuspend in 1 mL hNSC medium for every 1–2 collected wells, depending on cell density.
    • e.
      Prepare hNSCs cryopreservation solution at a volume ratio of 4:1 between hNSC medium and DMSO.
    • f.
      Transfer 0.5 mL hNSCs suspension to cryovials and add 0.5 mL of hNSCs cryopreservation solution dropwise to the cryovials.
    • g.
      Quickly tighten the cap and gently invert it to mix well.
    • h.
      Transfer the frozen vial to a cell freezing container to allow cells to be cryopreserved slowly and place it into a −80°C refrigerator to freeze 12–18 h.
    • i.
      The next day, transfer frozen hNSCs to the liquid nitrogen tank.

Optional: To facilitate planning, cells are counted before freezing. Freeze hNSCs at about 1×106 cells per cryovial to thaw them into one well of a 6-well plate. Record the production (i.e., counting neurons obtained from differentiation) and/or quality of cells (e.g., by capturing representative bright-field images) to optimize future differentiation and adjust subsequent experimental settings.

Inline graphicPause point: hNSCs can be frozen at this point and stored in liquid nitrogen for a longer period of time (months to years). Long-term cultivation of differentiated human neurons can be resumed at any later time point, allowing for synchronous long-term cultivation of different cell lines.

  • 5.
    Thawing of hNSCs.
    • a.
      The day before thawing, coat the required number of wells with Matrigel.
    • b.
      Prepare 9 mL hNSC medium in a 15 mL-conical tube, one tube per vial thawed.
    • c.
      Rapidly thaw frozen hNSCs in a 37°C water bath until only a small piece of ice remains.
    • d.
      Gently transfer the thawed cell suspension dropwise into a prepared tube with hNSC medium.
    • e.
      Centrifuge at 200 × g for 5 min at 25°C–28°C and remove the supernatant.
    • f.
      Resuspend the cells in 2 mL warm hNSC media containing 10 μM Y-27632 and plate into one well of a 6-well plate.
    • g.
      Shake the plate to distribute cells and transfer it to the incubator.
    • h.
      Change media (hNSC medium without Y-27632) daily.
    • i.
      hNSCs were cultured up to around Passage 5 (P5) for neuronal differentiation.

Note: It is recommended to directly differentiate neurons from hESC-derived hNSCs, i.e. without a hNSC thawing step in the middle. This way, the differentiation efficiency and the morphology of the differentiated neurons is the best.

Generation of human neurons

Inline graphicTiming: around 2 weeks

This step describes the generation of human neurons (hNeurons).

  • 6.
    Preparation of hNSCs.
    • a.
      Based on the experimental setup, place the needed number of coverslips in a 24-well plate and irradiate it >30 min under a UV lamp in the biological safety cabinet.
    • b.
      Coat 6-well and 24-well plates with Matrigel.
    • c.
      To obtain uniform neuronal networks, plate hNSCs at about P5 with a density of 1.5×104 cells/cm2.
    • d.
      Culture hNSCs in hNSC medium for 1–3 days to allow formation of cell clusters (Figure 3A).
  • 7.
    Generation of hNeurons.
    • a.
      Remove hNSC medium from the plate and gently wash the cells with Advanced DMEM/F12.
    • b.
      Use NDM medium to induce differentiation of hNSCs, and replace with fresh medium every 3 days (or 2 days). Troubleshooting 1.
    • c.
      Add 20 μg/mL Laminin on the 2nd to 3rd day of NDM medium treatment (the first time of adding NDM is the 1st day).
      • i.
        Add Laminin directly without changing the solution.
      • ii.
        Incubate 12–18 h.
      • iii.
        Remove the laminin-containing medium the next day, and continue using NDM medium.
      • iv.
        Replace with fresh medium every 3 days (or 2 days).

Note: After approximately 14 days treatment of NDM medium, the vast majority of cells will develop intact and long dendrites/axons (Figure 3A), at which point the expression of neuronal markers MAP2 and TUJ1 can be detected. Troubleshooting 2.

Inline graphicCRITICAL: As shown in Figure 3B, the proportion of MAP2 and TUJ1 double positive cells is over 90% (Figures 3B and 3C), with high purity, which can be further studied. Troubleshooting 3.

Inline graphicCRITICAL: After 21 days of culture in NDM media, the expression of synaptic proteins such as Synapsin-1 in hNeurons indicates that they have acquired mature functions (Figure 3D). This time point is designated as Day 0 for neuronal culture (D0).

Note: It is not recommended to freeze mature hNeurons, as their growth status tends to deteriorate and their purity decreases after thawing and recovery (Figure 3E).

Figure 3.

Figure 3

Characterization of differentiated hNeurons confirming maturation, high purity and senescence

(A) The morphology of cells treated with NDM culture medium for different times. Scale bars, 100 μm.

(B) Left, immunofluorescence staining of MAP2 and TUJ1 in hNeurons on day 14-in-vitro (DIV14). Scale bars, 20 μm. Right, Quantitative data for MAP2 and TUJ1 double positive cells. n = 3 biological samples. Data are represented as the mean ± SEM.

(C) Immunofluorescence staining of MAP2 and GFAP in hNeurons on day 14-in-vitro (DIV14). Scale bars, 50 μm. Quantitative data for MAP2-positive cells and GFAP-positive cells are shown on the right. n = 3 biological samples. Data are represented as the mean ± SEM.

(D) Left, immunofluorescence staining of MAP2 and Synapsin-1 (Syn-1) in hNeurons on day 21-in-vitro (DIV21). Scale bars, 20 μm. Right, Quantitative data for density of Syn-1 per 100 μm. The white arrow indicates Syn-1 puncta. n = 3 biological samples. Data are represented as the mean ± SEM.

(E) The morphology of Day 0 hNeurons after cryopreservation and thawing. The red dashed circle represents glial cells. Scale bars, 100 μm.

Long-term culture of hNeurons

Inline graphicTiming: 5 weeks

This step describes the long-term culture of hNeurons and reference time points for modeling neuronal aging.

  • 8.
    Long-term culture of hNeurons. Troubleshooting 4.
    Note: Mature hNeurons can be cultured in NDM medium for several months.
    • a.
      Assess the expression of senescence markers (including Lamin B1, Lamin B2, SA-β-Gal, Aβ (4G8), aggresome, etc.) in cultured hNeurons every 7 days.
      Inline graphicCRITICAL: On the 7th day of neuronal culture, the expression levels of Lamin B1 and Lamin B2 in hNeurons are high, the expression levels of SA-β-Gal, Aβ (4G8) and aggresome are low.
    • b.
      Define Day 7 for neuronal culture (D7) as the time point of young neurons (Figures 4A and 4B).
      Inline graphicCRITICAL: On the 21st day of neuronal culture, and relative to the hNeurons on day 7, the expression levels of Lamin B1 and Lamin B2 in hNeurons on day 21 were decreased, while the expression of SA-β-Gal, Aβ (4G8) and aggresome were increased.
    • c.
      Define Day 21 for neuronal culture (D21) as the time point of middle-aged neurons (Figures 4A and 4B).
      Inline graphicCRITICAL: On the 35th day of neuronal culture, compared with the hNeurons on day 7, the expression levels of Lamin B1 and Lamin B2 in hNeurons on day 35 were further reduced, while the expression of SA-β-Gal, Aβ (4G8) and aggresome were further increased.
    • d.
      Define Day 35 for neuronal culture (D35) as the time point of aged neurons (Figures 4A and 4B).

Figure 4.

Figure 4

Detection of senescent phenotypes in long-term cultured hNeurons

(A) From left to right, immunofluorescence staining of Lamin B1, Lamin B2, SA-β-Gal staining, immunofluorescence staining of Aβ (4G8) and aggresome staining in MAP2-marked hNeurons during prolonged culture. White arrowheads indicate the corresponding positively stained cells. Scale bars, for SA-β-Gal, 50 μm; for Lamin B1, Lamin B2, Aβ (4G8) and aggresome staining, 20 μm and 5 μm (zoomed-in images).

(B) Quantitative data for fluorescence intensity of Lamin B1 and Lamin B2, as well as the percentages of SA-β-Gal-positive hNeurons, Aβ (4G8)-positive hNeurons and aggresome-positive hNeurons as shown in (A). n = 3 biological samples. Data are represented as the mean ± SEM. Two-tailed unpaired t-test.

siRNA-mediated gene silencing in long-term cultured hNeurons

Inline graphicTiming: 3 weeks

This step describes the steps for siRNA transfection in hNeurons.

  • 9.
    siRNA-mediated gene silencing in long-term cultured hNeurons. Troubleshooting 5.
    • a.
      Purchase siRNA molecules and the negative control (NC) duplex.
    • b.
      For one well of the 6-well plate, add 6 μL Lipofectamine 3000 reagent fully mixed with 125 μL Opti-MEM medium.
    • c.
      Dilute the siRNA duplexes in 125 μL Opti-MEM medium and then mix fully.
    • d.
      Added the diluted siRNA duplexes to the diluted Lipofectamine 3000 Reagent (1:1 ratio) and then incubate for 10–15 min at 25°C–28°C.
    • e.
      Add the siRNA-lipid complex solution to hNeuron medium and replace with fresh culture medium after 6–8 h.
    • f.
      Collect the cells for qRT–PCR to measure the knockdown efficiency of target genes 48 h post-transfection.
    • g.
      Collect the cells for immunofluorescence analysis to assess the knockdown efficiency of target genes 72 h post-transfection.
    • h.
      For prolonged neuronal culture, transfect siRNA duplexes every 6 days and transfect twice continuously, that is, siRNA was transfected once on D0 and D6, respectively.
    • i.
      After two rounds of siRNA transfections, conduct phenotype characterization on D21 of cultivation (Figures 5A–5E).
  • 10.
    Perform twice siRNA mediated gene silencing in hNeurons.
    • a.
      Perform the second gene manipulation on D9 and D15 of neuronal culture.
    • b.
      Conduct phenotype testing on D21 (Figures 5F–5H).

Figure 5.

Figure 5

Example data demonstrating the efficiency of the siRNA approach

(A) Verification of knockdown efficiency by qRT–PCR at 48 h after transfection with negative control (NC) or siRNA duplexes against LMNB1 and LMNB2 (si-LB1&2) in hNeurons. n = 3 biological samples.

(B) Verification of knockdown efficiency by immunofluorescence staining of Lamin B1 at 72 h after transfection with negative control (NC) or siRNA duplexes against LMNB1 and LMNB2 in hNeurons. Scale bars, 20 μm and 5 μm (zoomed-in images). n = 3 biological samples.

(C) Verification of knockdown efficiency by immunofluorescence staining of Lamin B2 at 72 h after transfection with negative control (NC) or siRNA duplexes against LMNB1 and LMNB2 in hNeurons. Scale bars, 20 μm and 5 μm (zoomed-in images). n = 3 biological samples.

(D) SA-β-Gal staining in hNeurons transfected with NC or siRNA duplexes against LMNB1 and LMNB2. Scale bars, 50 μm. n = 3 biological samples.

(E) Aggresome staining in MAP2-marked hNeurons transfected with NC or siRNA duplexes against LMNB1 and LMNB2. White arrowheads indicate the aggresome positive cells. Scale bars, 20 μm and 5 μm (zoomed-in images). n = 3 biological samples.

(F) Verification of knockdown efficiency by qRT-PCR at 48 h after transfection with NC or siRNA duplexes against cGAS (si-cGAS) in hNeurons transfected with siRNA duplexes against LMNB1 and LMNB2. n = 3 biological samples.

(G) Verification of knockdown efficiency by immunofluorescence staining of cGAS at 72 h after transfection with NC or siRNA duplexes against cGAS in hNeurons transfected with siRNA duplexes against LMNB1 and LMNB2. Scale bars, 20 μm and 5 μm (zoomed-in images). n = 3 biological samples.

(H) SA-β-Gal staining in LMNB1 and LMNB2 knockdown hNeurons after transfection with NC or siRNA duplexes against cGAS. Scale bars, 50 μm. n = 3 biological samples.

Data are represented as the mean ± SEM. Two-tailed unpaired t-test.

Reference dosing time points in long-term cultured hNeurons

Inline graphicTiming: 5 weeks

This step describes the reference dosing time points in long-term cultured hNeurons.

  • 11.
    For long-term cultured hNeurons.
    • a.
      Culture hNeurons for 21 days and then treat with the small molecule drug.
    • b.
      Freshly add the small molecule drug to the medium each time when the medium was changed until analyses on Day 35 (Figures 6A and 6B).
  • 12.
    For hNeurons with siRNA-mediated gene silencing.
    • a.
      Transfect hNeurons twice with siRNAs and treat with the small molecule drug on Day 12.
    • b.
      Freshly add the small molecule drug to the medium each time when the medium was changed until analyses on Day 21 (Figures 6C and 6D).

Figure 6.

Figure 6

Example data demonstrating the effects of drug treatment on long-term cultured hNeurons

(A) SA-β-Gal staining in hNeurons at day 35 after treatment with vehicle or abacavir. n = 3 biological samples.

(B) Left, aggresome staining in hNeurons at day 35 after treatment with vehicle or abacavir. White arrowheads indicate the aggresome positive cells. Right, Quantitative data for the relative aggresome-positive neurons. n = 3 biological samples.

(C) SA-β-Gal staining in hNeurons transfected with siRNA duplexes against LMNB1 and LMNB2 after treatment with vehicle or abacavir. n = 3 biological samples.

(D) Left, aggresome staining in hNeurons transfected with siRNA duplexes against LMNB1 and LMNB2 after treatment with vehicle or abacavir. White arrowheads indicate the aggresome positive cells. Right, Quantitative data for the relative aggresome-positive neurons. n = 3 biological samples.

Data are represented as the mean ± SEM. Two-tailed unpaired t-test.

Expected outcomes

Based on the method we described, highly pure human neurons (hNeurons) express synaptic proteins on Day 0 (D0), as illustrated in Figure 3D. Notably, during prolonged culture, there was an increase in SA-β-Gal activity, accumulation of aggresomes, and deposition of Aβ. More importantly, there was a reduction in the expression of type-B lamins proteins, followed by a reduction in H3K9me3 levels, reactivation of endogenous retroviruses (ERVs), activation of the cGAS pathway, and upregulation of downstream interferon (IFN) signaling genes in senescent hNeurons.13,14,15,16,17,18,19,20,21,22,23

For additional quality control parameters and representative images related to the evaluation of long-term cultured neuronal aging models and gene manipulation in neurons, please refer to our previous publications.1,24

Quantification and statistical analysis

All results are presented as the mean ± SEM. The data were statistically analyzed using a two-tailed Student’s t-test to compare differences with PRISM software. p values < 0.05 were considered statistically significant. p values are presented in the figures.

Limitations

Neurons are particularly vulnerable to the aging process of the brain and neurodegenerative diseases that are linked to brain aging.25,26,27,28 Due to technical constraints, while the in vitro neuronal model can simulate aspects of neuronal aging and is useful for drug evaluation, it cannot fully replicate the complex in vivo neuronal microenvironment.29,30,31 In the future, research utilizing human organoids and in vivo models will be essential to better understand the regulatory mechanisms underlying neuronal aging.32,33,34,35,36,37,38,39,40,41,42,43,44,45,46

hiPSC and H1 hESC can also successfully differentiate into neurons according to this protocol.

Troubleshooting

Problem 1

Following the initial supplementation with NDM medium, the cells exhibited significant apoptosis (related to Step 7b).

Potential solution

  • Check if the storage status of Matrigel has failed after repeated freeze-thaw cycles. If so, replace it with a new Matrigel.

  • Confirm the constituents of NDM medium, with particular attention to the final concentration of the critical factor like BDNF, to ensure its precise inclusion.

Problem 2

Differentiated hNeurons are impure, with a high proportion (over 20%) of non-neurons (related to Step 7d).

Potential solution

  • The condition of hESCs is pivotal to the successful induction of neuronal differentiation.47,48,49 Before initial differentiation, adjust the growth state of hESCs to the best.

  • hNeurons were treated with 4 μM cytosine arabinoside to inhibit the growth of glia.50

Problem 3

Variability in neuronal differentiation efficiency among different precursor cell lines (related to Step 7e).

Potential solution

  • For assessing cell line variability, we tested the H1 hESC line and hiPSC and found that our neural differentiation system performs consistently across both the hESC H1 line and hiPSC.

The differentiation efficiency of neurons derived from both the H1 hESC line and hiPSC can reach over 90%.

Problem 4

hNeurons that have successfully differentiated undergo extensive apoptosis during long-term cultivation (related to Step 8).

Potential solution

  • Perform weekly mycoplasma testing on neuronal supernatants to prevent contamination.

  • To mitigate the risk of contamination affecting long-term neuronal cultivation and potentially hindering experimental progress, it is advisable to differentiate multiple plates of neurons concurrently in separate incubators.

Problem 5

The efficiency of siRNA transfection is low (related to Step 9).

Potential solution

  • Confirm that the siRNA sequence used is valid and try several more siRNA sequences.

  • Use Lipofectamine RNAiMAX (Thermo Fisher Scientific, Cat# 13778100) to improve transfection efficiency, please refer to the product manual for specific usage methods.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Guang-Hui Liu (ghliu@ioz.ac.cn).

Technical contact

For further inquiries and to obtain the details of the protocol, please contact the technical contact, Guang-Hui Liu (ghliu@ioz.ac.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

This study did not generate/analyze datasets/code.

Acknowledgments

We are grateful to Lei Bai, Jing Lu, Luyang Tian, Xiangmei Jin, Shikun Ma, Ruijun Bai, Shangyi Qiao, Qun Chu, Ying Yang, Xiuping Li, and Jing Chen for administrative assistance. We are grateful to Linguo Cai for her help in the cell culture. This work was supported by the National Key Research and Development Program of China (the STI2030-Major Projects-2021ZD0202400, 2020YFA0804000, 2022YFA1103700), the National Natural Science Foundation of China (82488301, 82125011, 92168201, and 82361148131), the National Natural Science Foundation of China (82330044, 32341001, 32121001, 82192863, 82361148130, and 8231101626), the Program of the Beijing Natural Science Foundation (JQ24044, Z240018, and Z230011), Shenzhen Medical Research Fund (C2406001), CAS Project for Young Scientists in Basic Research (YSBR-076 and YSBR-012), the Informatization Plan of Chinese Academy of Sciences (CAS-WX2022SDC-XK14), New Cornerstone Science Foundation through the XPLORER PRIZE (2021-1045), Beijing Municipal Public Welfare Development and Reform Pilot Project for Medical Research Institutes (JYY2023-13), CAS Youth Interdisciplinary Team, Space Medical Experiment Project of CMSP (HYZHXMH01012), Key Laboratory of Alzheimer’s Disease of Zhejiang Province (ZJAD-2024001), Initiative Scientific Research Program, Institute of Zoology, CAS (2023IOZ0202), Excellent Young Talents Program of Capital Medical University (12300927), and Excellent Young Talents Training Program for the Construction of Beijing Municipal University Teacher Team (BPHR202203105).

Author contributions

J.Q., G.-H.L., W.Z., and S.W. conceived the study. H.Z. performed the experiments. H.Z., S.S., J.C.I.B., G.-H.L., S.W., W.Z., and J.Q. wrote, reviewed, and edited the manuscript.

Declaration of interests

J.C.I.B. is an employee of Altos Labs.

Contributor Information

Guang-Hui Liu, Email: ghliu@ioz.ac.cn.

Si Wang, Email: wangsi@xwh.ccmu.edu.cn.

Weiqi Zhang, Email: zhangwq@big.ac.cn.

Jing Qu, Email: qujing@ioz.ac.cn.

References

  • 1.Zhang H., Li J., Yu Y., Ren J., Liu Q., Bao Z., Sun S., Liu X., Ma S., Liu Z., et al. Nuclear lamina erosion-induced resurrection of endogenous retroviruses underlies neuronal aging. Cell Rep. 2023;42 doi: 10.1016/j.celrep.2023.112593. [DOI] [PubMed] [Google Scholar]
  • 2.Tang X.-Y., Wang D., Zhang X.-Y., Xu M., Liu Y. Optimized protocol for analysis of neural stem proliferation in human-pluripotent-stem-cell-derived cerebral organoids. STAR Protoc. 2023;4 doi: 10.1016/j.xpro.2023.102169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ling C., Liu Z., Song M., Zhang W., Wang S., Liu X., Ma S., Sun S., Fu L., Chu Q., et al. Modeling CADASIL vascular pathologies with patient-derived induced pluripotent stem cells. Protein Cell. 2019;10:249–271. doi: 10.1007/s13238-019-0608-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Schneider C.A., Rasband W.S., Eliceiri K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods. 2012;9:671–675. doi: 10.1038/nmeth.2089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Liang C., Liu Z., Song M., Li W., Wu Z., Wang Z., Wang Q., Wang S., Yan K., Sun L., et al. Stabilization of heterochromatin by CLOCK promotes stem cell rejuvenation and cartilage regeneration. Cell Res. 2021;31:187–205. doi: 10.1038/s41422-020-0385-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bi S., Liu Z., Wu Z., Wang Z., Liu X., Wang S., Ren J., Yao Y., Zhang W., Song M., et al. SIRT7 antagonizes human stem cell aging as a heterochromatin stabilizer. Protein Cell. 2020;11:483–504. doi: 10.1007/s13238-020-00728-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wang W., Zheng Y., Sun S., Li W., Song M., Ji Q., Wu Z., Liu Z., Fan Y., Liu F., et al. A genome-wide CRISPR-based screen identifies KAT7 as a driver of cellular senescence. Sci. Transl. Med. 2021;13 doi: 10.1126/scitranslmed.abd2655. [DOI] [PubMed] [Google Scholar]
  • 8.Liang C., Ke Q., Liu Z., Ren J., Zhang W., Hu J., Wang Z., Chen H., Xia K., Lai X., et al. BMAL1 moonlighting as a gatekeeper for LINE1 repression and cellular senescence in primates. Nucleic Acids Res. 2022;50:3323–3347. doi: 10.1093/nar/gkac146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Liu G.-H., Qu J., Suzuki K., Nivet E., Li M., Montserrat N., Yi F., Xu X., Ruiz S., Zhang W., et al. Progressive degeneration of human neural stem cells caused by pathogenic LRRK2. Nature. 2012;491:603–607. doi: 10.1038/nature11557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zhang W., Wan H., Feng G., Qu J., Wang J., Jing Y., Ren R., Liu Z., Zhang L., Chen Z., et al. SIRT6 deficiency results in developmental retardation in cynomolgus monkeys. Nature. 2018;560:661–665. doi: 10.1038/s41586-018-0437-z. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang X., Liu Z., Liu X., Wang S., Zhang Y., He X., Sun S., Ma S., Shyh-Chang N., Liu F., et al. Telomere-dependent and telomere-independent roles of RAP1 in regulating human stem cell homeostasis. Protein Cell. 2019;10:649–667. doi: 10.1007/s13238-019-0610-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cheng F., Wang S., Song M., Liu Z., Liu P., Wang L., Wang Y., Zhao Q., Yan K., Chan P., et al. DJ-1 is dispensable for human stem cell homeostasis. Protein Cell. 2019;10:846–853. doi: 10.1007/s13238-019-00659-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cai Y., Song W., Li J., Jing Y., Liang C., Zhang L., Zhang X., Zhang W., Liu B., An Y., et al. The landscape of aging. Sci. China Life Sci. 2022;65:2354–2454. doi: 10.1007/s11427-022-2161-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Bao H., Cao J., Chen M., Chen M., Chen W., Chen X., Chen Y., Chen Y., Chen Y., Chen Z., et al. Biomarkers of aging. Sci. China Life Sci. 2023;66:893–1066. doi: 10.1007/s11427-023-2305-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wu Z., Qu J., Liu G.-H. Roles of chromatin and genome instability in cellular senescence and their relevance to ageing and related diseases. Nat. Rev. Mol. Cell Biol. 2024;25:979–1000. doi: 10.1038/s41580-024-00775-3. [DOI] [PubMed] [Google Scholar]
  • 16.Ma S., Ji Z., Zhang B., Geng L., Cai Y., Nie C., Li J., Zuo Y., Sun Y., Xu G., et al. Spatial transcriptomic landscape unveils immunoglobin-associated senescence as a hallmark of aging. Cell. 2024;187:7025–7044.e34. doi: 10.1016/j.cell.2024.10.019. [DOI] [PubMed] [Google Scholar]
  • 17.Dannert A., Klimmt J., Cardoso Gonçalves C., Crusius D., Paquet D. Reproducible and scalable differentiation of highly pure cortical neurons from human induced pluripotent stem cells. STAR Protoc. 2023;4 doi: 10.1016/j.xpro.2023.102266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jia Y.J., Wang J., Ren J.R., Chan P., Chen S., Chen X.C., Chhetri J.K., Guo J., Guo Q., Jin L., et al. A framework of biomarkers for brain aging: a consensus statement by the Aging Biomarker Consortium. Life Med. 2023;2 doi: 10.1093/lifemedi/lnad017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang H., Li J., Ren J., Sun S., Ma S., Zhang W., Yu Y., Cai Y., Yan K., Li W., et al. Single-nucleus transcriptomic landscape of primate hippocampal aging. Protein Cell. 2021;12:695–716. doi: 10.1007/s13238-021-00852-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang W., Qu J., Liu G.H., Belmonte J.C.I. The ageing epigenome and its rejuvenation. Nat. Rev. Mol. Cell Biol. 2020;21:137–150. doi: 10.1038/s41580-019-0204-5. [DOI] [PubMed] [Google Scholar]
  • 21.Zhao Y., Simon M., Seluanov A., Gorbunova V. DNA damage and repair in age-related inflammation. Nat. Rev. Immunol. 2023;23:75–89. doi: 10.1038/s41577-022-00751-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gorbunova V., Seluanov A., Mita P., McKerrow W., Fenyö D., Boeke J.D., Linker S.B., Gage F.H., Kreiling J.A., Petrashen A.P., et al. The role of retrotransposable elements in ageing and age-associated diseases. Nature. 2021;596:43–53. doi: 10.1038/s41586-021-03542-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wilson D.M., III, Cookson M.R., Van Den Bosch L., Zetterberg H., Holtzman D.M., Dewachter I. Hallmarks of neurodegenerative diseases. Cell. 2023;186:693–714. doi: 10.1016/j.cell.2022.12.032. [DOI] [PubMed] [Google Scholar]
  • 24.Yang Y., Lu X., Liu N., Ma S., Zhang H., Zhang Z., Yang K., Jiang M., Zheng Z., Qiao Y., et al. Metformin decelerates aging clock in male monkeys. Cell. 2024;187:6358–6378.e29. doi: 10.1016/j.cell.2024.08.021. [DOI] [PubMed] [Google Scholar]
  • 25.Rose E.P., Osterberg V.R., Gorbunova V., Unni V.K. Alpha-synuclein modulates the repair of genomic DNA double-strand breaks in a DNA-PKcs-regulated manner. Neurobiol. Dis. 2024;201 doi: 10.1016/j.nbd.2024.106675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Herdy J.R., Mertens J., Gage F.H. Neuronal senescence may drive brain aging. Science. 2024;384:1404–1406. doi: 10.1126/science.adi3450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lautrup S., Sinclair D.A., Mattson M.P., Fang E.F. NAD+ in Brain Aging and Neurodegenerative Disorders. Cell Metab. 2019;30:630–655. doi: 10.1016/j.cmet.2019.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mattson M.P., Arumugam T.V. Hallmarks of Brain Aging: Adaptive and Pathological Modification by Metabolic States. Cell Metab. 2018;27:1176–1199. doi: 10.1016/j.cmet.2018.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Marei H.E., Khan M.U.A., Hasan A. Potential use of iPSCs for disease modeling, drug screening, and cell-based therapy for Alzheimer’s disease. Cell. Mol. Biol. Lett. 2023;28:98. doi: 10.1186/s11658-023-00504-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Struzyna L.A., Watt M.L. The Emerging Role of Neuronal Organoid Models in Drug Discovery: Potential Applications and Hurdles to Implementation. Mol. Pharmacol. 2021;99:256–265. doi: 10.1124/molpharm.120.000142. [DOI] [PubMed] [Google Scholar]
  • 31.Sun S., Li J., Wang S., Li J., Ren J., Bao Z., Sun L., Ma X., Zheng F., Ma S., et al. CHIT1-positive microglia drive motor neuron ageing in the primate spinal cord. Nature. 2023;624:611–620. doi: 10.1038/s41586-023-06783-1. [DOI] [PubMed] [Google Scholar]
  • 32.Wu S., Wang D., Liu Y. Brain assembloid: a human model for neural circuits research. Life Med. 2023;2:lnad031. doi: 10.1093/lifemedi/lnad031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhang Y., Zhang Q., Hou Y., Wang R., Wang Y. Comparative functional RNA editomes of neural differentiation from human PSCs. Life Med. 2022;1:221–235. doi: 10.1093/lifemedi/lnac027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Feng S., Zhang T., Ke W., Xiao Y., Guo Z., Lu C., Li S., Guo Z., Liu Y., Tan G., et al. The long-term survival and functional maturation of human iNPC-derived neurons in the basal forebrain of cynomolgus monkeys. Life Med. 2022;1:196–206. doi: 10.1093/lifemedi/lnac008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Xiang Y., Park I.-H. Brain organoids: from unguided to regionalized to nucleus-specific. Life Med. 2024;3 doi: 10.1093/lifemedi/lnae014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Piao X., Li D., Liu H., Guo Q., Yu Y. Advances in gene and cellular therapeutic approaches for Huntington’s disease. Protein Cell. 2024 doi: 10.1093/procel/pwae042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.De Los Angeles A., Wu J. New concepts for generating interspecies chimeras using human pluripotent stem cells. Protein Cell. 2022;13:234–238. doi: 10.1007/s13238-021-00880-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Birtele M., Lancaster M., Quadrato G. Modelling human brain development and disease with organoids. Nat. Rev. Mol. Cell Biol. 2024 doi: 10.1038/s41580-024-00804-1. [DOI] [PubMed] [Google Scholar]
  • 39.Kelley K.W., Pașca S.P. Human brain organogenesis: Toward a cellular understanding of development and disease. Cell. 2022;185:42–61. doi: 10.1016/j.cell.2021.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Karmirian K., Holubiec M., Goto-Silva L., Fernandez Bessone I., Vitória G., Mello B., Alloatti M., Vanderborght B., Falzone T.L., Rehen S. In: Alzheimer’s Disease: Methods and Protocols. Chun J., editor. Springer US; 2023. Modeling Alzheimer’s Disease Using Human Brain Organoids; pp. 135–158. [DOI] [PubMed] [Google Scholar]
  • 41.Antón-Bolaños N., Faravelli I., Faits T., Andreadis S., Kastli R., Trattaro S., Adiconis X., Wei A., Sampath Kumar A., Di Bella D.J., et al. Brain Chimeroids reveal individual susceptibility to neurotoxic triggers. Nature. 2024;631:142–149. doi: 10.1038/s41586-024-07578-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.He Z., Dony L., Fleck J.S., Szałata A., Li K.X., Slišković I., Lin H.-C., Santel M., Atamian A., Quadrato G., et al. An integrated transcriptomic cell atlas of human neural organoids. Nature. 2024;635:690–698. doi: 10.1038/s41586-024-08172-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Dao L., You Z., Lu L., Xu T., Sarkar A.K., Zhu H., Liu M., Calandrelli R., Yoshida G., Lin P., et al. Modeling blood-brain barrier formation and cerebral cavernous malformations in human PSC-derived organoids. Cell Stem Cell. 2024;31:818–833.e11. doi: 10.1016/j.stem.2024.04.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Hendriks D., Pagliaro A., Andreatta F., Ma Z., van Giessen J., Massalini S., López-Iglesias C., van Son G.J.F., DeMartino J., Damen J.M.A., et al. Human fetal brain self-organizes into long-term expanding organoids. Cell. 2024;187:712–732.e38. doi: 10.1016/j.cell.2023.12.012. [DOI] [PubMed] [Google Scholar]
  • 45.Chiaradia I., Imaz-Rosshandler I., Nilges B.S., Boulanger J., Pellegrini L., Das R., Kashikar N.D., Lancaster M.A. Tissue morphology influences the temporal program of human brain organoid development. Cell Stem Cell. 2023;30:1351–1367.e10. doi: 10.1016/j.stem.2023.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Atamian A., Birtele M., Hosseini N., Nguyen T., Seth A., Del Dosso A., Paul S., Tedeschi N., Taylor R., Coba M.P., et al. Human cerebellar organoids with functional Purkinje cells. Cell Stem Cell. 2024;31:39–51.e6. doi: 10.1016/j.stem.2023.11.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Liu Y., Wang J., Südhof T.C., Wernig M. Efficient generation of functional neurons from mouse embryonic stem cells via neurogenin-2 expression. Nat. Protoc. 2023;18:2954–2974. doi: 10.1038/s41596-023-00863-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Pahl M.C., Doege C.A., Hodge K.M., Littleton S.H., Leonard M.E., Lu S., Rausch R., Pippin J.A., De Rosa M.C., Basak A., et al. Cis-regulatory architecture of human ESC-derived hypothalamic neuron differentiation aids in variant-to-gene mapping of relevant complex traits. Nat. Commun. 2021;12:6749. doi: 10.1038/s41467-021-27001-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Nazim M., Lin C.-H., Feng A.-C., Xiao W., Yeom K.-H., Li M., Daly A.E., Tan X., Vu H., Ernst J., et al. Alternative splicing of a chromatin modifier alters the transcriptional regulatory programs of stem cell maintenance and neuronal differentiation. Cell Stem Cell. 2024;31:754–771.e6. doi: 10.1016/j.stem.2024.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Muguruma K., Nishiyama A., Kawakami H., Hashimoto K., Sasai Y. Self-Organization of Polarized Cerebellar Tissue in 3D Culture of Human Pluripotent Stem Cells. Cell Rep. 2015;10:537–550. doi: 10.1016/j.celrep.2014.12.051. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

This study did not generate/analyze datasets/code.


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES