METTL3 is aberrantly expressed in endometriosis and suppresses proliferation, invasion, and migration of endometrial stromal cells

Abstract

Endometriosis (EM) is one of the leading gynecological disorders, and associated with excessive functioning of endometrial stromal cells (ESCs). The current study was conducted to determine the expression and role of methyltransferase‐like 3 (METTL3) in the proliferation, invasion, and migration of ESCs in EM. The documented expression levels of METTL3, microRNA (miR)‐21‐5p, and WNT inhibitory factor 1 (WIF1) in eutopic (Eut) and ectopic (Ect) endometrial tissues and ESCs were determined by a combination of real‐time quantitative polymerase chain reaction and Western blot assay. After transfection with pcDNA3.1‐METTL3, miR‐21‐5p mimic, and WIF1 small interfering RNA, cell counting kit‐8, colony formation, and Transwell assays were performed in the Ect ESCs (Ect‐ESCs). Subsequently, the binding of miR‐21‐5p to METTL3 was analyzed, along with quantification of the N6‐methyladenosine (m6A) level, the enrichments of METTL3 and m6A on WIF1, and the mRNA stability of WIF1. In our findings, METTL3 was downregulated in the EM tissues and cells. METTL3 overexpression intrinsically reduced the proliferation, invasion, and migration of Ect‐ESCs. miR‐21‐5p inhibited the METTL3 expression while METTL3 enhanced the mRNA stability and expression of WIF1 via m6A modification. Additionally, a negative correlation of METTL3 was identified with miR‐21‐5p along with a positive correlation with the WIF1 mRNA in EM tissues. The miR‐21‐5p overexpression or WIF1 downregulation enhanced the proliferation, invasion, and migration of Ect‐ESCs. Collectively, miR‐21‐5p inhibited the METTL3‐mediated m6A modification and mRNA stability of WIF1, thereby facilitating the proliferation, invasion, and migration of Ect‐ESCs.

1. INTRODUCTION

Endometriosis (EM) is a serious reproductive condition among females, diagnosed by the presence of endometrial tissues outside of the uterus. ¹ EM is a primary cause of chronic pelvic pain, infertility, and low quality of life among women of reproductive age. ² Although EM is classified as a benign gynecological disorder, it is characteristic of malignant biological behaviors such as invasion, migration, metastasis, and reoccurrence. ³ , ⁴ Endometrial stromal cells (ESCs) from EM patients or animals have elicited increased invasive and migratory properties as a response to an array of hormones, growth factors, chemokines, inflammatory mediators, and pathways. ⁵ Encouragingly, pharmacological regimens which principally target the pathways of migration and invasion are a promising strategy for EM treatment but warrant more clinical validation. ⁶ In light of the aforementioned context, it is imperative to explore the molecular landscape of proliferation, invasion, and migration of ESCs in EM.

N6‐methyladenosine (m6A) modification, a dynamic and reversible RNA modification, elicits fundamental functionality in female infertility and disorders of the reproductive system, including EM. ⁷ , ⁸ The functional effects of m6A are induced by a combination of dynamic and interactive m6A regulators, such as writers including methyltransferase‐like 3 (METTL3), METTL14, WTAP, erasers including FTO and ALKBH5, and readers including the YTH family. ⁹ As an m6A methyltransferase, METTL3 can essentially catalyze m6A modification of downstream genes to further improve the stability and translation of messenger RNAs (mRNAs). ¹⁰ , ¹¹ Notably, the depletion of METTL3 can facilitate invasion and migration of ESCs, thus contributing to EM progression. ¹² Currently, a limited literature exists about the molecular mechanism of METTL3 in EM.

MicroRNAs (miRNAs), a class of non‐coding transcripts, elicits application for the regulation of EM progression, including cell proliferation, adhesion, migration, invasion, inflammation, and the hormonal production of estrogen and progesterone. ¹³ One such miRNA miR‐21‐5p, has been identified with an elevated level and expression in the endometrium of EM patients and prevents the apoptosis of ESCs. ¹⁴ Additionally, the ability of miRNAs to serve as vital inhibitors of mRNA translation and inducers of mRNA degradation via binding to the 3′ untranslated regions of target mRNAs has been previously documented ¹⁵ and our bioinformatics data predicted miR‐21‐5p as an upstream miRNA of METTL3, thus speculating a regulatory function of miR‐21‐5p in modulating the METTL3 expression. Furthermore, WNT inhibitory factor 1 (WIF1), an inhibitor of WNT signaling, exerts functions on tumorigenesis and embryonic development. ¹⁶ Previously, the functionality of WIF1 as a negative regulator has been identified of ESC growth and mobility in EM. ¹⁷ An existing study elicited that m6A modification could radically influence WIF1 translation. ¹⁸ Collectively, the underlying interaction of METTL3 and miR‐21‐5p/WIF1 has been speculated to modulate the proliferation, invasion, and migration of ESCs.

In light of the aforementioned evidence, we speculated the function of the miR‐21‐5p/METTL3/WIF1 axis in the proliferation, invasion, and migration of ESCs in EM. Consequently, we sought to determine the molecular mechanism of METTL3 in ESC behaviors and provide a novel rationale for the development of EM treatment.

2. MATERIALS AND METHODS

2.1. Tissue collection

Ect endometrial tissues from a total of 45 EM patients who underwent hysterectomy were isolated, with addition isolation of Eut endometrial tissues from these patients as control. After tissue collection, the samples were immediately preserved in liquid nitrogen. The inclusion criteria for the patients were as follows: included patients were at an average age of 38.60 ± 7.38 years, had normal menstrual cycles (21–35 days), and were not administered any steroid hormone therapy at least 6 months prior to surgery, without prior history of any malignant disease, immune disease, inflammatory disease, surgical disease, and estrogen‐dependent disease. The included patient signed informed consent prior to enrolment. The acquisition of clinical samples was conducted with approval of the Ethics Committee of local hospital and in conformity with the Declaration of Helsinki.

2.2. Cell separation and characterization

Eut‐ESCs or Ect‐ESCs were separated from the Eut or Ect endometrial tissues based on an existing protocol. ¹⁹ Briefly, the endometrial tissues were shredded and detached using 0.25% type 1 collagenase (Sigma, St. Louis, MO, USA) for 60 min. Next, the detached tissue specimens were filtered using a 100 μm filter for removal of any undetached tissues, followed by centrifugation at 1000g for 5 min to isolate the cell suspension. Next, the cells were cultured in an F12/Dulbecco's modified Eagle medium (DMEM) supplemented with a combination of 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 mg/L streptomycin (Solarbio, Beijing, China) in an incubator at 37°C with 5% CO₂. The cells were passaged to attain 80%–90% cell confluence. The medium was replaced every 2 days.

The cells were fixed using 4% paraformaldehyde for 15 min, washed with phosphate buffer saline (PBS), and cultured with the corresponding antibody against Cytokeratin 19 (CK19; ab52625, Abcam, Cambridge, MA, USA) or Vimentin (ab92547, Abcam) at 4°C overnight. Next, the experimental cells were cultured with the secondary antibody IgG (ab6721, Abcam) at 37°C for 30 min. Subsequently, cells were subject to development with diaminobenzidine (Sigma), counter‐staining with hematoxylin (Beyotime, Shanghai, China) for 1 min, and observation and documentation of findings under an optical microscope (Eclipse E200, Nikon Co., Tokyo, Japan).

2.3. Cell treatment

pcDNA3.1‐METTL3 (oe‐METTL3), pcDNA3.1 empty vector (oe‐NC), three small interfering (si) RNAs of WIF1 (si‐WIF1#1, si‐WIF1#2, si‐WIF1#3), and negative control siRNA (si‐NC) were provided by from GenePharma (Shanghai, China). Additionally, miR‐21‐5p mimic (miR‐mimic) and mimic control (mimic‐NC), and miR‐21‐5p inhibitor (miR‐inhi) and inhibitor control (inhi‐NC) were acquired from RiboBio (Guangzhou, China). Upon attaining 80% Ect‐ESC confluence, the Ect‐ESCs were transfected with the aforementioned expression vectors using Lipofectamine 3000 (Invitrogen, CA, USA). The subsequent experimentation was performed 48 h after cell transfection.

2.4. Cell counting kit‐8 (CCK‐8) assay

Cell proliferation was measured using the CCK‐8 assay kits (96992, Sigma). Next, the Ect‐ESCs were seeded in 96‐well plates at a density of 1 × 10³ cells/well. On days 1, 2, and 3 of cell incubation, each well was supplemented with 10 μl of CCK‐8 reagent for subsequent culture at 37°C for 4 h. The optical density at a wavelength of 450 nm was quantified using a microplate reader (Bio‐Rad, Hercules, CA, USA).

2.5. Colony formation assay

Ect‐ESCs were detached with 1% trypsin and seeded into the 6‐well plates (500 cells/well). After 14 days of cell culture, the Ect‐ESCs were fixed using methanol for 15 min and stained with crystal violet for another 15 min at room temperature. Additionally, the Ect‐ESCs were observed and documented under an Olympus Ckx53 inverted phase‐contrast microscope with counting and estimation of the number of colonies using the ImageJ software (1.48 V).

2.6. Transwell assay

The Transwell assay was performed using the Transwell chambers (Corning Corporation, Corning, NY, USA). In the cell invasion assay, Matrigel was diluted with FBS‐free DMEM at a ratio of 1:3 and loaded into the apical chamber, while Matrigel was not supplemented for the cell migration assay. Next, a concentration of 8 × 10⁴ Ect‐ESCs were resuspended using 200 μl serum‐free DMEM and then seeded in the apical chamber, after which the basolateral chamber was supplemented with 600 μl medium containing 20% FBS. After 24 h, the cell suspension in the chamber was removed, and the chamber was rinsed twice with sterile PBS. The nonmigrative and noninvasive cells were removed using swabs. The remaining cells were fixed using 4% paraformaldehyde for 30 min and subsequently stained with 0.1% crystal violet for another 30 min at room temperature. The stained cells were observed under an optical microscope (Olympus Corporation, Tokyo, Japan).

2.7. Assessment of m6A level

The m6A level in the total RNA content was assessed using the EpiQuik m6A RNA methylation quantification kit (Epigentek, Farmingdale, NY, USA). Simply, the RNA content was added into the band wells using the RNA high‐binding solution. Next, the capture antibody solution and detection antibody solution were adjusted to appropriate concentrations and supplemented into the wells, respectively. Subsequently, the absorbance value at a wavelength of 450 nm was analyzed using a microplate reader (Bio‐Rad) and the m6A level was quantified based on the colorimetric method. The experimental data was estimated based on the relative quantification method.

2.8. RNA immunoprecipitation (RIP) assay

The RIP assay was performed in strict accordance with the provided instructions of the EZ‐Magna RIP kit (Millipore, Bedford, MA, USA). Next, the Ect‐ESCs were lysed in complete RIP lysis solution. The cell extracts were cultured with the protein A/G agarose beads conjugated with the corresponding METTL3 antibody (ab195352, Abcam) or control IgG (ab133470, Abcam) at 4°C for 2 h. After rinsing the beads, the protein content was isolated by incubation with proteinase‐K, followed by quantitative analysis of the purified RNAs.

In the m6A RNA immunoprecipitation (MeRIP) assay, m6A‐modified WIF1 was pulled down using m6A antibody (ab151230, Abcam). The total RNA content was extracted from Ect‐ESCs using the TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Inc.). Then, 500 μl of MeRIP buffer (150 mM NaCl, 10 mM tri‐HCl, pH 7.5, 0.1% NP‐40) was added to 100 μg of the RNA content followed by a short incubation with IgG, after which the anti‐IgG antibody was removed using the protein A/G beads. Next, the precleaned lysis solution was transferred to a new tube for incubation with IgG or m6A antibody at 4°C with vigorous agitation for 2 h. Furthermore, the binding RNA content was extracted using the TRIzol reagent for subsequent analysis.

2.9. RNA stability detection

To examine the RNA stability in Ect‐ESCs, the experimental cells were incubated with actinomycin D (Act‐D; 10 μg/ml; Sigma, USA). The mRNA level of WIF1 was determined at separate periods of 3, 6, and 9 h after Act‐D treatment.

2.10. RNA pull‐down assay

RNA pull‐down assay was performed using the Magna RIP kit (Millipore [China] Co., Ltd, Shanghai, China). The Ect‐ESCs were transfected with bio‐miR‐21‐5p or bio‐NC using Lipofectamine 3000 (Invitrogen). The cells were lysed and the lysis solution was collected 48 h after cell transfection. Then, the lysis solution was incubated with streptavidin magnetic beads, followed by detection of the immunoprecipitated RNAs.

2.11. Dual‐luciferase assay

Upstream miRNAs of METTL3 were predicted using a combination of the Starbase website (https://starbase.sysu.edu.cn/agoClipRNA.php?source=mRNA) ²⁰ and Targetscan website (https://www.targetscan.org/vert_71/). ²¹ In strict accordance with the binding site of miR‐21‐5p and METTL3 obtained from the Starbase website, the wild type (WT) and mutant type (MUT) of METTL3 were constructed and cloned into the pGL3 vectors (Promega, Madison, WI, USA). Next, the Ect‐ESCs were seeded into 96‐well plates at a density of 1 × 10⁴ cells/well. WT METTL3 or MUT METTL3 was transfected using the miR‐21‐5p mimic or mimic control into the Ect‐ESCs. After 48 h, the luciferase activity was quantified using the luciferase determination kit (Promega).

2.12. Real‐time quantitative polymerase chain reaction (RT‐qPCR)

The experimental cells and tissues (N = 45) were treated using the TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Inc.) to extract the total RNA content. In strict accordance with the provided instructions, the RNA content was reverse‐transcribed into the complementary DNA (cDNA) using the cDNA synthesis kit (Takara Biotechnology, Dalian, China). The cDNA was then examined using the 7500 ABI Real‐Time PCR (Applied Biosystems, Thermo Fisher Scientific, Inc.) and the SYBR Green kit (Takara Biotechnology). With GAPDH and U6 ¹⁴ as internal references, the relative gene expression was quantified based on the 2^−ΔΔCt method. ²² Primers are listed in Table 1.

TABLE 1.

PCR primers

Gene	Sequence (5′‐3′)
METTL3	F: TGGGGGTATGAACGGGTAGA
	R: TGGTTGAAGCCTTGGGGATT
miR‐21‐5p	F: GCTGCGGTAGCTTATCAGACT
	R: CTCAACTGGTGTCGTGGAGTC
WIF1	F: GCACAACAGAGAATGCCAGC
	R: TTTATCCAGGGAGCGCAAGG
GAPDH	F: GATGCTGGCGCTGAGTACG
	R: GCTAAGCAGTTGGTGGTGC
U6	F: CTCGCTTCGGCAGCACATA
	R: AACGATTCACGAATTTGCGT

2.13. Western blot assay

The total protein content was extracted from the tissues (N = 6) or cells using the radio‐immunoprecipitation assay buffer (Beyotime). Next, the protein concentration was determined using the bicinchoninic acid protein determination kit (Beyotime). After a regimen of 10% sodium dodecyl sulfate‐polyacrylamide gel electrophoresis, an equal volume of protein sample was transferred onto the polyvinyl difluoride membranes (Millipore). In Tris‐buffered saline containing 0.1% Tween‐20, the membranes were treated with 5% nonfat milk for 1 h of blockade and cultured with the corresponding primary antibodies against METTL3 (ab195352, at a dilution ratio of 1:1000, Abcam), WIF1 (ab155101, 1:2000, Abcam), and GAPDH (ab9485, at a dilution ratio of 1:2500, Abcam) at 4°C overnight and then incubated with the secondary antibody (at a dilution ratio of 1:2000, ab205718, Abcam) for 1 h. After a rinse, the membranes were incubated with the enhanced chemiluminescence reagent (Millipore) and visualized using the detection system. Eventually, the grayscale of protein bands was analyzed using the ImageJ software.

2.14. Statistical analysis

All data were processed using a combination of the SPSS21.0 software (IBM Corp, Armonk, NY, USA) and GraphPad Prism 8.0 software (GraphPad Software Inc., San Diego, CA, USA) for statistical analysis and graphing. The experimental data conformed to normal distribution and homogeneity of variance. Pairwise comparisons of data were analyzed based on the t test and multigroup comparisons of data were analyzed based on one‐way or two‐way analysis of variance (ANOVA), followed by Tukey's multiple comparison test. In all statistical references, a value of p < 0.05 was indicative of statistically significant differences while a value of p < 0.01 was indicative of highly statistically significant differences.

3. RESULTS

3.1. METTL3 is downregulated in Ect endometrial tissues and ESCs

A poor expression of METTL3 has been reported in EM. ¹² First, we determined the expression levels of METTL3 in tissues and observed the down‐regulation of METTL3 in Ect endometrial tissues (p < 0.01, Figure 1A,B). Next, the ESCs were separated and characterized by immunocytochemistry, which suggested that the two types of ESCs were both negative for CK19 and positive for vimentin (Figure 1C), thereby indicating the successful isolation of ESCs. Besides, the determined expression levels of METTL3 in Ect‐ESCs were lower than the levels in Eut‐ESCs (p < 0.05, Figure 1D,E).

FIGURE 1.

METTL3 is downregulated in Ect endometrial tissues and ESCs. (A,B) METTL3 expression levels in Eut and Ect endometrial tissues were determined by RT‐qPCR (N = 45) and Western blot assay (N = 6). (C) Expression levels of cytokeratin 19 and vimentin were determined by immunocytochemistry. (D,E) METTL3 expression levels in Eut‐ESCs and Ect‐ESCs were determined by RT‐qPCR and Western blot assay. Cell experiments were performed three times independently. Data in figures B, D, and E were expressed as mean ± standard deviation. Pairwise comparisons in panels A–D were analyzed using the t test. * p < 0.05, ** p < 0.01

3.2. METTL3 overexpression restrains the proliferation, invasion, and migration of Ect‐ESCs

Proliferation, invasion, and migration of ESCs are of vital significance in the onset of EM. ²³ , ²⁴ To assess the functionality of METTL3 on Ect‐ESCs, we successfully upregulated METTL3 in the Ect‐ESCs (p < 0.01, Figure 2A,B). Our results showed that after METTL3 overexpression, the proliferation potential of Ect‐ESCs was significantly reduced (p < 0.01, Figure 2C,D) along with notably decreased numbers of invasive and migrative Ect‐ESCs (p < 0.01, Figure 2E,F). Collectively, our findings demonstrated that METTL3 upregulation suppressed the proliferation, invasion, and migration of Ect‐ESCs.

FIGURE 2.

METTL3 overexpression restrains the proliferation, invasion, and migration of Ect‐ESCs. Ect‐ESCs cells were transfected with pcDNA3.1‐METTL3 (oe‐METTL3), with pcDNA3.1 empty vector as the negative control. (A,B) METTL3 expression levels in cells were determined by RT‐qPCR and Western blot assay. (C,D) Cell proliferation was assessed by CCK‐8 assay and colony formation. (E,F) Cell invasion and migration were assessed by Transwell assays. Cell experiments were conducted three times independently. Data were expressed as mean ± standard deviation. Pairwise comparisons in panels A and B were analyzed using the t test and multigroup comparisons in panel C were analyzed using two‐way ANOVA and in panels D–F were analyzed using one‐way ANOVA, followed by Tukey's multiple comparison test. ** p < 0.01

3.3. miR‐21‐5p is an upstream miRNA of METTL3

To explore the upstream mechanism of METTL3, the respective upstream miRNAs of METTL3 were predicted on the Starbase and Targetscan databases, and the intersections were identified to obtain three miRNAs (Figure 3A). As one of these miRNAs, an upregulated miR‐21‐5p expression has been documented in EM. ¹⁴ In comparison with bio‐NC, bio‐miR‐21‐5p can knock‐down a higher concentration of METTL3 (p < 0.01, Figure 3B), and the targeted binding of miR‐21‐5p to METTL3 was revealed by the dual‐luciferase assay (p < 0.01, Figure 3C). Besides, our results presented with an unregulated miR‐21‐5p expression pattern in the Ect endometrial tissues and Ect‐ESCs (p < 0.05, Figure 3D–F) while the miR‐21‐5p expression pattern was negatively correlated with the mRNA level of METTL3 in experimental tissues (p < 0.01, Figure 3F). In order to verify the targeted regulation of miR‐21‐5p on METTL3, miR‐21‐5p was down‐regulated in the Ect‐ESCs (p < 0.01, Figure 3G), which resulted in METTL3 upregulation in response to miR‐21‐5p downregulation (p < 0.01, Figure 3H,I). Altogether, our findings suggested miR‐21‐5p as an upstream miRNA of METTL3.

FIGURE 3.

miR‐21‐5p is an upstream miRNA of METTL3. (A) Upstream miRNAs of METTL3 were predicted on the Starbase and Targetscan databases and intersections were identified. (B,C) The targeted binding of miR‐21‐5p to METTL3 was examined by RNA pull‐down and dual‐luciferase assays. (D,E) miR‐21‐5p expression levels in tissues (N = 45) and cells were determined by RT‐qPCR. (F) Correlation between the miR‐21‐5p expression pattern and METTL3 mRNA in ectopic endometrial tissues was analyzed by Pearson correlation analysis; Ect‐ESCs were transfected with miR‐21‐5p inhibitor (miR‐inhi), with inhibitor control (inhi‐NC) as the negative control. (G) miR‐21‐5p expression levels in cells were determined by RT‐qPCR. (H,I) METTL3 expression levels in cells were determined by RT‐qPCR and Western blot assay. Cell experiments were conducted three times independently. Data in figures B, C, E, G–I were expressed as mean ± standard deviation. Pairwise comparisons in panels B, D, E, G–I were analyzed using the t test and multigroup comparisons in panel C were analyzed using two‐way ANOVA, followed by Tukey's multiple comparison test. * p < 0.05, ** p < 0.01

3.4. miR‐21‐5p overexpression attenuates the suppressive role of METTL3 overexpression in the proliferation, invasion, and migration of Ect‐ESCs

Next, the miR‐21‐5p expression was upregulated in the Ect‐ESCs (p < 0.01, Figure 4A) and used oe‐METTL3 for combination treatment, upon which METTL3 expression levels were decreased (p < 0.05, Figure 4B,C), the proliferation potential of Ect‐ESCs was enhanced (p < 0.01, Figure 4D,E), while the number of invasive and migrative cells was increased (p < 0.01, Figure 4F,G). Collectively, our findings suggested that miR‐21‐5p overexpression attenuated the suppressive functionality of METTL3 overexpression on the proliferation, invasion, and migration of Ect‐ESCs.

FIGURE 4.

miR‐21‐5p overexpression attenuates the suppressive role of METTL3 overexpression in proliferation, invasion, and migration of Ect‐ESCs. Ect‐ESCs were transfected with miR‐21‐5p mimic (miR‐mimic), with mimic control (mimic‐NC) as negative control. (A) miR‐21‐5p expression levels in cells were determined by RT‐qPCR. (B,C) METTL3 expression levels in cells were determined by RT‐qPCR and Western blot assay. (D,E) Cell proliferation was assessed by CCK‐8 and colony formation assays. (F,G) Cell invasion and migration were assessed by Transwell assays. Cell experiments were conducted three times independently. Data were expressed as mean ± standard deviation. Pairwise comparisons in panel A were analyzed using the t test, multigroup comparisons in panel D were analyzed using two‐way ANOVA, multigroup comparisons in panels B, C, E–G were analyzed using one‐way ANOVA, followed by Tukey's multiple comparison test. * p < 0.05, ** p < 0.01

3.5. METTL3 stabilizes WIF1 transcription via m6A modification

Accumulating evidence have shown that METTL3 can enhance the mRNA stability of downstream genes via m6A modification, ¹⁰ , ¹¹ such that WIF1 can also be regulated by means of m6A modification ¹⁸ and poorly expressed in EM. ¹⁷ We speculated that WIF1 downregulation was associated with METTL3. Our experiments identified the downregulation of WIF1 in Ect endometrial tissues and Ect‐ESCs (p < 0.01, Figure 5A–C), a negative association between the mRNA level of WIF1 and miR‐21‐5p expression pattern, and a positive association between the METTL3 expression pattern and the mRNA level of WIF1 (p < 0.01, Figure 5D,E). Additionally, the m6A contents in the Ect endometrial tissues and Ect‐ESCs were markedly lower relative to the Eut endometrial tissues and Eut‐ESCs (P < 0.01, Figure 5F,G). In the Ect‐ESCs, METTL3 overexpression amplified the enrichment of METTL3 and m6A on WIF1 and upregulated the transcriptional levels of WIF1, while miR‐21‐5p overexpression induced conflicting findings (p < 0.01, Figure 5H–J). Meanwhile, METTL3 overexpression also enhanced the mRNA stability of WIF1 (p < 0.01, Figure 5K). Altogether, our findings demonstrated that METTL3 stabilized WIF1 transcription via m6A modification.

FIGURE 5.

METTL3 stabilizes WIF1 transcription via m6A modification. (A,B) WIF1 expression levels in tissues were determined by RT‐qPCR (N = 45) and Western blot assay (N = 6). (C) WIF1mRNA levels in cells were determined by RT‐qPCR. (D,E) Correlations between WIF1 mRNA level and miR‐21‐5p or METTL3 mRNA level were analyzed by Pearson correlation analysis. (F,G) m6A contents in tissues (N = 45) and cells were analyzed by m6A quantitation analysis. (H,I) Enrichment of METTL3 and m6A on WIF1 was analyzed by the RNA immunoprecipitation assay. (J,K) mRNA level and stability of WIF1 was determined by RT‐qPCR. Cell experiments were performed three times independently. Data in panels B, C, G–K were expressed as mean ± standard deviation. Pairwise comparisons in panels A, B, C, F, and G were analyzed using the t test, multigroup comparisons in panels H, I, and K were analyzed using two‐way ANOVA, multigroup comparisons in panel J were analyzed using one‐way ANOVA, followed Tukey's multiple comparison test. ** p < 0.01

3.6. WIF1 downregulation attenuates the suppressive role of METTL3 overexpression in the proliferation, invasion, and migration of Ect‐ESCs

Lastly, we downregulated the expression levels of WIF1 in Ect‐ESCs (p < 0.01, Figure 6A,B) and selected two siRNAs (si‐WIF1#1, si‐WIF1#2) for a regimen of combination treatment. After WIF1 downregulation, the proliferation potential of Ect‐ESCs was enhanced (p < 0.05, Figure 6C,D) while the number of invasive and migrative cells was decreased (p < 0.05, Figure 6E,F). Collectively, our findings suggested that WIF1 downregulation attenuated the inhibitory effect of METTL3 overexpression on the proliferation, invasion, and migration of Ect‐ESCs.

FIGURE 6.

WIF1 downregulation attenuated the suppressive role of METTL3 overexpression in proliferation, invasion, and migration of Ect‐ESCs. Ect‐ESCs were transfected with three small interfering (si) RNA of WIF1 (si‐WIF1#1, si‐WIF1#2, and si‐WIF1#3), with NC siRNA (si‐NC) as the negative control. (A,B) Levels of WIF1 in cells were determined by RT‐qPCR and Western blot assay. (C,D) Cell proliferation was assessed by CCK‐8 and colony formation assays. (E,F) Cell invasion and migration were assessed by Transwell assays. Cell experiments were conducted three times independently. Data were expressed as mean ± standard deviation. Multigroup comparisons in panel C were analyzed using two‐way ANOVA and in panels A, B, D–F were analyzed using one‐way ANOVA, followed Tukey's multiple comparison test. * p < 0.05, ** p < 0.01

4. DISCUSSION

EM is a prevalent gynecological disease that deteriorates the quality of life of females of reproductive age. ²⁵ Accumulating evidence has elicited that modifications in ESC behaviors, such as proliferation, invasion, and migration, can facilitate the onset and development of EM. ²⁴ , ²⁶ The hard‐done work of our peers has further highlighted the epigenetic functionality of m6A regulators in EM pathogenesis and their potential usage as biomarkers for EM diagnosis. ⁷ In the current study, METTL3, miR‐21‐5p, and WIF1 were identified as vital regulators of Ect‐ESC proliferation, invasion, and migration, which consolidated them into a single mechanism wherein miR‐21‐5p inhibited the METTL3 expression and METTL3‐mediated m6A modification of WIF1 and subsequently weakened the mRNA stability of WIF1, thus promoting Ect‐ESC proliferation, invasion, and migration.

The pathophysiologic characteristics of EM are consistent with malignant tumors. ²⁷ Previously, the functionality of METTL3 in cancer development has been elicited, either dependent or independent of its m6A methyltransferase activity. ²⁸ Through extensive experimentation, we identified METTL3 downregulation in the Ect endometrial tissues and Ect‐ESCs and observed that METTL3 upregulation could successfully alleviate the proliferation, migration, and invasion of Ect‐ESCs. In consistency with our findings, METTL3 has demonstrated functionality as a inducer of ESC migration and invasion by facilitating the maturation of pri‐miR‐126. ¹² Moreover, an existing study revealed that METTL3 knockdown could effectively reduce m6A methylation to inactivate the AKT pathway, thus increasing the proliferation and tumorigenicity of endometrial cancer cells, ²⁹ eliciting preventing property of METTL3 against the malignant transformation of the endometrium. Collectively, our findings and a plethora of evidence validated the function and effects of METTL3 overexpression for inhibiting the proliferation, migration, and invasion of Ect‐ESCs.

Several miRNAs have demonstrated capacity to serve as imperative diagnostic biomarkers in EM. ³⁰ To determine the upstream mechanism of METTL3 in EM, we screened the upstream miRNAs of METTL3 via the Starbase and Targetscan databases and further identified miR‐21‐5p. Our findings were illustrative of an abundant expression of miR‐21‐5p in the Ect endometrial tissues with a negative correlation between Ect‐ESCs and the mRNA level of METTL3. Additionally, the results also revealed that miR‐21‐5p overexpression exacerbated the proliferation, invasion, and migration of Ect‐ESCs in the oe‐METTL3 group. In consistency with our results, a reduced expression of miR‐21‐5p has been evident after endometriotic peritoneal fluid treatment in primary cell cultures from Eut endometrial tissues, ³¹ where the inhibition of miR‐21‐5p by saponin extracts could induce the apoptosis of ESCs. ¹⁴ Besides, METTL3 can increase the mRNA stability and translation of downstream genes via m6A modification. ¹⁰ , ¹¹ A notable under‐expression of WIF1 has been evident in Ect tissues ¹⁷ with m6A modification as a critical mechanism to regulate WIF1. ¹⁸ On the basis of these findings, we speculated that WIF1 serves as a downstream factor of METTL3. Our subsequent experiments revealed that METTL3 overexpression enhanced the m6A and transcriptional levels of WIF1 and mRNA stability of WIF1, eliciting the potential of METTL3 to stabilize WIF1 transcription via m6A modification. Thereafter, we downregulated the expression levels of WIF1 in Ect‐ESCs, which resulted in increased Ect‐ESC proliferation, invasion, and migration. In consistency with our findings, WIF1 ablation can fundamentally trigger the proliferation, migration, and invasion of ESCs in EM. ¹⁸ Similarly, a low expression of WIF1 in the follicular fluids of EM‐associated infertility patients was previously associated with apoptosis of granulose cells. ³² Altogether, our findings were indicative of the involvement of miR‐21‐5p and WIF1 in the upstream and downstream mechanisms of METTL3 respectively and miR‐21‐5p overexpression or WIF1 downregulation attenuated the inhibitory role of METTL3 overexpression in the proliferation, migration, and invasion of Ect‐ESCs.

In summary, our study highlighted the significance of the miR‐21‐5p/METTL3/WIF1 axis in the exacerbation of Ect‐ESC proliferation, invasion, and migration, and provides novel insight into the METTL3‐mediated targeted treatment of EM. However, our study has certain limitations that need to be addressed. Firstly, our findings could not be verified through animal experiments; secondly, whether other upstream and downstream factors of METTL3, except miR‐21‐5p and WIF1, have functionality in EM progression remains unidentified; thirdly, the limited sample size of our study. Accordingly, we shall validate the role of METTL3 in animals with EM and provide novel theoretical references for EM treatment in our future endeavors.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Zhang Q‐C. METTL3 is aberrantly expressed in endometriosis and suppresses proliferation, invasion, and migration of endometrial stromal cells. Kaohsiung J Med Sci. 2023;39(3):266–277. 10.1002/kjm2.12626