ABSTRACT
Aim
This study aims to explore the role of propionylation at the K32 residue of the global regulator Fis in Salmonella enterica serovar Typhi (S. Typhi) and its influence on the pathogenicity of the bacteria.
Materials & methods
Bacterial strains were cultured in media with sodium propionate supplementation. The propionylation status of Fis was determined through Western blot and mass spectrometry analyses. The DNA-binding capability of Fis was assessed using EMSA. The invasion and survival capacities of S. Typhi were examined using T84 cells and THP-1 macrophages.
Results
Propionylation at the K32 site of Fis was found to down-regulate its DNA-binding ability, leading to a reduction in the invasion and survival of S. Typhi within host cells. The K32Q mutant exhibited significantly decreased invasion and survival capabilities compared to the wild-type and K32R mutant strains.
Conclusion
Propionylation of Fis at the K32 residue impacts the pathogenicity of S. Typhi, shedding light on the role of post-translational modifications in bacterial infections.
KEYWORDS: Salmonella enterica serovar Typhi, propionylation, propionyl coenzyme A, Fis, virulence
Plain Language Summary
Our intestines are home to many types of bacteria, some of which can make us sick. One such bacteria is called Salmonella typhi, which can cause a serious illness known as typhoid fever. In this study, we looked at a specific change in a protein called Fis that can affect how dangerous this bacteria is. The change we looked at is called “propionylation,” which occurs when a small molecule called propionyl-CoA attaches to the protein. We found that when this change occurs at a specific site (K32) on the Fis protein, it makes the bacteria less capable of invading and surviving inside our cells. This is important because it helps us understand how the bacteria functions and could lead to new ways to treat or prevent typhoid fever without relying too heavily on antibiotics. By learning more about these changes, we can discover better methods to keep our bodies healthy and combat infections.
1. Introduction
Propionylation is a novel post-translational modification (PTM) that plays a crucial role in regulating protein functionality and cellular processes [1,2]. This PTM involves the addition of a propionyl group (CH3-CH2-CO-) from propionyl coenzyme A (Propionyl-CoA) to lysine residues, thereby altering the structure, charge, and activity of proteins [3]. Propionylation exerts diverse functional effects in various biological processes, including gene expression, metabolism, and signal transduction [4,5]. Propionylation is widely observed across the spectrum of life, from prokaryotes to eukaryotes. Despite its prevalence, our understanding of the mechanisms that govern propionylation and its functional implications remains incomplete, particularly in the context of prokaryotic organisms. Unraveling the role of propionylation in prokaryotes is not only crucial but also imperative, given their pivotal roles in diverse ecological environments, their significance as agents of infectious diseases, and their utility in biotechnological advancements.
The enteric pathogen Salmonella enterica serovar Typhi (S. Typhi) is responsible for life-threatening typhoid fever [6,7]. Despite extensive research on the pathogenic mechanisms of S. Typhi, the molecular mechanisms underlying its adaptation to the host environment and its pathogenicity are still not fully understood [8,9]. Consequently, investigating the role of propionylation in the pathogenicity of S. Typhi is a viable approach to elucidating the intricate relationship among PTMs, bacterial physiology, and infection dynamics.
Regulatory factor Fis (UniProt ID P0A6R7, STY3565) is essential for Salmonella virulence and gene regulation [10]. This protein consists of 98 amino acids and has a molecular weight of 11.24kDa. As a nucleoid-associated protein (NAP), Fis modulates gene expression by regulating DNA topology and interacting with other transcriptional regulatory factors [11,12]. Notably, Fis has been identified as an activator of the pathogenicity island genes (SPI) in Salmonella, including SPI-1 genes linked to bacterial invasion and SPI-2 genes associated with macrophage intracellular survival [13,14]. Furthermore, Fis is recognized as a “global regulator” involved in the regulation of metabolism, substance transport, flagellum synthesis, and invasion [15–18]. These findings underscore the critical role of Fis not only in pathogenicity of Salmonella but also in its survival and adaptation to the environment.
Recent evidence suggests that PTMs, such as lysine acetylation and methylation on NAPs, may influence bacterial DNA structure [19,20]. The identification of Fis as a target for propionylation opens up new avenues for understanding how this modification impacts the complex network governing the pathogenicity of S. Typhi. Moreover, elucidating the role of propionylation in bacterial physiology and pathogenicity could have significant clinical implications; it may pave the way for novel therapeutic strategies targeting these modifications, potentially offering new approaches to treat infections caused by S. Typhi and other pathogens. Our study aims to contribute to this emerging field by elucidating the molecular mechanisms underlying Fis propionylation and its impact on S. Typhi’s virulence.
2. Materials and methods
2.1. Bacterial strains, plasmids, and growth conditions
Table 1 provides a list of all bacterial strains and plasmids used in this study. Bacteria were cultured using either LB broth or M9CA medium, the latter being supplemented with 20 mm sodium propionate and a low concentration of magnesium (8 μM). The following antibiotics were utilized at the stated concentrations: ampicillin (100 μg/mL), chloramphenicol (34 μg/mL), kanamycin (100 μg/mL), and spectinomycin (100 μg/mL).
Table 1.
Bacterial strains, plasmids and cells used in this study.
| Strains or Plasmids | Characteristic | Reference |
|---|---|---|
| Strains | ||
| WT | Wild-type Salmonella enterica serovar Typhi GIFU 10,007 | Lab collection |
| Δfis | WT with a defined deletion of the fis gene | Lab collection |
| Fis WT | Expression of wild-type Fis in BL21(λDE3) via pET28a | This study |
| Fis K32Q | Expression of K32Q mutant Fis in BL21(λDE3) via pET28a | This study |
| Fis K32R | Expression of K32R mutant Fis in BL21(λDE3) via pET28a | This study |
| WT::pBAD | WT with pBAD empty vector | This study |
| Δfis:pBAD | Δfis with pBAD empty vector | This study |
| Δfis:K32Q | Backfill K32Q mutant fis gene on Δfis via pBAD | This study |
| Δfis:K32R | Backfill K32R mutant fis gene on Δfis via pBAD | This study |
| Δfis:: fis | Backfill fis gene on Δfis via pBAD | This study |
| Plasmids | ||
| pBAD33 | Suitable for constructing backfill strains | Lab collection |
| pET28a | Construction of vectors for in vitro expression of proteins | Lab collection |
| GFP(pFPV25.1) | Plasmid with green fluorescent label | Lab collection |
| Cell | ||
| THP-1 | Can be induced to differentiate into macrophages by PMA | Lab collection |
| T84 | Human colon adenocarcinoma epithelial cells | Shenzhen Huatuo Biotechnology Co. |
2.2. Quantitative real-time pcr (qPCR) assay
Bacteria were cultured in M9CA medium supplemented with 8 µM magnesium until the optical density at 600 nm reached 0.4. Total RNA was extracted using TRIzol (Vazyme, China). The primers utilized are listed in Table 2. The relative transcriptional levels of target genes were analyzed using the 2−ΔΔCT method, with 16S rRNA serving as the reference gene.
Table 2.
Primers used in this study.
| Primer | Sequences (5’-3’) | Target |
|---|---|---|
| Fis-F(EcoR I) | GGAATTCATGTTCGAACAACGCGTAAA | |
| Fis-R(Hind III) Fis-32Q-F |
CCCAAGCTTTTAGTTCATGCCGTATTTTTTTAAT ACTCGGTTCAACAGGCACTGAAGAACTATTTTGCT |
For FisK32Q construction |
| Fis-32Q-R | TGCCTGTTGAACCGAGTCACGCAGGGGTTTTT | |
| Fis-32 R-F | GTTCGACAGGCACTGAAGAACTATTTTGCTCA | For FisK32R construction |
| Fis-32 R-R | TTCAGTGCCTGTCGAACCGAGTCACGCAGGGG | |
| pBAD-F | ATGCCATAGCATTTTTATCC | |
| pBAD-R | GATTTAATCTGTATCAGG | |
| 16S-qF | AAACGGTGGCTAATACCGCA | For qRT-PCR |
| 16S-qR | GAGCCGTTACCTCACCAACA | |
| ssrA-qF | AATCACTGGACCTCTTGCTG | |
| ssrA-qR | CAGTCTGCCCTATTTGACCT | |
| ssrB-qF | TAAAACTTTAGCCGCAGGTG | |
|
ssrB-qR spiC-qF |
AGGATAGCTTCCCGATTCAA AAGCCTTGTCTTGCCTATGT |
|
| spiC-qR | AATAACCGTTTAACCATCCC | |
| iagA-qF | TTACCCGCTGTATCTATGCC | |
| iagA-qR | GGACGATTAAACCGATAACCC | |
| invH-qF | ACATCCACAATACATGCGTTC | |
| invH-qR | GCTTAAATTCTTACTTCCGGGTT | |
| invF-qF | TCCGGCCTTCAATAAGGTAC | |
| invF-qR | TCTCCCAGCATTCTCATCGT | |
| fis-promoter-F | TTGCTTTGCACGCATGTTCG | For EMSA |
| fis-promoter-R | TAGAAACGGTCAGTACGTCA |
2.3. Antibodies and SDS-PAGE
Anti-His antibody and Pan-anti propionyl lysine antibody were purchased from Jingjie PTM BioLab (Hangzhou, China). The coding region of fis was cloned into the pET28a vector (Novagen, USA) and transferred into BL21 (λDE3) for His-Fis expression. Purification of His-Fis was performed with 1% Protease Inhibitor Cocktail III (Merck Millipore), 3 μM TSA (MedchemExpress), and 50 mm NAM (Sigma-Aldrich) [21]. The purity of His-Fis was confirmed by SDS-PAGE.
2.4. Mass spectrometry analysis
Fis WT was cultured in LB medium supplemented with 20 mm sodium propionate until reaching the stationary phase. The His-Fis protein, expressed in BL21(λDE3) using the pET28a plasmid, was purified following the aforementioned methodology. Tryptic peptides were dissolved in solvent A (0.1% formic acid, 2% acetonitrile in water) and directly loaded onto a homemade reversed-phase analytical column (25 cm length, 75 μm i.d.). The peptides were separated using a gradient elution comprising a series of solvent B (0.1% formic acid in 90% acetonitrile) concentrations. The gradient began at 5% and increased to 25% over 60 minutes, then to 35% over 22 minutes, and finally reached 80% in 4 minutes. The flow rate was maintained at a constant 450 nL/min using an EASY-nLC 1200 UPLC system (ThermoFisher Scientific).
2.5. Non-enzymatic propionylation assay of Fis
To investigate the non-enzymatic propionylation of Fis, we incubated recombinant Fis with varying concentrations of propionyl-CoA in vitro. The propionylation assay was performed as follows: Purified recombinant Fis protein (10 μg) was mixed with propionyl-CoA (final concentrations of 0 mm, 5 mm, 15 mm, and 30 mm) in reaction buffer (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 1 mm DTT). The mixture was incubated at 37°C for 6 hours to allow the propionylation reaction to proceed. The reaction was terminated by adding 5× SDS-PAGE loading buffer and heating at 95°C for 5 minutes to denature the protein. The propionylation levels of Fis were detected by Western blot analysis using a specific anti-propionylation antibody (Anti-PrK) [22].
2.6. Electrophoretic mobility shift assay (EMSA)
EMSA was performed following a similar protocol as previously described [23,24]. 100 ng of the fis promoter DNA fragment was incubated with increasing amounts of His-Fis at 30°C for 30 minutes. The resulting products were electrophoresed on a 6% polyacrylamide gel and analyzed using ethidium bromide (EB) dye.
2.7. Invasion assay of intestinal epithelial cells T84
T84 cells were grown in DMEM/F12, which contains 5% fetal bovine serum, at 37°C and 5% CO2. 1.5 × 10^5 cells/well in a 24-well plate were incubated for 24 hours, after which the medium was replaced with fresh medium for bacterial infection. Bacteria were cultured in LB medium (containing 0.2% Arabinose (Ara)) until OD600 ~0.6. The bacteria were washed twice with PBS and resuspended in a fresh cell culture medium. The cells were infected with the bacteria at multiplicity of infection (MOI) of 20 and incubated for 1.5 hours. The medium was replaced, and gentamicin (100 μg/mL) was added to kill extracellular bacteria. After an additional 1.5 hours of incubation, the cells were lysed with Triton X-100. The lysate was plated on LB agar containing chloramphenicol and incubated overnight at 37°C. The number of S. Typhi colonies reflected the level of bacterial invasion. The experiment was repeated three times.
2.8. The THP-1 cells intracellular survival assay
The bacteria were cultured to log phase (OD600 = 0.4) and subsequently added to THP-1 cells, which were cultured in 24-well plates at a MOI of 10. After 1 hour, gentamicin was added and after 2 hours, one-third of the wells were ruptured, cells were collected and left overnight. The number of colonies (C2h) was used to assess the level of phagocytosis of the bacteria. Cells from the remaining two-thirds of wells were incubated for 24 hours, ruptured, and plated overnight. The number of colonies (C24h) represented bacterial proliferation within the cells. The survival rate of S. Typhi in THP-1 cells was calculated as C24h/C2h.
2.9. Statistical analysis and plotting
The statistical analysis was performed using SPSS21.0 (Chicago, USA), and GraphPad Prism 8.0.1 (San Diego, CA, USA) was used for data visualization. The Student’s t-test was applied to assess significant differences between the two groups. A value of p < 0.05 indicated a significant difference (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001).
3. Results
3.1. Propionyl-CoA affects the level of Fis propionylation modifications
Previous studies have demonstrated a significant increase in overall protein propionylation levels in S. Typhi when treated with 20 mm propionate under simulated intestinal conditions [5]. Propionyl-coenzyme A (CoA) functions as a substrate for propionylation, a post-translational modification. It plays a pivotal role in the metabolic pathway of propionate. To investigate the impact of propionyl-CoA on Fis propionylation levels, we expressed and purified Fis using a recombinant pET28a vector in vitro. Subsequently, Fis was incubated with varying concentrations of propionyl-CoA for 6 hours. The propionylation levels of Fis were assessed through Western blot analysis using a propionylation-specific antibody (Anti-PrK). The findings revealed that Fis displayed minimal propionylation in the absence of propionyl-CoA (0 mm). However, as the concentration of propionyl-CoA increased, the propionylation level of Fis gradually elevated (Figure 1).
Figure 1.

Propionyl-CoA affects the level of Fis propionylation modifications. Fis exhibited low levels of propionylation in the absence of propionyl-CoA (0 mm). As the concentration of propionyl-CoA increased, the propionylation level of Fis gradually increased.
3.2. K32 is the specific lysine residue undergoing propionylation in the Fis protein
To identify the specific lysine residue(s) undergoing propionylation in Fis, the Fis WT strain was cultured in an LB medium supplemented with 20 mm sodium propionate until reaching the stationary phase. Subsequently, the purified His-tagged Fis protein was subjected to mass spectrometry analysis. The results indicated that K32 in Fis was propionylated (Figure 2(a)). The three-dimensional structure of Fis was analyzed using the UniProt database, with Lys32 highlighted in green, illustrating its spatial location within the protein (Figure 2(b)). A comparison of the sequences revealed that K32 is highly conserved, indicating that it plays an important role in protein function (Figure 2(c)). Propionyl-CoA acts as the substrate for propionylation reactions. To confirm the propionylation of Fis at K32, we introduced a K-to-Q substitution mutation in Fis (K32Q), which mimics a constitutively propionylated form by neutralizing the positive charge. The mutant Fis protein (K32Q) was expressed in vitro using the recombinant pET28a vector. When incubated with 30 mm propionyl-CoA for 6 hours, a significant decrease in propionylation level was observed for K32Q compared to the wild-type Fis (Figure 2(d)). These findings provide indirect support for the proposition that propionylation occurs at the K32 residue of Fis, which plays a critical role in the overall propionylation level of Fis.
Figure 2.

K32 of Fis can be propionylated by propionyl-CoA. (a) MS/MS spectrum of a propionylated peptide (SGKpr IMR) of Fis near the Lys32 residue. (b) Three-dimensional structure of Fis. The protein structure was analyzed using the UniProt database, and Lys32 is indicated in green. (c) the sequence alignment analysis of Lys32 in Fis was performed using Bio Edit. The conserved propionyl lysine residues of interest are indicated in red, with a blue box highlighting them. (d) Fis was incubated with propionyl-CoA for 6 h at 37°Cfollowed by immunoblotting.
3.3. Propionylation of K32 impairs Fis’ DNA binding activity
To investigate the impact of propionylation on Fis’ transcriptional function at K32, we examined the effects of K32 mutations on Fis’ DNA binding activity. Electrophoretic mobility-shift assays (EMSA) were performed using recombinant purified Fis protein and mutant variants where K32 was substituted with glutamine (Q) or arginine (R). The arginine substitution maintained the positive charge to simulate the non-propionylated form, while the glutamine substitution neutralized the positive charge to mimic constitutive propionylation. The PCR amplification of the fis promoter, as depicted in Figure 3(a), was successful, yielding a clear band. The EMSA results, shown in Figure 3(b), revealed a significant reduction in DNA binding activity of the K32Q mutant Fis compared to both the wild-type Fis and K32R mutant Fis, as evidenced by the presence of free fis fragments at a concentration of 2 μM. This observation indicated that the K32Q mutation leads to the loss of functionality in Fis’ lysine side chain, underscoring the critical importance of K32 for Fis’ binding to the promoter DNA. Consequently, the in vitro propionylation of K32 is closely correlated with the ability of Fis to bind DNA.
Figure 3.

K32 propionylation affects the DNA binding of Fis. (a) PCR amplification of fis promoter. (b) Propionylation of the K32 residue in Fis hinders its binding with DNA. Equal concentrations of Fis or Fis mutants were incubated with a DNA probe, and an EMSA assay was conducted to evaluate the DNA-binding capability of different Fis mutants (n = 3 biological replicates).
3.4. Propionylation of Fis at the K32 site reduces the invasive ability of S. Typhi
Invasion is a major virulence factor of S. Typhi, and studies have demonstrated that Fis can activate genes associated with the pathogenicity island, which are responsible for invasion, including the SPI-1. To investigate the functional impact of propionylation modification of the Fis protein at the K32 site, we constructed different Δfis complementation strains and induced Fis expression using 20% Ara. Bacterial invasion ability was evaluated by calculating colony-forming units for S. Typhi infected T84 cells. The Δfis::K32Q strain exhibited significantly reduced invasion capability compared to the WT:pBAD strain, intermediate between the Δfis::pBAD and Δfis::fis strains, and lower than the Δfis::K32R strain (Figure 4(a)) (Figure 4(b)). The results of qRT-PCR analysis demonstrated that the mRNA expression levels of invasion-related genes (i.e., iagA, invF, and invH) were markedly diminished in the Δfis::K32Q strain when compared to the Δfis::fis and Δfis::K32R strains (Figure 4(c)). The results demonstrated that propionylation modification of Fis at the K32 site suppresses the invasion capability of S. Typhi.
Figure 4.

Propionylation of Fis at the K32 site reduces the invasive ability of S. Typhi. (a) the changes in colony-forming units (CFU) were observed after 1.5 hours of S. Typhi invasion in T84 cells, followed by dilution and overnight incubation (MOI = 20). (b) Enumeration of colony-forming units (CFU) after 1.5 hours of invasion. Results are shown as the mean ± SD of three independent experiments. *p < 0.05; **p < 0.01; ****p < 0.0001 (Student’s t-test). (c) Transcription levels of invasion-related genes in the δfis complemented strain were measured using qRT-pcr. mRNA levels were determined, with the relative expression of genes in δfis:fis set as 1. Error bars indicate ± SD of triplicate measurements. ***p < 0.001; ****p < 0.0001 (Student’s t-test).
3.5. Effect of propionylation of Fis at K32 site on the intracellular survival of S. Typhi in THP-1 macrophages
Fis is involved in the expression of SPI-2 related genes, which are closely related to Salmonella‘s survival in macrophages [13]. By observing the fold change in intracellular bacteria following THP-1 macrophage infection with a MOI = 10, we found that the intracellular survival capability of the Δfis::K32Q strain significantly decreased compared to the WT:pBAD and Δfis::fis strains, while the intracellular survival capability of the Δfis::K32R strain was significantly higher than that of the Δfis::pBAD and Δfis::K32Q strains, but slightly lower than that of the WT:pBAD and Δfis::fis strains (Figure 5(a)). To visualize the impact of Fis K32 propionylation on intracellular survival capability, we introduced a green fluorescent protein (GFP) plasmid (pFPV25.1) into different Δfis complementation strains. The same method was used for an intracellular survival experiment in THP-1 macrophages, with the results analyzed at 24 hours using fluorescence microscopy (Figure 5(b)).
Figure 5.

Effect of propionylation of Fis at K32 Site on the intracellular survival of S. Typhi in THP-1 Macrophages. (a) Bacterial proliferation in THP-1 macrophages. THP-1 cells were infected with an empty WT pBAD vector strain and a Δfis complemented strain grown in LB medium. To determine the number of live intracellular bacteria, cells were lysed at 2 or 24 h post-infection. Bacterial growth was measured as the fold change in CFU from 2 to 24 h (MOI = 10). Results are shown as the mean ± standard deviation of three independent experiments. **p < 0.01; ****p < 0.0001 (Student’s t-test). (b) Representative fluorescent microscopic image showing a significant decrease in the viability of the Δfis::K32Q strain after 24 h of infection in THP-1 macrophages (original magnification, ×100).(c) Transcript levels of intracellular survival-related genes in the Δfis complemented strain. mRNA levels were determined by qRT-pcr. The relative expression of genes in the Δfis::fis strain was set as 1. Error bars indicate ± standard deviation of triplicate measurements. **p < 0.01; ***p < 0.001; ****p < 0.0001 (Student’s t-test). (d) the intermediate metabolite of propionate, propionyl-CoA, can affect the propionylation modification of the K32 residue of Fis, thereby reducing the activity of Fis and resulting in a significant decrease in invasion and intracellular survival abilities.
To confirm the relationship between intracellular survival capability and Fis activity, we analyzed the mRNA expression levels (including ssrA, ssrB, and spiC) associated with intracellular survival by qRT-PCR. The results showed that the mRNA levels of ssrA, ssrB, and spiC in the Δfis::K32Q complementation strain, which simulated Fis K32 propionylation, were significantly lower than those in the WT Δfis::fis complementation strain, and lower than those in the Δfis::K32R complementation strain, which simulated non-propionylation of Fis K32. The data indicates that propionylation of Fis K32 suppressed the expression of intracellular survival-related genes in S. Typhi (Figure 5(c)).
4. Discussion
The present study provides novel insights into the role of propionylation modification on the nucleoid-associated protein Fis in S. Typhi. Our findings reveal that propionylation at the K32 residue of Fis significantly impacts its DNA binding capacity and subsequently influences the expression of virulence genes. This study bridges a gap in the literature by demonstrating the functional implications of propionylation in the regulation of bacterial pathogenicity.
Proteomic analysis in our study identified a substantial increase in propionylation levels at the K32 residue of Fis following treatment with 20 mm propionate [4,5]. This result is consistent with recent research highlighting the sensitivity of bacterial proteins to environmental metabolites [25]. The use of an E. coli expression system to purify Fis protein allowed us to confirm propionylation through Western blot, a method that has been increasingly adopted for the detection of post-translational modifications. Mass spectrometry analysis further validated the propionylation at the K32 residue, a technique that has become a gold standard for the identification of specific protein modifications.
Moreover, it is noteworthy that in vitro, lysine residues can be acetylated by acetyl-CoA, as previously reported [26–28]. Non-enzymatic propionylation is primarily mediated by highly reactive thioesters, such as acyl-CoA species. These thioesters are generated through metabolic processes like glycolysis, β-oxidation, the tricarboxylic acid cycle, and amino acid degradation [29,30]. The high reactivity of propionyl-CoA allows it to modify lysine residues without the need for specific enzymes, although the efficiency and specificity of this modification are generally lower than those of enzymatic acylation [31]. In this study, we have shown that under non-enzymatic conditions, propionylation can occur on lysine residues of S. Typhi through propionyl-CoA (Figures 1 and 2(d)). This observation adds another layer to our understanding of the mechanisms by which environmental metabolites can directly influence bacterial protein function.
The functional investigation demonstrated that propionylation of Fis at K32 reduced DNA binding capacity (Figure 3(b)). This is in line with recent studies suggesting that post-translational modifications can significantly alter protein-DNA interactions [32]. The K32 residue, located in the core binding region of Fis, undergoes propionylation, introducing a bulky propionyl group that alters the protein’s three-dimensional structure, particularly affecting key regions involved in DNA binding. This structural change hinders direct contact between Fis and DNA, reducing binding affinity. Additionally, propionylation neutralizes the positive charge of K32, weakening electrostatic interactions with DNA’s negatively charged groups, further affecting binding. Moreover, propionylation at K32 affects DNA breathing dynamics, making the local DNA region more rigid and stable, reducing the necessary flexibility and dynamics for Fis binding. Thus, propionylation at K32 indirectly impacts Fis-DNA binding by altering these dynamics [33]. We investigated the impact of propionylation on the function of Fis by simulating the propionylation state through site-directed mutagenesis. Specifically, we introduced a K-to-Q substitution mutation in Fis (K32Q) to simulate a constitutively propionylated form by neutralizing the positive charge. Conversely, we used an R substitution (K32R) to maintain the positive charge while avoiding propionylation [32]. These mutations allowed us to explore the functional consequences of propionylation at the K32 residue in Fis. Invasion assays and macrophage survival experiments revealed a significant decrease in the invasion and intracellular survival abilities of the Δfis::K32Q strain, which provides evidence for the role of Fis propionylation in S. Typhi pathogenicity. qRT-PCR data confirmed corresponding changes in the expression levels of pathogenicity island genes, emphasizing the regulatory role of Fis in virulence gene expression.
These findings highlight the impact of propionylation at the K32 residue of Fis on its activity and the pathogenicity of S. Typhi. Furthermore, our findings indicate that propionate may function as an environmental signal, affecting the activity of Fis, a global regulatory factor in enteric pathogens. This suggests a model where environmental metabolites can modulate bacterial virulence to adapt to the host environment and enhance survival opportunities (Figure 5(d)).
In Salmonella, PTMs play a crucial role in regulating the functions of key transcription factors. For instance, acetylation of lysine 102 and lysine 201 in PhoP inhibits its protein activity and DNA binding, respectively, while acetylation of the transcriptional regulator HilD suppresses the expression of virulence genes [26,34,35]. These findings indicate that acetylation modifications are critical in modulating the pathogenicity of Salmonella. Additionally, histone-like nucleoid structuring protein (H-NS) is essential for gene silencing in bacteria [36]. Phosphorylation of H-NS at threonine 13 leads to the neutralization of the positive charge of arginine 14, resulting in defective H-NS dimerization [37]. This PTM reduces the interaction between H-NS and DNA, thereby weakening gene silencing. Similarly, the H118 residue of Fur, the major regulator of iron homeostasis in Salmonella, is located on the surface of the Fur homodimer. UMPylation of this residue may disrupt the dimer interface, altering the aggregation state of Fur and significantly weakening its DNA binding ability [38]. These discoveries reveal the complex roles of PTMs in the transcriptional regulation of Salmonella, providing new insights into how bacteria adapt to the host environment.
While this study provides initial insights into the functional significance of post-translational propionylation modifications in Fis protein, it is not without limitations. The study primarily focuses on the in vitro effects of propionylation on Fis protein function and virulence gene regulation. Future studies should aim to investigate the in vivo significance of these findings within the context of a host-pathogen interaction model. Additionally, the role of other post-translational modifications on Fis and their impact on bacterial physiology warrants further exploration. The role of propionate as an environmental signal and its impact on Fis activity and bacterial virulence is an intriguing area for future research. It would be valuable to explore the effects of different environmental conditions on propionylation levels and to identify additional proteins that may be regulated by this modification. Understanding the molecular mechanisms underlying the regulation of propionylation by host signals could provide new targets for therapeutic intervention. By expanding our understanding of these processes, we can gain valuable insights into the complex interplay between bacterial adaptation and host immunity, potentially leading to the development of novel strategies to combat bacterial infections.
5. Conclusion
In summary, this work reports that propionate in intestinal short-chain fatty acids affects the level of propionylation of Fis at K32 in a concentration-dependent manner, which then leads to reduced DNA-binding ability of Fis, ultimately affecting the virulence of S. Typhi. Our findings demonstrate that propionylation at the K32 residue of Fis significantly impacts its regulatory function, leading to a reduction in the expression of virulence genes and a decrease in the invasive and survival abilities of S. Typhi within host cells.
Funding Statement
This research was funded by the Jinshan Elite Talents in the Medical Field (JSYC2023–008).
Article highlights
Propionylation is a prevalent post-translational modification (PTM) that affects protein function and cellular processes in both prokaryotes and eukaryotes. Our study focuses on the role of propionylation in the enteric pathogen Salmonella enterica serovar Typhi (S. Typhi).
We report that the global regulator Fis in S. Typhi undergoes propionylation at the K32 residue, mediated by propionyl coenzyme A (Propionyl-CoA), an intermediate metabolite of propionate.
Propionylation at K32 down-regulates the DNA-binding ability of Fis, reducing its invasion and survival abilities within intestinal epithelial cells and macrophages.
Pathogenicity Mechanism: Our research unravels a potential molecular mechanism through which propionylation impacts the pathogenicity of S. Typhi, shedding light on the role of propionylation in prokaryotic infections.
Propionate, a short-chain fatty acid (SCFA) in the human intestine, can be activated by PrpE to generate propionyl-CoA, which affects the propionylation level of Fis at K32 in a concentration-dependent manner.
The study highlights the importance of post-translational modifications in modulating the activity of key regulatory proteins in bacteria, particularly in the context of host-pathogen interactions.
While our study provides initial insights into the functional significance of propionylation in Fis, future research should aim to investigate the in vivo significance of these findings within a host-pathogen interaction model and explore the role of other post-translational modifications on Fis.
Author contributions
Conceptualization: H.T., Z.Z.; methodology: X.L; software: X.L; formal analysis: Z.Z; writing original draft preparation: H.T; writing review and editing: X.H; project administration: X.H; funding acquisition: H.T. All authors have read and agreed to the published version of the manuscript.
Disclosure statement
The authors have no relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.
No writing assistance was utilized in the production of this manuscript.
References
Papers of special note have been highlighted as either of interest (•) or of considerable interest (••) to readers.
- 1.Okanishi H, Kim K, Masui R, et al. Lysine propionylation is a prevalent post-translational modification in Thermus thermophilus. Mol Cell Proteomics. 2014;13(9):2382–2398. doi: 10.1074/mcp.M113.035659 [DOI] [PMC free article] [PubMed] [Google Scholar]; • This study provides a comprehensive analysis of lysine propionylation in Thermus thermophilus, highlighting its prevalence and significance in prokaryotic organisms.
- 2.Sun M, Xu J, Wu Z, et al. Characterization of protein lysine propionylation in escherichia coli: global profiling, dynamic change, and enzymatic regulation. J Proteome Res. 2016;15(12):4696–4708. doi: 10.1021/acs.jproteome.6b00798 [DOI] [PubMed] [Google Scholar]; • This reference offers a detailed characterization of lysine propionylation in E. coli, providing insights into its global profiling and regulatory mechanisms.
- 3.Chen Y, Sprung R, Tang Y, et al. Lysine propionylation and butyrylation are novel post-translational modifications in histones. Mol Cell Proteomics. 2007;6(5):812–819. doi: 10.1074/mcp.M700021-MCP200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Xu X, Cao X, Yang J, et al. Proteome-wide Identification of lysine propionylation in the conidial and mycelial stages of trichophyton rubrum. Front microbiol. 2019;10:10. doi: 10.3389/fmicb.2019.02613 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Tang H, Zhan Z, Liu X, et al. Propionate reduces the viability of Salmonella enterica Serovar Typhi in macrophages by propionylation of PhoP K102. Microb Pathog. 2023;178:106078. doi: 10.1016/j.micpath.2023.106078 [DOI] [PubMed] [Google Scholar]; • This study demonstrates the impact of propionylation on the viability of S. Typhi in macrophages, emphasizing the role of PhoP K102 propionylation.
- 6.Meiring JE, Khanam F, Basnyat B, et al. Typhoid fever. Nat Rev Dis Primers. 2023;9(1):71. doi: 10.1038/s41572-023-00480-z [DOI] [PubMed] [Google Scholar]
- 7.da Silva KE, Tanmoy AM, Pragasam AK, et al. The international and intercontinental spread and expansion of antimicrobial-resistant Salmonella Typhi: a genomic epidemiology study. Lancet Microbe. 2022;3(8):e567–e577. doi: 10.1016/S2666-5247(22)00093-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Stanaway JD, Reiner RC, Blacker BF.. The global burden of typhoid and paratyphoid fevers: a systematic analysis for the Global Burden of Disease Study 2017. Lancet Infect Dis. 2019;19(4):369–381. doi: 10.1016/S1473-3099(18)30685-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Lee GY, Song J. Single missense mutations in Vi capsule synthesis genes confer hypervirulence to Salmonella Typhi. Nat Commun. 2024;15(1):5258. doi: 10.1038/s41467-024-49590-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Duprey A, Reverchon S, Nasser W. Bacterial virulence and Fis: adapting regulatory networks to the host environment. Trends Microbiol. 2014;22(2):92–99. doi: 10.1016/j.tim.2013.11.008 [DOI] [PubMed] [Google Scholar]; •• This review discusses the role of Fis in bacterial virulence and its adaptation to the host environment, providing a theoretical foundation for our study.
- 11.Travers A, Schneider R, Muskhelishvili G. DNA supercoiling and transcription in Escherichia coli: The FIS connection. Biochimie. 2001;83(2):213–217. doi: 10.1016/s0300-9084(00)01217-7 [DOI] [PubMed] [Google Scholar]
- 12.Ouafa ZA, Reverchon S, Lautier T, et al. The nucleoid-associated proteins H-NS and FIS modulate the DNA supercoiling response of the pel genes, the major virulence factors in the plant pathogen bacterium Dickeya dadantii. Nucleic Acids Res. 2012;40(10):4306–4319. doi: 10.1093/nar/gks014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kelly A, Goldberg MD, Carroll RK, et al. A global role for Fis in the transcriptional control of metabolism and type III secretion in Salmonella enterica serovar Typhimurium. Microbiology. 2004;150(Pt 7):2037–2053. doi: 10.1099/mic.0.27209-0 [DOI] [PubMed] [Google Scholar]
- 14.Wang H, Liu B, Wang Q, et al. Genome-wide analysis of the Salmonella Fis regulon and its regulatory mechanism on pathogenicity islands. PLOS ONE. 2013;8(5):e64688. doi: 10.1371/journal.pone.0064688 [DOI] [PMC free article] [PubMed] [Google Scholar]; • This study provides a genome-wide analysis of the Fis regulon in Salmonella, highlighting its regulatory mechanisms on pathogenicity islands.
- 15.Wang H, Wang L, Li P, et al. Dynamic transcriptional regulation of Fis in Salmonella during the exponential phase. Curr Microbiol. 2015;71(6):713–718. doi: 10.1007/s00284-015-0907-6 [DOI] [PubMed] [Google Scholar]
- 16.Yan D, Zhang Q, Fu Q, et al. Disruption of Fis reduces bacterial persister formation by regulating glutamate metabolism in Salmonella. Microb Pathog. 2021;152:104651. doi: 10.1016/j.micpath.2020.104651 [DOI] [PubMed] [Google Scholar]
- 17.Lv M, Chen Y, Liao L, et al. Fis is a global regulator critical for modulation of virulence factor production and pathogenicity of Dickeya zeae. Sci Rep. 2018;8(1):341. doi: 10.1038/s41598-017-18578-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Dorman CJ. Global regulators and environmental adaptation in Gram-negative pathogens. Clin Microbiol Infect. 2009;Suppl 15:47–50. doi: 10.1111/j.1469-0691.2008.02684.x [DOI] [PubMed] [Google Scholar]
- 19.Sakatos A, Babunovic GH, Chase MR, et al. Posttranslational modification of a histone-like protein regulates phenotypic resistance to isoniazid in mycobacteria. Sci Adv. 2018;4(5):eaao1478. doi: 10.1126/sciadv.aao1478 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Carabetta VJ, Greco TM, Cristea IM, et al. YfmK is an Nε-lysine acetyltransferase that directly acetylates the histone-like protein HBsu in Bacillus subtilis. Proc Natl Acad Sci USA. 2019;116(9):3752–3757. doi: 10.1073/pnas.1815511116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Gao H, Zhang Y, Han Y, et al. Phenotypic and transcriptional analysis of the osmotic regulator OmpR in Yersinia pestis. BMC Microbiol. 2011;11(1):39. doi: 10.1186/1471-2180-11-39 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Shui K, Wang C, Zhang X, et al. Small-sample learning reveals propionylation in determining global protein homeostasis. Nat Commun. 2023;14(1):2813. doi: 10.1038/s41467-023-38414-8 [DOI] [PMC free article] [PubMed] [Google Scholar]; •• This study uses small-sample learning to reveal the role of propionylation in global protein homeostasis, providing a novel perspective on post-translational modifications.
- 23.Gao H, Zhang L, Osei-Adjei G, et al. Transcriptional regulation of cpsQ-mfpABC and mfpABC by CalR in Vibrio parahaemolyticus. Microbiologyopen. 2017;6(4):e00470. doi: 10.1002/mbo3.470 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhang L, Osei-Adjei G, Zhang Y, et al. CalR is required for the expression of T6SS2 and the adhesion of Vibrio parahaemolyticus to HeLa cells. Arch Microbiol. 2017;199(6):931–938. doi: 10.1007/s00203-017-1361-6 [DOI] [PubMed] [Google Scholar]
- 25.Zhang ZJ, Pedicord VA, Peng T, et al. Site-specific acylation of a bacterial virulence regulator attenuates infection. Nat Chem Biol. 2020;16(1):95–103. doi: 10.1038/s41589-019-0392-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ren J, Sang Y, Qin R, et al. Metabolic intermediate acetyl phosphate modulates bacterial virulence via acetylation. Emerg Microbes Infect. 2019;8(1):55–69. doi: 10.1080/22221751.2018.1558963 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Li J, Liu S, Su Y, et al. Acetylation of PhoP K88 is involved in regulating Salmonella Virulence. Infect Immun. 2021;89(3). doi: 10.1128/iai.00588-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Baeza J, Smallegan MJ, Denu JM. Site-specific reactivity of nonenzymatic lysine acetylation. ACS Chem Biol. 2015;10(1):122–128. doi: 10.1021/cb500848p [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Baldensperger T, Glomb MA. Pathways of non-enzymatic lysine acylation. Front Cell Dev Biol. 2021;9:9. doi: 10.3389/fcell.2021.664553 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Kulkarni RA, Worth AJ, Zengeya TT, et al. Discovering targets of non-enzymatic acylation by thioester reactivity profiling. Cell Chem Biol. 2017;24(2):231–242. doi: 10.1016/j.chembiol.2017.01.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Wang MM, You D, Ye BC. Site-specific and kinetic characterization of enzymatic and nonenzymatic protein acetylation in bacteria. Sci Rep. 2017;7(1):14790. doi: 10.1038/s41598-017-13897-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Tang H, Zhan Z, Zhang Y, et al. Propionylation of lysine, a new mechanism of short-chain fatty acids affecting bacterial virulence. Am J Transl Res. 2022;14(8):5773–5784. [PMC free article] [PubMed] [Google Scholar]
- 33.Nowak-Lovato K, Alexandrov LB, Banisadr A, et al. Binding of nucleoid-associated protein fis to DNA is regulated by DNA breathing dynamics. PLoS Comput Biol. 2013;9(1):e1002881. doi: 10.1371/journal.pcbi.1002881 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ren J, Sang Y, Tan Y, et al. Acetylation of Lysine 201 inhibits the DNA-Binding ability of PhoP to regulate Salmonella Virulence. PloS Pathog. 2016;12(3):e1005458. doi: 10.1371/journal.ppat.1005458 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Sang Y, Ren J, Qin R, et al. Acetylation regulating protein stability and DNA-Binding ability of HilD, thus modulating Salmonella Typhimurium virulence. J Infect Dis. 2017;216(8):1018–1026. doi: 10.1093/infdis/jix102 [DOI] [PubMed] [Google Scholar]
- 36.Yamanaka Y, Winardhi RS, Yamauchi E, et al. Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation. J Biol Chem. 2018;293(24):9496–9505. doi: 10.1074/jbc.RA117.001425 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Hu L, Kong W, Yang D, et al. Threonine phosphorylation fine-tunes the regulatory activity of histone-like nucleoid structuring protein in Salmonella transcription. Front Microbiol. 2019;10:1515. doi: 10.3389/fmicb.2019.01515 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Jia H, Song N, Ma Y, et al. Salmonella facilitates iron acquisition through UMPylation of ferric uptake regulator. MBio. 2022;13(3):e0020722. doi: 10.1128/mbio.00207-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
