Establishment of an Organoid Culture Model Derived from Small Intestinal Epithelium of C57BL/6 Mice and Its Benefits over Tissues

Abstract

This study aimed to establish an organoid culture model using small intestine tissues from male and female C57BL/6 mice and to compare it with rat organoid cultures derived from frozen tissues. Crypts were isolated from the small intestines of eight-week-old male and female mice and cultured in 3D extracellular matrix with Wnt, R-spondin, and Noggin. In addition, small intestine tissues from sixteen-week-old F344 rats were preserved in a storage solution immediately post-sacrifice and stored at –80°C before being transferred to a nitrogen tank. Upon thawing, crypts from frozen rat tissues failed to develop into organoids due to structural damage, suggesting the need for fresh tissues or optimized preservation methods. In contrast, mouse-derived organoids showed viability for 7 days, with distinct morphological changes and clear differentiation by Day 7. Quantitative real-time PCR analysis revealed that Lgr5, a stem cell marker, showed significantly higher expression in organoids than in tissues, confirming the successful establishment of the organoid culture. Among epithelial markers, the antimicrobial enzyme Lyz1 was more highly expressed in organoids, while Muc2, a key goblet cell marker, was more highly expressed in male tissues. The enterocyte marker Alp exhibited higher expression in male organoids compared to females, with no sex differences in tissues. These findings highlight sex-specific differences in gene expression related to small intestine differentiation and demonstrate the challenges in organoid culture from frozen rat tissues. The results suggest the importance of immediate tissue processing or improved preservation methods for successful organoid cultures.

INTRODUCTION

Organoids serve as a bridge model between 2D cell culture and animal models, providing a versatile platform for research. Organoids are 3D cellular clusters that mimic the functional characteristics of organs and recent advancements in tumor organoid research have significantly contributed to personalized medicine by predicting how patients will respond to certain drugs [1,2]. While numerous studies on organoid cultures are underway, research involving women has been relatively insufficient due to hormonal factors. Thus, it is necessary to conduct comparative studies that consider sex differences [3,4].

Currently, organoid research is actively being conducted in various tissues, including the digestive system [5,6]. Among the digestive organs, the small intestine plays a crucial role in nutrient absorption, a process facilitated by digestive enzymes located in the brush border membrane [7,8]. The small intestine is divided into the duodenum, jejunum, and ileum, each of which plays a specific role in digestion and absorption [9]. The duodenum receives digestive fluids from other organs to aid in chemical breakdown, while the jejunum mixes digestive fluids and nutrients for absorption [10]. The ileum completes nutrient absorption and transfers the remaining material to the large intestine while also playing a key role in immune defense [11,12].

Intestinal organoids are characterized by crypt and villi structures, which can be observed as finger-like shapes during organoid culture [13,14]. Dr. Hans Clevers’ group [15] developed an organoid culture technique using LGR5+ stem cells isolated from adult mouse intestines. This technique, which involves culturing cells in a collagen rich Matrigel environment [16], mimics the extracellular matrix and produces organoids with functional properties similar to adult intestines [15,17]. These organoids contain various cell types and exhibit structural and functional similarities to actual organs, making them valuable for research purposes [18].

To assess the characteristics of intestinal organoids, markers such as epithelial (Lyz1, Muc2 and Alp) and intestinal stem cell markers (Lgr5) can be used to measure mRNA expression. Lysozyme 1 (Lyz1), mucin 2 (Muc2), alkaline phosphatase (Alp) and leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5) are key markers used to assess the characteristics of intestinal organoids. Lyz1 serves as a marker for Paneth cells, which play a critical role in gut immunity by secreting antimicrobial peptides. Muc2 identifies goblet cells responsible for producing mucus that protects the intestinal lining. Alp is used as a marker for enterocytes, the absorptive cells that aid in digestion within the intestinal epithelium. Finally, Lgr5 is a widely recognized marker for intestinal stem cells, essential for tissue regeneration and maintenance in the gut [19,20].

The Wnt signaling pathway is crucial in the small intestine, where it regulates the proliferation of intestinal stem cells and their differentiation into various specialized cell types [21,22]. This pathway governs essential processes such as stem cell proliferation, self-renewal, differentiation [23] and maintenance of the intestinal microenvironment, all of which are vital for intestinal tissue health and regeneration [24,25]. To culture small intestinal organoids, epidermal growth factor (EGF), expressed Wnt3a, Noggin, and R-spondin1 medium (ENR) is used to meet the specific growth requirements of the intestinal epithelium [6].

Each component of the ENR medium has a distinct role: EGF promotes epithelial cell proliferation, supporting tissue growth and renewal [26]; Wnt3a activates the Wnt signaling pathway, which maintains the stem cell population in the crypts; Noggin inhibits bone morphogenetic protein signaling, thereby sustaining stem cell activity and renewal by preventing the suppression of stem cell proliferation; and R-spondin1 enhances Wnt signaling, promoting crypt cell proliferation and supporting tissue regeneration [27,28].

The ENR medium can be derived from the conditioned medium of L-WRN cell cultures, which provide these essential growth factors in a balanced environment. This medium creates optimal conditions for the proliferation, differentiation, and maintenance of intestinal epithelial cells, enabling the successful culture of small intestinal organoids [29]. Frozen tissues enable long-term storage and remote sample transport, but the effects of the freezing process on cell viability and organoid characteristics remain unclear. By analyzing differences between fresh and frozen tissue-derived organoids, we aim to evaluate their experimental applicability.

Despite the small intestine’s importance as a digestive organ, research on it has been limited due to its relatively low disease incidence in humans [30]. Therefore, after establishing organoid culture techniques for the small intestine, differences between organoid cultures and tissues will be examined, as well as comparisons across sexes. Additionally, due to unavoidable circumstances, immediate organoid culture may not always be feasible. We hypothesized that organoids derived from fresh small intestine tissues would exhibit superior quality and physiological characteristics compared to those derived from frozen tissues lacking stock media. Furthermore, sex-specific biological variations are expected to influence organoid cultures derived from male and female C57BL/6 mice. As one example, sex-based differences in inflammatory bowel disease (IBD) have been reported in clinical studies, but the underlying cellular mechanisms remain unclear. One study analyzed sex-specific differences in inflammatory responses using human IBD-derived intestinal organoids. The results demonstrated morphological changes and differences in cytokine expression in male and female organoids following TNF-α stimulation. These findings suggest the need to consider hormonal, genetic, and molecular factors that contribute to sex-based differences in organoids [31]. From this background the aims of this study were to establish small intestine organoid culture system using C57BL/6 mice, to investigate sex-specific differences in organoid characteristics, and to compare the quality and functionality of organoids derived from fresh tissues with those cultured from frozen small intestine tissues with stock media.

MATERIALS AND METHODS

Animal care and sacrifice

Sixteen-week-old male (n = 4) and female (n = 4) F344 rats (Orient Co.) and eight-week-old male (n = 9) and female (n = 9) C57BL/6 mice (Orient Co.) were housed in cages and maintained at 23°C with a 12/12-hour light/dark cycle under specific pathogen-free conditions. All rats and mice were housed in the same room in filter-top cages, with two rats per cage and three to five mice per cage. Both rats and mice were marked so that individual animals could be followed for the duration of the experiments. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the Seoul National University Bundang Hospital (BA-2305-367-005-02 [rat], BA-2309-375-002-02 [mouse]). The procedures were carried out in accordance with the Animals in Research: Reporting of in Vivo Experiments (ARRIVE) guideline. Animals were euthanized by CO₂ asphyxiation and small intestine tissues were collected.

Viability of tissue culture after freezing in storage solution

Sixteen-week-old female and male rats were sacrificed to obtain small intestine tissues, which were placed in a storage solution and kept in a freezing container using isopropanol at –80°C in a deep freezer for one day before being transferred to a nitrogen tank at –180°C for storage. After thawing and washing the tissues, the crypts of the small intestine tissues were isolated. The composition of the storage solution is as follows: 60% Dulbecco’s modified Eagle medium (DMEM/F12; Gibco, 31330-038), 30% FBS (Gibco, 16000-044), and 10% dimethyl sulfoxide (Sigma, D2660-100 mL) [32].

Preparation of conditioned media from L-WRN cell culture

L-WRN cells were cultured to prepare conditioned media, following the American Type Culture Collection (ATCC) standardized protocol to ensure consistency and optimal production of necessary growth factors. L-WRN cells were kindly provided by Professor Yoon Seok Seo from the Department of Surgery at Seoul National University Bundang Hospital. A brief description of the standardized protocol is as follows. Cells were obtained from the ATCC (CRL-3276) and were maintained in DMEM (ATCC, 30-2002) supplemented with 10% FBS (Gibco, 16000-044), 0.5 mg/mL hygromycin B (Roche, 10843555001), 0.5 mg/mL G418 (Geneticin; Gibco, 10131-035) to maintain selective pressure for Wnt3a, R-spondin3, and Noggin expression. Cells were rapidly thawed in a 37°C water bath for 1 to 2 minutes until fully thawed. The cell suspension was transferred into 15 mL conical tube containing 5 mL of pre-warmed complete culture medium and centrifuged at 200 × g for 5 minutes. The supernatant was carefully aspirated, and the cell pellet was resuspended in 10 mL of fresh complete medium. Cells were then seeded into T-75 culture flasks and incubated in a humidified incubator at 37°C with 5% CO₂. Cell growth was monitored daily, and medium was replaced every 2 to 3 days. Subculturing was performed when the cells reached about 80% confluence. To prepare conditioned media, L-WRN cells were cultured until they reached approximately 90% confluence. Fresh complete medium, without G418 and hygromycin B, was added to the flasks, and they were incubated at 37°C with 5% CO₂. The second, third, and fourth conditioned media (supernatants) were collected every 24 hours. The conditioned media was aliquoted into sterile 50 mL conical tubes and stored at –20°C for short-term use or –80°C for long-term storage.

Extraction of crypts from small intestines of rats and mice

To begin the isolation of intestinal crypts from mice, a segment of the small intestine approximately 10 cm in length from the mouse was obtained, and the lumen was carefully flushed with a 10 mL syringe filled with Dulbecco’s PBS (DPBS; Welgene, LB 001-02) to thoroughly clean the internal surface. Once the small intestine is cleaned, it was cut longitudinally and sliced into 5 mm sections. These sections were transferred into a cold DPBS solution (10 mL) and washed three times by filtering to remove any debris. After washing, the small intestine tissue was placed in DPBS containing 2 mmol/L ethylenediaminetetraacetic acid (Invitrogen, 15575020) and incubated at 37°C with 5% CO₂ for 15 minutes to facilitate tissue loosening. Following incubation, the supernatant was removed, and 1 mL of cold DPBS was added to the tissue. The tube was vigorously shaken by hand for approximately 1 minute to dislodge the crypts, and this process was repeated three times. The collected crypts from each repetition were transferred into a 15 mL tube that had been rinsed with bovine serum albumin (BSA; GenDEPOT, A0100-010) and centrifuged at 20 × g for 5 minutes at room temperature. If the crypts were not well-separated, additional centrifugation was performed at a speed between 50 and 150 × g, ensuring that low-speed centrifugation selectively collected heavier epithelial units without single cells. After centrifugation, the supernatant was carefully removed, and the collected crypts were resuspended in 3 mL of DPBS containing 2% BSA. The cell strainer was washed twice more, with each wash followed by centrifugation at 100 × g for 3 minutes at room temperature, using a total of 9 mL of wash solution. Finally, the resulting crypt pellet was resuspended in 1 mL of media, and the number of crypts was counted using a microscope.

Organoids culture from isolated crypts

Once the desired number of crypts is obtained, centrifuge at 200 × g for 5 minutes at room temperature. Following centrifugation, the supernatant was removed, and the pellet was resuspended in Matrigel (Corning, 356231) by pipetting up and down 10 times before incubating the mixture on ice. A total of 50 µL aliquots of the Matrigel-crypt mixture were dispensed into a pre-warmed 24-well plate, ensuring that the pipette tip did not touch the bottom of the wells. The plate was then incubated at 37°C with 5% CO₂ for 10 minutes to allow the gel to solidify, handling carefully while placing it in the incubator. After the gel had set, 500 µL of complete organoid growth medium (conditioned media) was gently added along the wall of each well to avoid disrupting the gel. The plate was then incubated at 37°C with 5% CO₂. The culture medium consisted of Advanced DMEM/F-12 (Gibco, 12634028) supplemented with 20% FBS, 1% penicillin/streptomycin (Gibco, 15140-148), 10 mmol/L HEPES (Gibco, 15630-080), GlutaMAX (Gibco, 35050-061), and 50% L-WRN conditioned media [33]. The media was replaced every 2 to 3 days. For subculturing, organoids that had been cultured for 7 days were transferred using Cultrex Organoid Harvesting Solution (Cultrex, 3700-100-01). Organoids were passaged at a 1:5 ratio. Finally, fresh medium and Matrigel were added for the continued culture of the organoids.

Quantitative real-time PCR analysis

RNA was isolated from small intestinal organoid cultured on Matrigel using Trizol (Invitrogen, 15596018) reagent according to the manufacturer’s instruments and quantified using a NanoDrop ND-1000 device (Thermo Scientific). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). Quantitative real-time PCR (RT-qPCR) was performed using Power SYBR Green PCR Master Mix (Thermofisher, 4367659) and Viia7 instrument (Applied Biosystems). All experiments were conducted in duplicate. The mRNA expression levels were normalized to the endogenous expression of glyceraldehyde 3-phosphate dehydrogenase. The sequences of the primers are provided in Table 1 [19].

Table 1.

Quantitative real-time PCR primers information

Target gene	Sequence (5’ → 3’)	Annealing temperatures (°C)
Lgr5	F: ACA TTC CCA AGG GAG CGT TC R: ATG TGG TTG GCA TCT AGG CG	60
Lyz1	F: GCC AAG GTC TAC AAT CGT TGT GAG TTG R: CAG TCA GCC AGC TTG ACA CCA CG	60
Muc2	F: TTT CAA GCA CCC CTG TAA CC R: AGG TCC TGG TGT TGA ACC TG	60
Alp	F: AACTCACCTCATGGGCCTCTT R: GGGTTTCGGTTGGCATCATA	60
Gapdh	F: TCATCAACGGGAAGCCCATCAC R: AGACTCCACGACATACTCAGCACCG	60

Lgr5, leucine-rich repeat-containing G-protein coupled receptor 5; F, forward; R, reverse; Lyz1, lysozyme 1; Muc2, mucin 2; Alp, alkaline phosphatase; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.

Statistical analysis

Data are expressed as the mean ± SEM of at least two independent samples. Statistical comparisons between groups were performed with two-tailed Student’s t-tests or two-way ANOVA with Dunnett’s T3 tests. Differences with P-values of less than 0.05 were considered significant.

RESULTS

L-WRN cell culture for conditioned media

The timeline for L-WRN cell culture begins with cell seeding in Media without G418 and hygromycin B (Fig. 1A). Cells are allowed to grow without the selective pressure of antibiotics for optimal expansion before conditioned media collection. On Day 1, after seeding, the culture shows early stages of growth and adherence to the culture dish surface. By Day 2, cells exhibit significant proliferation, reaching a confluence of approximately 50% to 60%. By Day 4, the culture reaches 90% confluence, signaling readiness for conditioned media collection (Fig. 1B) [29].

Figure 1. L-WRN cells were cultured to prepare conditioned media for small intestinal organoid culture (CKX53, CKX3-SLP [OLYMPUS]; magnification, 10Χ).

(A) L-WRN cell culture schedule. (B) Result images of L-WRN cell culture on Days 1, 2, and 4. On Day 1, initial cell seeding shows minimal growth as cells begin to adhere to the culture surface. On Day 2, significant cell proliferation is observed, with approximately 50% to 60% confluence. On Day 4, the culture reaches around 90% confluence, indicating robust cell growth. After reaching this stage, Dulbecco’s modified Eagle’s medium (DMEM without G418 and hygromycin B) is introduced, and conditioned media is collected over the next three days for use in organoid culture.

At this point, DMEM is added to the culture for further growth and the collection of conditioned media. Media is harvested daily and stored, ensuring that the secreted factors beneficial for organoid culture are preserved. The conditioned media collected over several days is then pooled for use in subsequent organoid experiments.

Day 1: Initial cell seeding shows minimal growth. Cells are scattered and begin the process of adhering to the culture surface, with little visible confluence. At this stage, the primary focus is on cell survival and attachment rather than growth growth (Fig. 1B).

Day 2: The culture demonstrates significant proliferation, with cells spreading across the dish surface. By Day 2, approximately 50% to 60% confluence is observed, indicating that the cells are actively dividing and expanding. This is a critical point in the culture process as the cell population expands towards forming a dense monolayer (Fig. 1B).

Day 4: By Day 4, the culture has reached about 90% confluence. The cells form a dense, continuous monolayer, indicating robust growth and readiness for the next stage of media collection. At this point, the culture is maintained for harvesting conditioned media, which is essential for providing the growth factors necessary for small intestinal organoid development (Fig. 1B).

The images clearly demonstrate the gradual increase in cell density, reflecting the successful growth and health of the L-WRN cells. The timeline emphasizes the importance of precise monitoring and timing in the culture process to ensure the production of high-quality conditioned media, which is crucial for organoid experiments.

Cell viability based on tissue condition

Cell viability was found to be significantly influenced by the preservation state of the tissues. Fresh tissues exhibited much higher viability compared to frozen tissues stored in cryopreservation media (Fig. 2). Specifically, the viability of fresh tissues was measured at 28% for male samples and 13% for female samples (Fig. 2B). In contrast, frozen tissues stored in liquid nitrogen and thawed for crypt isolation showed a drastically reduced viability of only 1% in both male and female samples (Fig. 2A). This stark difference highlights the negative impact of freezing and thawing processes on cell viability, even when cryopreservation media designed to minimize damage were used. These findings suggest that the composition of the cryopreservation media might not have been optimal and that fresh tissues, with their superior cell viability and structural integrity, are more suitable for organoid culture and related applications.

Figure 2. Differences in cell viability between fresh tissue and frozen tissue samples preserved in stock solution.

(A) Frozen tissue samples stored in cryopreservation media. (B) Fresh tissue samples. Fresh tissues showed significantly higher cell viability (28% in males, 13% in females) compared to frozen tissues stored in stock solution (1% in both), highlighting the negative impact of freezing and thawing processes in stock solution on cell viability.

Organoid culture after isolation of crypt from frozen tissue stored in stock media

In this study, crypts were isolated from frozen tissue stored in stock media to culture organoids. During the thawing process, it was difficult to effectively separate the crypts from the frozen tissue, and the tissue integrity appeared compromised. This made it challenging to maintain crypts for further culture. As shown in Figure 3A and 3B, neither the male nor female samples exhibited clear crypt structures after thawing. This result suggests that the composition of the cryopreservation media may have been incorrect, which affected the preservation of the crypts.

Figure 3. Crypt isolation and organoid culture in male and female mice (CKX53, CKX3-SLP [OLYMPUS]; magnification, 10Χ).

Images on the left show crypts isolated from the small intestines of male (A) and female (B) mice. The right panels display the corresponding organoid cultures after several days, showing clear differentiation in both sexes. The male-derived organoids (C) exhibit notable morphological changes, like those observed in the female derived organoids (D).

Despite the difficulties in isolating crypts, organoid culture was performed under the assumption that some crypts might still be present. The samples were incubated on Matrigel for seven days, but no significant changes or growth were observed (Fig. 3C and 3D). Both the male and female samples showed no signs of organoid formation after incubation. The lack of morphological changes suggests that the frozen tissues likely did not contain viable crypts after thawing. The absence of crypt expansion and organoid development indicates that the cryopreservation process was not effective, likely due to an incorrect media composition, resulting in the loss of viable crypts necessary for organoid culture.

Isolating crypts from fresh tissue

In the second part of the study, wild-type organoid cultures were derived from freshly isolated small intestine crypts. Crypts were manually isolated from both male and female mice immediately after obtaining the small intestine tissue [19]. As illustrated in Figure 4, crypts from male (Fig. 4A) and female (Fig. 4B) mice exhibited distinct and well-preserved structures compared to the previous experiment using frozen tissues. The difference in crypt quality was evident, highlighting that isolation from fresh tissue is significantly more efficient [34].

Figure 4. Manually isolating crypts from mice small intestine tissue (CKX53, CKX3-SLP [OLYMPUS]; magnification, 10Χ).

(A) Crypts from male (M) mice. (B) Crypts from female (F) mice. Crypts isolated from fresh small intestine tissues of male and female mice showed significantly better preservation and structure compared to those isolated from cryopreserved tissues.

The clear distinction between the crypts isolated from fresh tissue and those from cryopreserved tissue suggests that fresh tissue provides better conditions for crypt preservation and isolation. The fresh small intestine tissues yielded crypts that appeared more intact, facilitating their use in subsequent organoid cultures. This result underscores the importance of using fresh tissues for optimal crypt isolation, as opposed to frozen tissue, which compromises crypt integrity and hinders successful isolation and subsequent culture. The outcome from this experiment confirms that fresh tissue offers a more reliable source for crypt isolation, enabling more efficient and viable organoid cultures.

Fresh tissue-derived crypt isolation and organoid culture efficacy compared between male and female

Fresh crypts were isolated from tissues and cultured in Matrigel for 7 days, with organoid morphology assessed at time points (Day 3, Day 5, and Day 7; Fig. 5). Both male-and female-derived organoids displayed progressive growth and differentiation, as shown in Figure 5. By Day 7, significant differentiation was observed in both male and female organoids, indicated by the distinct morphological structures (arrows) that formed.

Figure 5. Organoid culture after isolation of crypt from mice small intestine tissue (CKX53, CKX3-SLP [OLYMPUS]; magnification, 10Χ).

Fresh crypts cultured in Matrigel for seven days showed progressive growth and differentiation in both male-and female-derived organoids. By Day 7, distinct morphological structures were formed in both, indicating successful differentiation. Blue arrows indicate representative differentiated organoid structures, such as budding regions or lumen formation.

In Figure 5, male-derived crypts on Day 7 exhibited visible differentiation, with organoids forming more distinct structures compared to earlier days. Similarly, female-derived crypts also showed differentiation by Day 7, with comparable morphological changes to those in male organoids. These findings suggest that organoid development progresses effectively over time, particularly in fresh tissue-derived cultures [34].

Figure 6 presents a quantitative comparison of the number of organoids formed between male and female samples. As shown in Figure 6A, the number of organoids increased progressively over time for both sexes, but female-derived samples generated a significantly higher number of organoids compared to male-derived samples. This trend is further emphasized in Figure 6, which highlights the overall difference in organoid formation after 7 days of culture. Female-derived crypts exhibited a more robust organoid-forming potential than male-derived crypts, indicating a statistically significant difference.

Figure 6. The number of organoids formed on Day 7 after culturing organoids for each of the male (M) and female (F) mice.

(A) Organoid counting across entire population. (B) Comparison of organoid counting between male and female. Graph shows that both male-and female-derived crypts increased organoid formation over time, but female-derived samples consistently produced significantly more organoids. By Day 7, female crypts exhibited a higher organoid-forming potential compared to male crypts. This indicates a statistically significant sex difference in organoid formation efficiency. The P-values were calculated to compare differences between two independent groups.

The correlation between Figure 5 and 6 shows that fresh tissue-derived crypts from both males and females efficiently form organoids and undergo differentiation. However, female-derived crypts consistently produced more organoids, suggesting that sex may influence organoid formation potential [3]. These results suggest an inherent biological difference, showing sex-based variation in the efficiency of organoid formation, meriting further investigation.

These observations highlight that the use of fresh tissue for crypt isolation and subsequent organoid culture is more effective than frozen tissue, particularly in terms of differentiation and organoid yield with female-derived crypts showing greater efficacy.

Comparison of organoid cultures and deep-frozen tissue samples with marker-specific analysis

A detailed comparison was conducted between fresh organoid cultures and tissues that were immediately deep-frozen after collection, as shown in Figure 7. RT-qPCR was used to assess the expression of specific markers to compare the differentiation and stem cell characteristics between organoids and tissue samples.

Figure 7. Quantitative real-time PCR analysis.

(A) Gene expression of Lgr5, Muc2, and Alp in fresh organoids (n = 18) versus tissue (n = 18) samples. (B) Comparison of Lyz1, Alp, and Muc2 expression in male (M; n = 9) and female (F; n = 9) organoids and tissue samples. Figure 7 compared marker expression between fresh organoid cultures and deep-frozen tissue samples, showing higher Lgr5 expression in organoids and higher Muc2 levels in tissues, indicating more differentiation in tissue samples. Male organoids showed higher Lyz1 and Alp expression than female organoids and male tissues, suggesting sex-specific differences. The P-values were calculated for the comparison differences between independent two groups. Lgr5, leucine-rich repeat-containing G-protein coupled receptor 5; Lyz1, lysozyme 1; Alp, alkaline phosphatase; Muc2, mucin 2; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.

The Lgr5 marker, known as a stem cell marker, is primarily expressed in intestinal stem cells located in the crypt base, responsible for the regeneration of the intestinal lining [35]. In Figure 7A, Lgr5 showed significantly higher expression in organoid cultures than in tissue samples. This result confirms the establishment of organoids, as stem cells are enriched and proliferate more efficiently in the organoid model compared to frozen tissues, which may have lost some stem cell functionality during freezing [36].

In contrast, the Muc2 marker, which is a key goblet cell marker encoding mucin 2, a major component of the intestinal mucus layer, was expressed more strongly in tissue samples than in organoids [25]. Muc2’s higher expression in tissues (Fig. 7A) can be explained by the fact that goblet cells are fully differentiated in the tissues, while organoids remain in a less differentiated state. Muc2 plays a crucial role in protecting the intestinal lining by forming a barrier and its higher levels in tissue indicate more mature and differentiated goblet cell population [37].

Subsequently, sex-based comparison was conducted, and several markers showed notable differences between male and female organoids and tissues. Lyz1, an antimicrobial enzyme marker, which is involved in maintaining intestinal microbial balance by breaking down bacterial cell walls, showed higher expression in male organoids compared to male tissue samples. This suggests that the male derived organoids may have heightened ability to produce lysozyme, which could be beneficial for studying immune responses in intestinal organoid models [38].

The Alp marker, an enzyme associated with cell membrane integrity and phosphate metabolism, is commonly found in tissues such as bones, liver, and intestines [39]. In this study, Alp exhibited no significant sex differences in tissue samples. However, in organoids, Alp expression was significantly higher in male organoids compared to female organoids, as shown in Figure 7B. This observation could be related to known biological differences in alkaline phosphatase activity between males and females. Alp levels tend to be higher in males, particularly in younger individuals, which aligns with findings in previous literature that report increased levels in males until around age 40 [40]. The heightened expression of Alp in male organoids may reflect these physiological differences, making male organoids more responsive in certain metabolic contexts.

Finally, Muc2 again showed stronger expression in male tissues compared to male organoids, like the overall trend seen earlier, where tissue samples consistently displayed more differentiation. The role of Muc2 in maintaining mucosal barriers and its extensive presence in fully differentiated goblet cells explain this trend [37].

Together, these results illustrated in Figure 7 provide a comprehensive view of organoid versus tissue-specific expression for key markers like Lgr5, Muc2, Lyz1, and Alp, while also revealing the influence of sex on these markers, particularly in the context of organoid culture. This study underscores the importance of using fresh tissue for crypt isolation and subsequent organoid culture, as well as the significant biological differences between male and female organoids, which could inform future research on sex specific intestinal functions and disease models. These findings highlight the importance of fresh tissue for crypt isolation and reveal biological variations between male and female organoids.

DISCUSSION

This study successfully established an organoid culture system using small intestine crypts derived from fresh tissues of male and female C57BL/6 mice. The comparison between fresh and frozen tissues provided significant insights into the efficacy of organoid formation, and further analysis revealed sex-specific differences in marker expression. These results offer a comprehensive understanding of how organoids, particularly from fresh tissue, better mimic the biological characteristics of the intestine compared to frozen samples, and how male and female organoids behave differently.

Firstly, the comparison between fresh and frozen tissues indicated a clear advantage for fresh tissues in organoid formation. As illustrated in the results, organoids derived from fresh tissue exhibited better structural integrity and were capable of undergoing differentiation by Day 7, confirming that crypts isolated from fresh tissue are more viable. Frozen tissues, on the other hand, showed compromised crypt integrity and failed to form proper organoids, likely due to improper preservation methods that may have led to the loss of cellular viability. These findings emphasize the importance of using fresh tissues for organoid culture, especially when high viability and differentiation potential are crucial.

In terms of marker-specific analysis, stem cell marker Lgr5 was significantly more expressed in organoid cultures compared to tissues, highlighting that organoid models better maintain and propagate stem cell populations. This reinforces the organoid’s ability to replicate stem cell activity, which is critical for studies involving regeneration and tissue repair. In contrast, Muc2, a goblet cell marker, was expressed more strongly in tissue samples than in organoids. This suggests that goblet cell differentiation is more complete in native tissues, while organoids remain in a less differentiated state. The structural and functional difference between tissues and organoids, particularly in goblet cell maturation, points to the limitations of organoids in fully recapitulating some differentiated cell types.

The sex-based analysis revealed several interesting findings. Lyz1, an enzyme crucial for antimicrobial defense, was expressed more strongly in male organoids compared to male tissues, indicating that male-derived organoids may be more responsive in immune related studies. This highlights a potential sex-specific feature of organoids that could be valuable in immunological research. On the other hand, Alp, an enzyme involved in phosphate metabolism and commonly expressed in intestinal and bone tissues, showed significantly higher expression in male organoids than female organoids. This mirrors physiological trends where males tend to exhibit higher Alp activity, particularly in younger individuals. The observed sex difference in Alp expression in organoids could offer new insights into metabolic and developmental differences between sexes.

In the initial attempts to culture intestinal organoids, IntestiCult™ Organoid Growth Medium (mouse; STEMCELL Technologies, 06005) was used. However, challenges were observed in maintaining consistent culture performance across male and female samples. Additionally, the fixed composition of this commercially available medium limited its adaptability to specific experimental requirements. The high cost further constrained its utility for extensive experimental applications. To address these limitations, alternative media compositions, including Sato medium, Fujii medium, and Miyoshi medium, were evaluated based on prior studies [33]. Among these, Miyoshi medium demonstrated superior performance in supporting intestinal cell differentiation and maintaining organoid structural integrity. This finding suggests that Miyoshi medium provides a cost-effective and customizable alternative for intestinal organoid culture. Further investigations could explore the potential of Miyoshi medium in other organoid systems or optimize its composition to achieve enhanced cellular outcomes.

One notable limitation of this study is the lack of investigation into the potential of organoid cultures as disease models. While current research effectively establishes and analyzes the fundamental characteristics of organoids derived from fresh and frozen tissues, it stops short of applying these models to study disease pathology or test drug efficacy. Organoid systems hold significant promises for simulating disease conditions and evaluating therapeutic interventions [41]. The absence of this application in the current study represents a missed opportunity to explore the practical utility of organoids in translational research.

Additionally, the study’s reliance on marker expression at the mRNA level without corroborating these findings with protein-level analysis could be seen as another limitation. The inclusion of techniques such as Western blotting or immunohistochemistry would provide more comprehensive understanding of the functional differences between organoids and tissues, particularly regarding stem cell maintenance, differentiation, and sex-specific responses.

Moreover, while the study highlights sex-specific differences, it does not delve deeply into the underlying mechanisms driving these variations. Future research could benefit from exploring hormonal or genetic factors that contribute to the observed differences in marker expression between male and female organoids. Such investigations could provide more robust insights into how sex influences organoid biology and its implications for personalized medicine [4].

In summary, fresh tissue is more effective for establishing viable and differentiating organoids, while frozen tissues may not be as reliable due to structural damage. The study demonstrates that organoids can maintain specific stem cell characteristics better than tissue, although fully differentiated cell types, such as goblet cells, are less well-represented in organoids. Mouse-derived organoids demonstrated viability for 7 days, showing distinct morphological changes and clear differentiation, while frozen rat tissues failed to develop into organoids, highlighting the importance of immediate tissue processing or optimized preservation methods. Additionally, the observed sex-specific differences in gene expression, with male organoids showing higher expression of the enterocyte marker Alp and female tissues exhibiting greater expression of the goblet cell marker Muc2, emphasize the need to consider sex as an important variable in organoid-based research, particularly in intestinal biology and disease models.

These findings pave the way for further exploration into sex-specific responses in organoid cultures and highlight the potential of using organoid models for studying a wide range of intestinal functions and pathologies.

Funding Statement

FUNDING This work was supported by the Technology Innovation Program (20018499) funded by the Ministry of Trade, Industry & Energy (MOTIE, Korea).