Skip to main content
NCBI home page
Health Science Reports logoLink to Health Science Reports
. 2025 Apr 18;8(4):e70612. doi: 10.1002/hsr2.70612

Molecular Characterization and Analysis of Human Trichostrongylus Species in an Endemic Region of Iran Based on COX 1 Gene; A Cross‐Sectional Study

Sara Nemati 1, Hanieh Mohammad Rahimi 1, Meysam Sharifdini 2,✉, Hamed Mirjalali 1,✉
PMCID: PMC12007466  PMID: 40256140

ABSTRACT

Background and Aims

Trichostrongylus species are the causative agents of zoonotic disease, which has been frequently reported from animals in Iran. The aim of this study was to identify, molecular characterization and analysis of Trichostrongylus species isolated from humans, in an endemic region, based on cytochrome c oxidase (COX) 1.

Methods

A total of 206 fresh stool samples were collected from residents of endemic villages of sampling area. All samples had been examined using conventional parasitological methods, along with the PCR technique. After amplification and sequencing of a discriminative region of COX1 gene, the phylogeny relationship, haplotype network, and molecular diversity between Trichostrongylus spp., were scrutinized using PopART networking, DnaSP v.6, and MEGA10 software.

Results

In total, from 206 fecal samples, 71 people (34.4%) were infected with Trichostrongylus spp. The ~700‐bp fragment of the COX1 was amplified in all 71 morphological positive samples, however, 33 samples were successfully sequenced, belonging to Trichostrongylus spp. In this study, T. colubriformis was the predominant species and one sequence was characterized as T. vitrinus. Our sequences were grouped together with sequences, which were obtained from animals in the same region (97.17% similarity). In total, 26 haplotypes were identified and haplotype diversity ranged from 0.988 ± 0.012.

Conclusions

In view of the importance of Trichostrongylosis to public health as zoonotic infection, information about its prevalence in animal and human populations can provide valuable information on how different types of this parasite are transmitted between people and animal's host.

Keywords: cytochrome oxidase gene, Iran, phylogenetic analysis, Trichostrongylus, zoonotic infection

1. Introduction

Among ruminants, Trichostrongylus spp., are common gastrointestinal parasitic pathogens with a global spread [1, 2, 3, 4, 5, 6]. These nematodes provide serious health risks, reduce animal products and in severe forms may lead to death in animals [7, 8, 9]. Trichostrongilosis is generally asymptomatic and little is known about its pathogenesis and zoonotic aspects. The clinical manifestations of infection in humans range from mild (malaise, generalized fatigue, dizziness, flatulence, diarrhea, nausea, and abdominal pain) to severe symptoms (anemia, cholecystitis, and emaciation). In severe forms of infection, Trichostrongylus can cause mild anemia [10, 11, 12]. The clinical symptoms in human are generally not severe; however, some people may complain from gastrointestinal discomfort and eosinophilia [3].

Due to the importance of zoonotic diseases, and the close relationship between human with animal [3, 13], Trichostrongylus spp. represented a major public health problem over the world [14]. Application of nonchemical fertalizers such as night‐soils increases the risk of transmission of this nematod to humans [3]. Human as incidental hosts, become infected upon ingestion of infective filariform (L3) larvae of the parasite in contaminated food or water resources [3, 6, 15]. Until now, 12 species for Trichostrongylus spp. have been reported from humans [1, 12, 16]. The human infections in the Middle East are mostly assigned to T. colubriformis and T. orientalis [17, 18]. The prevalence of Trichostrongylus infection in the general population in Iran is 10% (95% CI: 1.6% to 17%) [19], and Fuman city is considered as an endemic region for human trichostrongylosis [18].

For the phylogenetic investigation of Trichostrongylus and the genetic variation within it, molecular analyses based on the internal transcribed spacer (ITS) and 28S region of the ribosomal DNA (rDNA) genes were employed [2, 5, 16, 20]. Although most of studies have employed ITS2 fragment to analyze the genetic variations and phylogenetic relationships of the Trichostrongylus spp. [14, 21], mitochondrial (mt) fragments can provide more data [22, 23, 24]. The mt genes (mitogenome) are highly conserved genetic fragments, which makes them a valuable resource to study the DNA structure and the evolutionary and phylogenetic relationships of species [25]. Accordingly, few studies have employed mtDNA to identify species of the Trichostrongylidae family [26, 27], and there are few publications on the mt gene of nematodes from Iran [14, 28, 29]. In this regard, the current research aimed to characterize and phylogenetically analyze the cytochrome c oxidase subunit I (COX1) from the mitochondrial gene of Trichostrongylus species in human samples collected from an endemic region in north of Iran.

2. Methods

2.1. Ethical Approval

This project was approved by the Ethical Review Committee of the Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, (IR. SBMU. RIGLD. REC.1400.011).

2.2. Samples and Study Area

A total of 206 fresh stool samples were collected from villagers in Guilan province, northern Iran, from June to October 2020. The stool samples collected were immediately transferred to the Department of Parasitology and Mycology, Guilan University of Medical Sciences. Guilan has a humid subtropical climate with, by a large margin, the heaviest rainfall in Iran: reaching as high as 1900 millimeters (75 in) in the southwestern coast and generally around 1400 millimeters (55 in), which all provide a suitable condition for transmission of soil transmitted helminths (STHs). Fuman County is in Gilan province, in northwestern Iran; its capital is the city of Fuman. It is only 21 km to the west‐southwest of Rasht, the capital of the province, and 356 km away from the national capital Tehran (Figure 1).

Figure 1.

Figure 1

Open in a new tab

Geographical map of Guilan province, Fuman district, North of Iran.

2.3. Genomic Characterization

In this study, identification of Trichostrongylus spp. was determined based on the morphological characters and flotation methods [30]. Accordingly, 2–3 g of stool samples were floated in 20 mL of saturated sodium chloride solution in a test tube with a coverslip on the top. After 15 min, the coverslip was lifted and screened by a light microscopy (Willis technique). All samples, which were parasitologically positive for Trichostrongylus spp., were directed to molecular investigation. For this purpose, a commercial DNA extraction kit (Yektatajhiz, Tehran, Iran) was employed to extract total DNA from stool samples, which were identified positive for Trichostrongylus spp. Briefly, the supernatant of Willis method was collected, washed twice with distilled water, and introduced to the DNA extraction process. Extracted DNA was stored at −20°C for PCR amplification.

The identical fragment of the COX1 gene, with approximately 700 bp length, was amplified using the LCO1490 (5′‐GGTCAACAAATCATAAAGATATTGG‐3′) and HCO2198 (5′‐TAAACTTCAGGGTGACCAAAAAATCA‐3′) primers. The reaction mixture, conditions, and protocol for the polymerase chain reaction amplification were done based on the previously mentioned study [31]. The PCR amplification was performed in 20 µl volumes containing 2X red PCR premix (Ampliqon, Odense, Denmark), 10 pmol of each primer, and 3 µl of extracted DNA (20–50 ng). The thermal PCR protocols included an initial denaturation step at 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 40 s, annealing at 54°C for 90 s, an initial extension step at 72°C for 60 s, and a final extension step at 72°C for 10 min. PCR products were visualized by electrophoresis using 1.5% agarose, and staining with 7 μl/100 ml of ethidium bromide. All PCR products resulted from the amplification of identical fragment in stool samples were directly sequenced using by a 3130 ABI sequencer.

2.4. Sequencing, Phylogenetic and Networking Analyzing

Sequencing of the PCR products was performed by Sanger sequencing method, which was carried out in an automated DNA analyzer (ABI 3730XL, Applied Biosystems, USA). All generated sequences were manually trimmed and edited using BioEdit and using Chromas (version 2.6) software, and compared to the GenBank database through basic local alignment search tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to characterize genus and species. All sequences were deposited to the GenBank database with accession numbers: OR429439‐OR429471.

To illustrate the phylogeny relationship between Trichostrongylus spp., the Molecular Evolutionary Genetics Analysis (MEGA) X software was engaged. The software suggested the best phylogenetic tree model based on the Bayesian information criterion (BIC). In this regard, phylogenetic tree for our sequences together with reference sequences, retrieved from the GenBank database, was constructed by the Maximum Likelihood (ML) and Tamura 3‐parameter incorporated in the MEGAX software. The COX1 sequence topologies were evaluated using 1000 bootstrap replicates to assess the significance level of the tree. The relationships in the haplotype network and molecular diversity were inferred through Templeton, Crandall and Sing (TCS) algorithm [32] using the PopART (Population Analysis) networking and DnaSP v.6 software, respectively [33].

All reference sequences, based on the COX1 gene, were retrieved from the GenBank database, which were associated to T. colubriformis (n = 14) and T. axei (n = 9) of ruminants from Brazil, and T. vitrinus (n = 2), T. colubriformis (n = 29) and, T. axei (n = 3) of ruminants from same location with ours in Guilan province, Iran.

3. Results

3.1. Ethics Approval and Consent to Participate

This project was approved by the Ethical Review Committee of the Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, (IR. SBMU. RIGLD. REC.1400.011). A verbal informed consent was obtained from participants or their legal guardian (s), at the time of sampling.

3.2. Sample Identification

In total, from 206 fecal samples, 71 samples were identified positive for Trichostrongylus spp. Pandi et al., [30]. The Willis floatation method coupled with microscopy showed the presence of identical eggs for Trichostrongylus spp., sized 75–110 µm in samples. The filariform larvae of the parasite was seen in agar plate cultivation of infected stools [30] (Figure 2). A ~700‐bp fragment of the COX1 was amplified in all 71 morphological positive samples, however, 33 samples were successfully sequenced and belonged to the genus of Trichostrongylus. An identity more than 95% to the available sequences, previously submitted to the GenBank database, was considered as a good sequence. Unfortunately, the other 38 samples were sequenced that were failed. The reason for this result was unspecific or faint amplification of the fragment. In this study area, T. colubriformis was the predominant species. Accordingly, 32 and one sequences were characterized as T. colubriformis and T. vitrinus, respectively.

Figure 2.

Figure 2

Open in a new tab

A microscopy figure of (A) the egg of Trichostrongylus spp. and the identical spicule of (B) T. colubriformis and (C) T. vitrinus.

3.3. Phylogenetic Analysis

The ML phylogenetic tree showed that the Trichostrongylus spp. sequences were categorized into three main groups including T. colubriformis, T. vitrinus, T. axei. The clade T. colubriformis consisted of our 29 sequences of T. colubriformis together with reference sequence, which was related to isolates from goat with acc no. MW051250 from Giulan province, Iran (identity: 99.06%). In addition, all reference sequences isolated from goats and sheep from Brazil were clustered with our sequences. Our T. vitrinus sequence was grouped together with T. vitrinus sequences, which were obtained from goat and sheep in Guilan province, Iran (97.17%) similarity with reference sequence: MW051255, MW051256 (Figure 3).

Figure 3.

Figure 3

Open in a new tab

The phylogenetic tree of Trichostrongylus spp., was constructed based on the maximum‐likelihood and Tumura 3‐parameter algorithms. The COX1 sequence topologies was evaluated using 1000 bootstrap replicates. This phylogenetic tree shows similarity between the Trichostrongylus spp. sequences in our study with those isolated from animals.

3.4. Nucleotide Diversity and Networking Analysis

In this study, nucleotide diversity of our T. colubriformis sequences (n = 29) was analyzed. The estimation of the numbers of synonymous (d S) and nonsynonymous (d N) substitutions per site between two sequences showed, d S: 122.05; Pi(s): 0.21509; and d N: 405.95; Pi(a): 0.01835. Moreover, for measurement of codon usage bias values, effective number of codons (ENC) parameter 36.259 were estimated. A not statistically significant trend toward a negative Tajima's D was observed in sequences (Tajima's D: –1.54772; Not significant, p > 0.10) (Table 1).

Table 1.

Genetic diversity parameters of T. colubriformis.

Number of sequences used Number of sites Invariable sites Segregating H* Hd* Pi* Tajima's D S* N*
29 530 484 46 25 0.983 0.01323 –1.54772 122.99 405.01
Open in a new tab

Abbreviations: H, haplotypes; Hd, haplotype diversity; S, synonymous sites/N, nonsynonymous sites; Pi, nucleotide diversity.

The networking analysis based on the COX1 locus showed a topology similar to the phylogenetic tree. In general, three clusters (T. vitrinus, T. axei, and T. colubriformis) represented long arms due to the number of polymorphisms among the species. The results of network analysis revealed that the sequences of the present study and the sequences from GenBank in relation to Trichostrongylus spp. (Figure 4), were organized into three main groups including: T. vitrinus, T. axei. and T. colubriformis. These groups containing sequences of Trichostrongylus spp. from animals and humans from over the world. In the present study 26 novel haplotypes of Trichostrongylus spp. were identified (25 for T. colubriformis and one for T. vitrinus). Most of our haplotypes were found as separate haplotypes with low similarity and high diversity to each other, without forming a central haplotype. Furthermore, Trichostrongylus spp. from same origin (Fuman's villages), but from different hosts (Sheep, goat, and human) were closely related.

Figure 4.

Figure 4

Open in a new tab

TCS sequence‐type network generated for the COX1 gene. The size of the circle indicates the relative frequency of the sequences belonging to a particular sequence type. Hatch marks along the network branches indicate the number of mutations. Each color represents a different host. Human (red), Sheep (green), Deer (yellow), Goat (blue), and Cattle (purple).

4. Discussion

From the public health point of view, zoonotic diseases are an important part of infection control strategies. Zoonotic diseases not only increase public health concerns, but also can disturb animal related industries [34]. Parasitic helminths are common in animal husbandries and negatively affect the growth rate, fertility, and animal products, while increase morbidity and mortality, and induce huge economy loss [35, 36, 37]. Apart from the importance of Trichostrongylus spp. in animal husbandry, zoonotic infection due to this helminth has been reported from the world, particularly in regions with close contact between humans and domesticated animals [3].

Human tricostrongylosis is still among the most important STHs in Iran with a prevalence rate ranging from 2% to 18% in north and south‐west provinces [18, 38, 39]. In the current study, Trichostrongylus spp., isolated from infected villagers were characterized using COX1 gene in Fuman district. Fuman is a city in the north of Iran, which is known as an endemic region for trichostrongilosis. The prevalence of Trichostrongylus spp. in this region was investigated in both humans and animals during recent years. Sharifdini et al. [18], investigated the prevalence of Trichostrongylus spp., in villagers of Fuman city and the prevalence of Trichostrongylus spp. in humans was reported as high as 3.05%. The characterized species based on the morphological features and phylogenetical analyses of the ITS gene were T. colubriformis, T. vitrinus, T. longispicularis, and T. axei [18]. In the same region, trichostrongyloid genera were recognized in 83 of 144 fecal samples collected from dairy cattle, sheep, and goats, in which three Trichostrongylus species including T. colubriformis, T. vitrinus and T. axei were identified based on morphological characteristics and genetic analyses of the ITS2 gene [9]. In the current study two T. colubriformis and T. vitrinus were characterized among study population with majority of T. colubriformis. Trichostrongylus colubriformis seems to be the most prevalent species in humans in the world [5, 16, 40, 41]. This species is the frequently reported species in Iran [17, 18, 42], as well. In addition, T. colubriformis is the major species in domesticated animals and is categorized among the highly zoonotic trichostrongylidae [1, 18, 31]. Trichostrongylus vitrinus is mainly a parasite that affects ruminants such as sheep, goats, and cattle. Although it is not a common human Trichostrongylus spp., it is still capable to being transmitted from animals to humans under certain situation [43, 44]. Trichostrongylus vitrinus was previously characterized in human samples of the studied region and seems to be circulated between humans and animals, although it is not a common human Trichostrongylus species [18]. Interestingly, both T. colubriformis and T. vitrinus were reported from a family who were infected by Trichostrongylus spp., presenting gastrointestinal symptoms, from Langroud district, east of Guilan province [17]. Cases of trichostrongylosis caused by T. colubriformis was also reported in a French family who consumed strawberries from a local garden fertilized by dried manure from local sheep [6]. Taken together, high humidity and suitable environmental conditions in Guilan province together with grazing animals in pasture increase the chance of the eggs to stay alive and transmit to humans. The previous epidemiological data released from Guilan province besides our findings suggests a zoonotic transmission, particularly from sheep and goat together with anthroponotic transmission of Trichostrongylus spp. This hypothesis is supported by study performed in Ghana on farmers and their livestock, of which Trichostrongylus spp., were isolated from farmers and their animals (goat, cattle, and sheep) [41].

Until now, many investigations have done on the ITS2 fragment to identify the phylogenetic connections of Trichostrongylus species [1, 4, 5, 9, 42]. Nevertheless, there are not significant data about discrimination of Trichostrongylus spp. based on Mt genome. Sharifdini et al., [18] investigated phylogenetic relationship of Trichostrongylus species using COX1 gene in Guilan province, northern Iran. In this line, T. axei was reported from the cattle, sheep, and goats, while T. colubriformis and T. vitrinus were only detected in sheep and goats. The genetic divergence within the species of T. axei, T. colubriformis, and T. vitrinus obtained in this study were indicated that T. axei and T. vitrinus isolated from the sheep and goats were quite similar. The main reason for targeting COX1 gene in this study was to describe similarity between our isolates with those, which were characterized from animals in same region to explore probable zoonotic transmission. Actually, it was demonstrated that the ITS2 fragment is not discriminative enough to illustrate inter‐ intra‐species similarity/diversity of Trichostrongylus spp. [17, 18, 31]. Due to the rare data on the COX1 gene, particularly those from same region in Iran, in the databases, our molecular analysis was not able to highlight sheep and goat as definitive source of zoonotic transmission, although our findings suggest such transmission cycle.

Genetic diversity analysis is a tool which is employed to assess geographical distribution and host adaptation for infectious agents [45]. In the present analyses, we tested neutrality, which negative values of Tajima's D (Tajima's D: –1.54772; not significant, p > 0.10), indicated a rare variation and consistent with population growth or positive selection, while the growth process is normal and the natural selection has not occurred in the population [46]. The current results suggest increased occurring of rare mutations compared to the expectation suggesting new selection due to adaptation to new hosts [47]. Owing to this, although not significant, the negative Tajima's D suggests expansion of Trichostrongylus spp., infection from sheep to humans.

Zoonotic pathogens are of public health concern because of their potential food safety implications that can cause emerging diseases. Monitoring zoonotic pathogens in animal populations in a region can provide information to prevent human outbreaks [48]. In addition, the presence of STHs in a community reflects close‐relationship between domesticated animals and humans. In a rural community, manure is usually employed to fertilized farmlands. Nowadays, shifting to chemical fertilizer has decreased the chance of transmission of parasites, particularly STHs to humans. However, the presence of STHs like Trichostrongylus spp. in high prevalence rate in a community may indicate employing traditional fertilizers such as night soil. Surveillance systems help detect and respond to new threats before they spread. Due to the public health importance of trichostrongylosis, particularly in endemic regions, having information about the prevalence of Trichostrongylus in animals and humans in a region can provide valuable information about the transmission cycle of different species of this parasite between humans and animals [1, 4, 17].

The most important limitation of this study was the short length of mt genome, which was investigated. In addition, we only analyzed COX1 gene. The pressure of environmental changes and life traits on the host adaptability of nematodes like Trichostrongylus spp., may reflects its effects on the mt genome. However, to provide more reliable results and to shape transmission cycle and new hosts, analysis of other mitochondrial genes is needed [49].

5. Conclusion

In the current study, Trichostrongylus spp., which were collected from villagers in Fuman district, were characterized using targeting and analyzing of a discriminative region of COX1. Accordingly, two T. colubriformis and T. vitrinus were characterized among samples, and molecular analyses suggested a close relationship between our sequences with those from sheep and goats in the same region. These findings strongly suggest the probability of zoonotic transmission of Trichostrongylus spp. in Fuman district from domesticated animals. However, due to the rare data about the COX1 gene, in Iran and the world, this study calls for further molecular investigations in both human and animal sources in endemic regions using discriminative genes such as COX1.

Author Contributions

Sara Nemati: investigation, visualization, software, writing – original draft, writing – review and editing. Hanieh Mohammad Rahimi: investigation, formal analysis, data curation. Meysam Sharifdini: conceptualization, resources. Hamed Mirjalali: conceptualization, writing – original draft, writing – review and editing, funding acquisition, formal analysis, supervision, methodology, validation.

Consent

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Transparency Statement

The lead author Meysam Sharifdini, Hamed Mirjalali affirms that this manuscript is an honest, accurate, and transparent account of the study being reported; that no important aspects of the study have been omitted; and that any discrepancies from the study as planned (and, if relevant, registered) have been explained.

Acknowledgments

The authors thank all members of the Foodborne and Waterborne Diseases Research Center for their collaborations. This study was financially supported by the Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences with grant number: RIGLD‐ 1171. The supporting source/financial relationships had no involvement in design, sample collection, data analysis and interpretations.

Contributor Information

Meysam Sharifdini, Email: sharifdini5@gmail.com.

Hamed Mirjalali, Email: hamedmirjalali@sbmu.ac.ir, Email: hamed_mirjalali@hotmail.com.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article (and/or) its supplementary materials.

References

  • 1. Ahmed N., Roy B. C., Hasan M. M., Zim M. M. R., Biswas H., and Talukder M. H., “Molecular and Phylogenetic Characterization of Zoonotic Trichostrongylus Species From Goats for the First Time in Bangladesh,” Transactions of the Royal Society of Tropical Medicine and Hygiene 117 (2023): 705–713. [DOI] [PubMed] [Google Scholar]
  • 2. Bakooie Katrimi A., Hoghooghi‐Rad N., Mizani A., et al., “Molecular Identification of Trichostrongylus Species Among Small Ruminants in Mazandaran Province, Iran,” Research in Molecular Medicine 10 (2022): 57–64. [Google Scholar]
  • 3. Bhat A. H., Tak H., Malik I. M., Ganai B. A., and Zehbi N., “Trichostrongylosis: A Zoonotic Disease of Small Ruminants,” Journal of Helminthology 97 (2023): e26. [DOI] [PubMed] [Google Scholar]
  • 4. Elseadawy R., Abbas I., Al‐Araby M., and Abu‐Elwafa S., “Molecular Identification of Different Trichostrongylus Species Infecting Sheep and Goats From Dakahlia Governorate, Egypt,” Journal of Parasitic Diseases 45 (2020): 218–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Hidalgo A., Gacitúa P., Melo A., Oberg C., Herrera C., and Fonseca‐Salamanca F., “First Molecular Characterization of Trichostrongylus colubriformis Infection in Rural Patients From Chile,” Acta Parasitologica 65 (2020): 790–795. [DOI] [PubMed] [Google Scholar]
  • 6. Lattes S., “ Trichostrongylus colubriformis Nematode Infections in Humans, France,” Emerging Infectious Diseases 17 (2011): 1301–1302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Bompadre T. F. V., Martinez M. I. V., Fernandes E. A. N., et al., “ Trichostrongylus colubriformis Infection Damages Intestine Brush Board Cells and Could Negatively Impact Postabsorptive Parameters of Santa Ines Lambs,” Experimental Parasitology 246 (2023): 108464. [DOI] [PubMed] [Google Scholar]
  • 8. Du B., Zhang L., Dang W., et al., “A Sheepherder With a Severe Diarrhea Caused by Trichostrongylus colubriformis ,” Travel Medicine and Infectious Disease 48 (2022): 102325. [DOI] [PubMed] [Google Scholar]
  • 9. Ghatee M. A., Malek Hosseini S. A. A., Marashifard M., et al., “Phylogenetic Analysis of Trichostrongylus vitrinus Isolates From Southwest Iran,” Parasites & Vectors 13 (2020): 553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Ghanbarzadeh L., Saraei M., Kia E. B., Amini F., and Sharifdini M., “Clinical and Haematological Characteristics of Human Trichostrongyliasis,” Journal of Helminthology 93 (2019): 149–153. [DOI] [PubMed] [Google Scholar]
  • 11. Phosuk I., Intapan P. M., Prasongdee T. K., et al., “Human Trichostrongyliasis: A Hospital Case Series,” Southeast Asian Journal of Tropical Medicine and Public Health 46 (2015): 191–197. [PubMed] [Google Scholar]
  • 12. Watthanakulpanich D., Pongvongsa T., Sanguankiat S., et al., “Prevalence and Clinical Aspects of Human Trichostrongylus colubriformis Infection in Lao PDR,” Acta Tropica 126 (2013): 37–42. [DOI] [PubMed] [Google Scholar]
  • 13. Singh B. B., Ward M. P., and Dhand N. K., “Host Characteristics and Their Influence on Zoonosis, Disease Emergence and Multi‐Host Pathogenicity,” One Health 17 (2023): 100596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Hosseinnezhad H., Sharifdini M., Ashrafi K., Atrkar Roushan Z., Mirjalali H., and Rahmati B., “Trichostrongyloid Nematodes in Ruminants of Northern Iran: Prevalence and Molecular Analysis,” BMC Veterinary Research 17 (2021): 371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Kaba T., Terefe G., and Waktole H., “Sheep and Goat Response to Trichostrongylus colubriformis Infection Based on Egg Output and Worm Burden,” Tropical Animal Health and Production 55 (2023): 177. [DOI] [PubMed] [Google Scholar]
  • 16. Sato M., Yoonuan T., Sanguankiat S., et al., “Human Trichostrongylus colubriformis Infection in a Rural Village in Laos,” American Society of Tropical Medicine and Hygiene 84 (2011): 52–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ashrafi K., Sharifdini M., Heidari Z., Rahmati B., and Kia E. B., “Zoonotic Transmission of Teladorsagia circumcincta and Trichostrongylus Species in Guilan Province, Northern Iran: Molecular and Morphological Characterizations,” BMC Infectious Diseases 20 (2020): 28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Sharifdini M., Derakhshani S., Alizadeh S. A., et al., “Molecular Identification and Phylogenetic Analysis of Human Trichostrongylus Species From an Endemic Area of Iran,” Acta Tropica 176 (2017): 293–299. [DOI] [PubMed] [Google Scholar]
  • 19. Rahimi‐Esboei B., Pourhajibagher M., and Bahador A., “Prevalence of Human Trichostrongyliasis in Iran: A Systematic Review and Meta‐Analysis,” Reviews in Medical Microbiology 33 (2022): e16–e22. [Google Scholar]
  • 20. Yong T. S., Lee J. H., Sim S., et al., “Differential Diagnosis of Trichostrongylus and Hookworm Eggs via PCR Using ITS‐1 Sequence,” Korean Journal of Parasitology 45 (2007): 69–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Arbabi M., Hooshyar H., Lotfinia M., and Bakhshi M. A., “Molecular Detection of Trichostrongylus Species Through PCR Followed by High Resolution Melt Analysis of ITS‐2 rDNA Sequences,” Molecular and Biochemical Parasitology 236 (2020): 111260. [DOI] [PubMed] [Google Scholar]
  • 22. Blouin M. S., “Molecular Prospecting for Cryptic Species of Nematodes: Mitochondrial DNA Versus Internal Transcribed Spacer,” International Journal for Parasitology 32 (2002): 527–531. [DOI] [PubMed] [Google Scholar]
  • 23. Hu M. and Gasser R. B., “Mitochondrial Genomes of Parasitic Nematodes–Progress and Perspectives,” Trends in Parasitology 22 (2006): 78–84. [DOI] [PubMed] [Google Scholar]
  • 24. Kern E. M. A., Kim T., and Park J.‐K., “The Mitochondrial Genome in Nematode Phylogenetics,” Frontiers in Ecology and Evolution 8 (2020): 250. [Google Scholar]
  • 25. Krajewski C., Sipiorski J. T., and Anderson F. E., “Complete Mitochondrial Genome Sequences and the Phylogeny of Cranes (Gruiformes: Gruidae),” Auk 127 (2010): 440–452. [Google Scholar]
  • 26. Hu M., Chilton N. B., and Gasser R. B., “The Mitochondrial Genomes of the Human Hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea),” International Journal for Parasitology 32 (2002): 145–158. [DOI] [PubMed] [Google Scholar]
  • 27. Ndosi B. A., Lee D., Bia M. M., et al., “Morphometry and Molecular Identification of Haemonchus Cobb, 1898 (Trichostrongylidae: Nematoda) Isolates From Small Ruminants in Tanzania Based on Mitochondrial Cox 1 and rRNA‐ITS Genes,” Journal of Parasitology Research 2023 (2023): 1923804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Hajizadeh F., Galeh T. M., Hosseini S. A., et al., “Investigating Intestinal Parasitic Infections With Emphasis on Molecular Identification of Strongyloides stercoralis and Trichostrongylus colubriformis in North of Iran,” Parasite Epidemiology and Control 22 (2023): e00312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Mikaeili F., Mirhendi H., Mohebali M., et al., “Sequence Variation in Mitochondrial cox1 and nad1 Genes of Ascaridoid Nematodes in Cats and Dogs From Iran,” Journal of Helminthology 89 (2015): 496–501. [DOI] [PubMed] [Google Scholar]
  • 30. Pandi M., Sharifdini M., Ashrafi K., Atrkar Roushan Z., Rahmati B., and Hajipour N., “Comparison of Molecular and Parasitological Methods for Diagnosis of Human Trichostrongylosis,” Frontiers in Cellular and Infection Microbiology 11 (2021): 759396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Sharifdini M., Hajialilo E., Hosseinnezhad H., and Mohammadi M. A., “Molecular Characterization of Mitochondrial Cytochrome c Oxidase Subunit 1 (Cox1) Gene From Trichostrongylus Species (Nematoda: Trichostrongylidae) in Northern Iran,” Turkish Journal of Parasitology 47 (2023): 28‐23. [DOI] [PubMed] [Google Scholar]
  • 32. Clement M., Posada D., and Crandall K. A., “TCS: A Computer Program to Estimate Gene Genealogies,” Molecular Ecology 9 (2000): 1657–1659. [DOI] [PubMed] [Google Scholar]
  • 33. Rozas J., Sánchez‐DelBarrio J. C., Messeguer X., and Rozas R., “DnaSP, DNA Polymorphism Analyses by the Coalescent and Other Methods,” Bioinformatics 19 (2003): 2496–2497. [DOI] [PubMed] [Google Scholar]
  • 34. Rahman M. T., Sobur M. A., Islam M. S., et al., “Zoonotic Diseases: Etiology, Impact, and Control,” Microorganisms 8 (2020): 1405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Charlier J., Rinaldi L., Musella V., et al., “Initial Assessment of the Economic Burden of Major Parasitic Helminth Infections to the Ruminant Livestock Industry in Europe,” Preventive Veterinary Medicine 182 (2020): 105103. [DOI] [PubMed] [Google Scholar]
  • 36. Coppieters W., Mes T. H., Druet T., et al., “Mapping QTL Influencing Gastrointestinal Nematode Burden in Dutch Holstein‐Friesian Dairy Cattle,” BMC Genomics 10 (2009): 96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Hamid L., Alsayari A., Tak H., et al., “An Insight Into the Global Problem of Gastrointestinal Helminth Infections Amongst Livestock: Does Nanotechnology Provide an Alternative?,” Agriculture (London) 13 (2023): 1359. [Google Scholar]
  • 38. Daryani A., Sharif M., Nasrolahei M., Khalilian A., Mohammadi A., and Barzegar G., “Epidemiological Survey of the Prevalence of Intestinal Parasites Among Schoolchildren in Sari, Northern Iran,” Transactions of the Royal Society of Tropical Medicine and Hygiene 106 (2012): 455–459. [DOI] [PubMed] [Google Scholar]
  • 39. Sharif M., Daryani A., Kia E., Rezaei F., Nasiri M., and Nasrolahei M., “Prevalence of Intestinal Parasites Among Food Handlers of Sari, Northern Iran,” Revista do Instituto de Medicina Tropical de São Paulo 57 (2015): 139–144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Phosuk I., Intapan P. M., Sanpool O., et al., “Molecular Evidence of Trichostrongylus colubriformis and Trichostrongylus axei Infections in Humans From Thailand and Lao PDR,” American Society of Tropical Medicine and Hygiene 89 (2013): 376–379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Squire S. A., Yang R., Robertson I., Ayi I., Squire D. S., and Ryan U., “Gastrointestinal Helminths in Farmers and Their Ruminant Livestock From the Coastal Savannah Zone of Ghana,” Parasitology Research 117 (2018): 3183–3194. [DOI] [PubMed] [Google Scholar]
  • 42. Gholami S., Babamahmoodi F., Abedian R., et al., “ Trichostrongylus colubriformis: Possible Most Common Cause of Human Infection in Mazandaran Province, North of Iran,” Iranian Journal of Parasitology 10 (2015): 110–115. [PMC free article] [PubMed] [Google Scholar]
  • 43. Arbabi M., Bakhshi A., Hooshyar H., Ghasemikhah R., Delavari M., and Sehat M., “Prevalence and Morphometric Comparison of Trichostrongylus spp. Among Sheep and Goats From Kashan Abattoir, Central Iran,” Journal of Medical Microbiology and Infectious Diseases 11 (2023): 28–33. [Google Scholar]
  • 44. Roeber F., Jex A. R., and Gasser R. B., “Next‐Generation Molecular‐Diagnostic Tools for Gastrointestinal Nematodes of Livestock, With an Emphasis on Small Ruminants,” A Turning Point? Advances in Parasitology 83 (2013): 267–333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Rezaei Riabi T., Mirjalali H., Haghighi A., et al., “Genetic Diversity Analysis of Blastocystis Subtypes From Both Symptomatic and Asymptomatic Subjects Using a Barcoding Region From the 18S Rrna Gene,” Infection, Genetics and Evolution 61 (2018): 119–126, 10.1016/j.meegid.2018.03.026. [DOI] [PubMed] [Google Scholar]
  • 46. Tajima F., “Statistical Method for Testing the Neutral Mutation Hypothesis by DNA Polymorphism,” Genetics 123 (1989): 585–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Kim K., Omori R., Ueno K., Iida S., and Ito K., “Host‐Specific and Segment‐Specific Evolutionary Dynamics of Avian and Human Influenza A Viruses: A Systematic Review,” PLoS One 11, no. 1 (2016): e0147021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Ihekweazu C., Michael C. A., Nguku P. M., et al., “Prioritization of Zoonotic Diseases of Public Health Significance in Nigeria Using the One‐Health Approach,” One Health 13 (2021): 100257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Mejías‐Alpízar M. J., Porras‐Silesky C., Rodríguez E. J., et al., “Mitochondrial and Ribosomal Markers in the Identification of Nematodes of Clinical and Veterinary Importance,” Parasites & Vectors 17, no. 1 (2024): 77. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article (and/or) its supplementary materials.

Articles from Health Science Reports are provided here courtesy of Wiley

RESOURCES