Abstract
Genomic subtractive hybridization was performed between Salmonella enterica serovar Typhimurium LT2 and DT104 to search for novel Salmonella serovar Typhimurium DT104-specific sequences. The subtraction resulted mainly in the isolation of DNA fragments with sequence similarity to phages. Two fragments identified were associated with possible virulence factors. One fragment was identical to irsA of Salmonella serovar Typhimurium ATCC 14028, which is suggested to be involved in macrophage survival. The other fragment was homologous to HldD, an Escherichia coli O157:H7 lipopolysaccharide assembly-related protein. Five selected DNA fragments—irsA, the HldD homologue, and three fragments with sequence similarity to prophages—were tested for their presence in 17 Salmonella serovar Typhimurium DT104 isolates and 27 non-DT104 isolates by PCR. All five selected DNA fragments were Salmonella serovar Typhimurium DT104 specific among the serovar Typhimurium isolates tested. These DNA fragments can be useful for better detection and typing of Salmonella serovar Typhimurium DT104.
During the past decades, Salmonella enterica subsp. enterica serovar Typhimurium infections have increased in many parts of the world. In particular, the multiple-antibiotic-resistant Salmonella serovar Typhimurium phage type DT104 has been identified as an emerging pathogen (9, 12, 24). For example, for human isolates in The Netherlands, the percentage of Salmonella serovar Typhimurium DT104 increased from 7% of total Salmonella serovar Typhimurium isolates in 1990 to 1995 to 29% in 1996 to 2001 (27). Salmonella serovar Typhimurium DT104 is multiply antibiotic resistant via a 43-kb Salmonella genomic island I (SGI-I), containing phage- and plasmid-related genes, and five antibiotic resistance genes to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracycline (3, 5, 25).
Pathogens can acquire horizontally transferable genetic elements such as plasmids, genomic islands, and prophages, which often contain virulence factors. For example, the acquisition of virulence factors located on prophages can play an important role in the emergence of specific pathogens (4, 11). Various virulence factors located on transferable elements have been described for Salmonella serovar Typhimurium; for example, Salmonella serovar Typhimurium LT2 contains a Salmonella virulence plasmid, Salmonella pathogenicity islands, and Gifsy and Fels prophages (15). In addition, strain-specific virulence factors located on prophages have been described for several Salmonella serovar Typhimurium strains. Phage Fels-1 of Salmonella serovar Typhimurium LT2 carries nanH and sodCIII, phage Gifsy-3 of Salmonella serovar Typhimurium ATCC 14028 encodes pagJ, and phage SopEΦ of Salmonella serovar Typhimurium SL1344 contains sopE (8, 16).
Two prophages (PDT17 and ST104) have been identified in Salmonella serovar Typhimurium DT104 (22, 23), although no virulence association has been reported. In addition, a Salmonella serovar Typhimurium DT104-specific DNA fragment has been identified which is homologous to genes encoded by Escherichia coli O157:H7 prophages (14, 20).
The objective of the present work was to identify and characterize Salmonella serovar Typhimurium DT104-specific sequences, which may lead to the identification of novel virulence factors. Therefore, genomic subtractive hybridization (2, 6, 7, 17) was performed between Salmonella serovar Typhimurium LT2 and DT104.
MATERIALS AND METHODS
Bacterial strains and growth conditions.
The bacterial strains used in this study are listed in Table 1; they included isolates from the strain collections of RIKILT, the Dutch National Institute of Public Health and the Environment (RIVM), the Norwegian Institute of Public Health (isolates 911 and 327), and the American Type Culture Collection (ATCC). All isolates were stored at −80°C in brain heart broth (Merck, Darmstadt, Germany) plus 50% glycerol (Merck). The isolates were grown overnight in brain heart broth (Merck) at 37°C without shaking.
TABLE 1.
Salmonella serovar Typhimurium isolates used in this study
| Phage typea | Strain no. | Isolation sourceb |
|---|---|---|
| ARS | 435 | Turkey |
| 444 | Human | |
| DT104 | 7945 | Pig |
| ATCC BAA-188 | Human | |
| so-2945 | Human | |
| so-3633 | Cacao | |
| stm 911 | Human | |
| stm 327 | Halva dessert | |
| LT2 (DT4) | ATCC 700720 | — |
| 286 (ATCC 29946) | — | |
| NDc | 275 (ATCC 13311) | Human feces |
| 375 | — | |
| 389 | — | |
| 390 | — | |
| OS | 254 | — |
| 255 | — | |
| 256 | — | |
| 257 | — | |
| PT3 | 322 | Meat |
| 419 | Chicken | |
| PT10 | 323 | — |
| PT296 | 413 | Pig |
| 462 | Human | |
| PT301 | 416 | Pig |
| PT350 | 412 | Pig |
| 445 | Meat | |
| PT353 | 414 | Pig |
| PT401 | 408 | Pig |
| 411 | Pig | |
| 420 | — | |
| 461 | Human | |
| PT506d | 406 | Human |
| 410 | Pig | |
| 418 | Dairy cow | |
| 427 | Human | |
| 433 | Human | |
| 436 | Pig | |
| 443 | Chicken products | |
| 448 | Human | |
| 451 | Pig | |
| 454 | Human | |
| 455 | Human | |
| PT507 | 452 | Pig |
| PT510 | 415 | Pig |
PT, phage types according to the Dutch phage-typing system.
—, isolation source unknown.
ND, not determined.
PT506 is typed as DT104 in the English phage-typing system.
The Dutch phage-typing system for serovar Typhimurium was gauged in 1997 and 1998 against the English phage-typing system and showed no clear one-to-one relationship. The following relationships between the two phage-typing methods were applied to the phage types mentioned in this paper: the Dutch atypically reacting strains (ARS) correspond with ARS in the English system; the nontypeable strains (OS) correspond with OS; PT10 with DT3; PT296 with DT12; PT3 with DT41, DT1, and DT12; PT301 with DT52; PT350 with DT193; PT353 with DT194; PT401 with DT193, DT104, and DT120; PT506 with DT104; PT507 with DT208; and PT510 with DT208 (W. van Pelt, personal communication).
Subtractive hybridization library construction.
First, genomic DNA was extracted from Salmonella serovar Typhimurium DT104 strain 7945 (tester) and strain LT2 (driver) by using a genomic DNA wizard kit (Promega, Madison, Wis.). Subtractive hybridization was carried out using the PCR-Select Bacterial Genome Subtraction kit (BD Clontech, Palo Alto, CA) as recommended by the manufacturer. In addition, glycogen (2 μg/μl; SEQ DTCS kit; Beckman Coulter, Princeton, NJ) was added during the precipitation step after the RsaI digestion to increase the precipitated DNA yield. The PCR products obtained at the end of the subtraction procedure were ligated into the pGEM-T Easy vector (Promega). The subtractive hybridization library was constructed by transforming the ligation mixture to XL2-Blue ultracompetent E. coli cells (Stratagene, La Jolla, CA) with ampicillin (50 μg/ml) and isopropyl-β-d-thiogalactopyranoside (IPTG)-5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) selection and screening on Luria-Bertani Lennox agar plates (Difco, Detroit, Mich.) as described by the supplier. Individual colonies (n = 192) were picked and grown overnight at 37°C in Luria-Bertani Lennox broth (Difco) with ampicillin (50 μg/ml) selection. Plasmid DNA was isolated using a miniprep plasmid isolation kit (QIAGEN, Valencia, CA).
DNA sequencing and analysis.
DNA sequencing was performed on a capillary sequencer (Beckman Coulter) using the CEQ DTCS kit (Beckman Coulter) according to the supplier's instructions. The sequence reactions were initiated by using forward primer M13. The sequences obtained from the clones were analyzed using BLASTN and BLASTX through the databases mentioned in the next section. The BLASTN or BLASTX hit with the highest similarity was picked and, if possible, linked to functionality. The unique fragments obtained that showed no similarities to the already known Salmonella serovar Typhimurium DT104-specific SGI-I (GenBank accession no. AF261825) (3) were additionally sequenced twice in both directions (M13 forward and M13 reverse primer).
Nucleotide databases used.
The following databases were used to analyze the sequences of the subtraction library: (i) GenBank at the National Center for Biotechnology Information (NCBI); (ii) the Salmonella genomes of the microbial-genome database (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi) at NCBI (the finished genomes of Salmonella enterica serovar Paratyphi A ATCC 9150, Salmonella enterica serovar Typhi CT18, Salmonella serovar Typhi Ty2, and Salmonella serovar Typhimurium LT2 and the unfinished genomes of Salmonella enterica serovar Dublin, Salmonella enterica serovar Enteritidis PT8 strain LK5, Salmonella serovar Typhimurium DT104, Salmonella serovar Typhimurium SL1344, Salmonella serovar Paratyphi B strain SPB7, and Salmonella bongori 12149); (iii) the DNA fragment databases of Salmonella serovar Enteritidis PT4, Salmonella enterica serovar Gallinarum 287/91, Salmonella serovar Typhimurium DT104, Salmonella serovar Typhimurium SL1344, and S. bongori 12419, the sequence data of which were produced by the Salmonella spp. Sequencing Group at the Sanger Institute and can be obtained from ftp://ftp.sanger.ac.uk/pub/pathogens/Salmonella; and (iv) the DNA fragment databases of Salmonella serovar Paratyphi A ATCC 9150 and Salmonella enterica subsp. diarizonae serovar 61:1,v:1,5,(7) ATCC BAA-639, the sequence data of which were produced by the Genome Sequencing Center at the Washington University School of Medicine and can be obtained from http://genome.wustl.edu/blast/client.pl.
Detection of genomic DNA fragments by PCR.
Primer sets were designed (Gene Runner, version 3.05) to detect five DNA fragments selected from the fragments obtained from the subtractive hybridization library (see Table 3): two fragments with nonprophage sequence homology (fragments 117 and 144) and three fragments homologous to prophage sequences found only in Salmonella serovar Typhimurium DT104 and not in other Salmonella genomes (fragments 84, 168, and 180). The two nonprophage fragments (fragments 117 and 144) were named irsA and HldD homologue according to their homology to irsA of Salmonella serovar Typhimurium ATCC 14028 and HldD of E. coli O157:H7, respectively. In addition, one control primer set was used to detect a DNA fragment (orf STM1056) in the Gifsy-2 prophage which should be present in all Salmonella strains. An overview of the primers used and the expected amplicon sizes is shown in Table 2.
TABLE 3.
BLAST search results for the Salmonella serovar Typhimurium DT104 fragments generated by genomic subtraction between the Salmonella serovar Typhimurium DT104 and LT2 strains excluding the fragments similar to SGI-I
| Group | Fragment no. | Sequence similarity to: | Accession no. | Similarity regiona | % Similarityb | Present inc: |
|---|---|---|---|---|---|---|
| (B) Phage | ||||||
| (i) ST64B | 4 | Serovar Typhimurium bacteriophage ST64B genome: putative DNA methyltransferase | AY055382.1 | 32607-32895 | 93 | Serovar Typhimurium SL1344 |
| 5 | Serovar Typhimurium bacteriophage ST64B genome: putative transcriptional activator | AY055382.1 | 31896-32507 | 98 | Serovar Typhimurium SL1344 | |
| 59 | Serovar Typhimurium bacteriophage ST64B genome: hypothetical protein Sb40 | AY055382.1 | 29290-29704 | 100 | Serovar Dublin, serovar Enteritidis PT4, serovar Typhimurium SL1344 | |
| 95 | Serovar Typhimurium bacteriophage ST64B genome: putative tail proteins Sb22 and Sb23 | AY055382.1 | 16126-16645 | 97 | Serovar Dublin, serovar Enteritidis PT4, serovar Typhimurium SL1344 | |
| 149 | Serovar Typhimurium bacteriophage ST64B genome: putative DNA methyltransferase Sb44 | AY055382.1 | 32897-33312 | 100 | Serovar Typhimurium SL1344 | |
| 155 | Serovar Typhimurium bacteriophage ST64B genome: hypothetical protein Sb46 | AY055382.1 | 33908-34104 | 98 | Serovar Enteritidis PT4, serovar Typhimurium SL1344 | |
| 170 | Serovar Typhimurium bacteriophage ST64B genome: integrase protein Sb28 | AY055382.1 | 21702-22241 | 99 | Serovar Dublin, serovar Enteritidis PT4, serovar Typhimurium SL1344 | |
| 178 | Serovar Typhimurium bacteriophage ST64B genome: putative tail protein Sb22 | AY055382.1 | 15708-16007 | 97 | Serovar Dublin, serovar Enteritidis PT4, serovar Typhimurium SL 1344 | |
| (ii) ST104 | 2 | Serovar Typhimurium bacteriophage ST104 genome: tailspike protein | AB102868.1 | 40450-40738 | 100 | Serovar Dublin, serovar Paratyphi A, serovar Paratyphi B |
| 17 | Serovar Typhimurium bacteriophage ST104 genome: NinZ | AB102868.1 | 19809-20268 | 99 | S. enterica subsp. diarizonae, serovar Dublin | |
| 36 | Serovar Typhimurium bacteriophage ST104 genome: ORF15 (endopeptidase) and ORF19 (lysozyme) | AB102868.1 | 21707-22377 | 99 | S. enterica subsp. diarizonae, serovar Paratyphi A, serovar Paratyphi B | |
| 50 | Serovar Typhimurium bacteriophage ST104: tail spike protein | AB102868.1 | 41078-41391 | 100 | Serovar Dublin, serovar Paratyphi A, serovar Paratyphi B | |
| 54 | Serovar Typhimurium bacteriophage ST104 genome: | AB102868.1 | 38879-39670 | 100 | Serovar Dublin, serovar Paratyphi A, serovar Paratyphi B | |
| Mnt and tail spike protein | ||||||
| 78 | Serovar Typhimurium bacteriophage ST104 genome: ORF46, ORF47, and ORF48 | AB102868.1 | 23183-24148 | 100 | S. enterica subsp. diarizonae, serovar Dublin, serovar Paratyphi A, serovar Paratyphi B | |
| 98 | Serovar Typhimurium bacteriophage ST104 genome: ORF19 | AB102868.1 | 9548-9791 | 100 | ||
| 101 | Serovar Typhimurium bacteriophage ST104 genome: ORF23 (antitermination protein Q homologue) | AB102868.1 | 20269-21264 | 99 | S. enterica subsp. diarizonae, serovar Paratyphi A, serovar Paratyphi B | |
| 110 | Serovar Typhimurium bacteriophage ST104 genome: NinG | AB102868.1 | 18853-19808 | 99 | S. enterica subsp. diarizonae | |
| 122 | Serovar Typhimurium bacteriophage ST104 genome: SieB | AB102868.1 | 10671-10897 | 99 | S. enterica subsp. diarizonae, serovar Paratyphi A, serovar Paratyphi B | |
| (iii) P27 | 8 | Serovar Typhi CT18 genome segment 6: putative holin of bacteriophage P27 | AL627270.1 | 15663-15915 | 94 | Serovar Paratyphi A, serovar Paratyphi B, serovar Typhi Ty2, serovar Typhi CT18, serovar Typhimurium SL1344 |
| 62 | Serovar Typhi CT18 genome segment 4: putative holin of bacteriophage P27 | AL627268.1 | 266762-267028 | 97 | S. bongori, serovar Enteritidis PT4, serovar Typhi Ty2, serovar Typhi CT18 | |
| 66 | Serovar Typhi CT18 genome segment 6: putative toxin subunit 1 of Bordetella pertussis | AL627270.1 | 14526-15084 | 91 | S. bongori, serovar Paratyphi A, serovar Paratyphi B, serovar Typhi Ty2, serovar Typhi CT18 | |
| (iv) Others | 16 | Putative prophage terminase large subunit of a prophage in serovar Typhi | CAD05440.1 | aa 291-453 | 82 (I), 89 (P) | |
| 22 | Unnamed protein product in Photorhabdus luminescens subsp. laumondii TTO1 | CAE15767.1 | aa 1-132 | 63 (I), 81 (P) | ||
| 56 | Unknown protein of prophage CP-933U in E. coli O157:H7 | AAG57029.1 | aa 23-99 | 61 (I), 79 (P) | ||
| 75 | Unnamed protein product in Photorhabdus luminescens subsp. laumondii TTO1 | CAE15775.1 | aa 142-233 | 65 (I), 75 (P) | ||
| 84d | Unnamed protein product in Photorhabdus luminescens subsp. laumondii TTO1 | CAE15762.1 | aa 1-113 | 59 (I), 78 (P) | ||
| 100 | Exodeoxyribonuclease of Gifsy prophages in serovar Typhimurium LT2 | AAL19943.1 | aa 58-355 | 46 (I), 58 (P) | Serovar Gallinarum, serovar Paratyphi A, serovar Paratyphi B, serovar Typhimurium SL1344 | |
| 158e | DNA fragment of serovar Typhimurium DT104: hypothetical | AF275268.1 | 229-516 | 100 | Serovar Dublin, serovar Gallinarum | |
| protein YdaU of Rac prophage in E. coli K-12 | ||||||
| 168d | S. flexneri 2a genome: putative bacteriophage protein | AE005674.1 | 2693454-2693818 | 93 | ||
| 180d | Hypothetical protein YmfD of prophage e14 in E. coli K-12 | F64858 | aa102-216 | 69 (I), 82 (P) | ||
| (C) Nonphage | 117d | irsA gene in serovar Typhimurium ATCC 14028 | AY328029.1 | 1627-1948 | 99 | Serovar Dublin, serovar Enteritidis PT4, serovar Enteritidis PT8, serovar Gallinarum |
| 144d | LPS biosynthesis enzyme HldD (WaaD) of E. coli O157:H7 | AAC69662.1 | aa 29-111 | 75 (I), 87 (P) | S. bongori | |
| (D) Not significant | 47 | Hypothetical protein in Caenorhabditis elegans | CAA88607.1 | aa 64-216 | 23 (I), 41 (P) | |
| 64 | Hypothetical protein in Anaeromyxobacter dehalogenans 2CP-C | EAL78506.1 | aa 38-155 | 34 (I), 55 (P) |
Region of similarity in base pairs or amino acids (aa) based on accession number.
Similarities are based on nucleotide or amino acid sequences. When identities (I) and positives (P) are given, values for positives (similarity based on similar amino acid properties) of ≤55% are not significant.
Present or partly present, based on >80% similarity by BLASTN analysis, in the genomes listed. All fragments are present in Salmonella serovar Typhimurium DT104.
DNA fragment used for PCR detection of genomic fragments.
DNA fragment described in the literature as Salmonella serovar Typhimurium DT104 specific (20).
TABLE 2.
Overview of the PCR primers used for the PCR detection of genomic fragments
| PCR fragment | Primer name | Sequence (5′-3′)a | Amplicon size (bp) |
|---|---|---|---|
| HldD homologue | hldDF | ACAATGCTTTCGAACCTGATGGGC | 510b |
| hldDR | CCATCGCTTCAATTGCAACCATGC | ||
| irsA | irsAF | ATTCAGGCTGCGCTCCGTCTTTAC | 416b |
| irsAR | CTTAATGAGGCGGCGGAACAGTAC | ||
| Fragment 84 | frag-84F | ATGGCACAACCACTCAGTAATCCG | 372b |
| frag-84R | AGATGGCATCGGCGTAGTTATGAG | ||
| Fragment 168 | frag-168F | CATCCATTACCGGGTTGTCCATCC | 492b |
| frag-168R | CGCGTTTAACGGTACAGATGGTGG | ||
| Fragment 180 | frag-180F | CCATAATAGGAAGCATTGCGTGAG | 476b |
| frag-180R | ATGCCATCTAGCTATCTCTGCGAC | ||
| Gifsy-2 control | gifsy-2 RB-F | GGTGGCTAAATGTAAATGACGTGG | 488c |
| gifsy-2 RB-R | TGAGCGAGATCGAGATGAAGCTTG |
All primers were designed and used first in this study.
Amplicon size based on Salmonella serovar Typhimurium DT104.
Amplicon size based on Salmonella serovar Typhimurium LT2.
The primers (Isogen, Maarssen, The Netherlands), at a 0.2 nM concentration, were combined with about 1 to 10 ng DNA template and amplified with Taq polymerase (Invitrogen, Carlsbad, CA). After an initial denaturation at 95°C for 3 min, the samples were subjected to 30 cycles of 95°C for 30 s, 60°C for 60 s, and 72°C for 45 s, followed by a final 7-min incubation at 72°C. Samples were fractionated by 2% agarose gel electrophoresis and visualized by ethidium bromide staining. All PCRs were performed four times for each Salmonella serovar Typhimurium isolate shown in Table 1.
Nucleotide sequence accession numbers.
The nucleotide sequences of the 34 Salmonella serovar Typhimurium DT104 fragments that are listed in Table 3 have been submitted to GenBank in numerical fragment order with accession numbers AY462969 to AY463002, respectively.
RESULTS
DNA sequencing and analysis.
The sequence reactions performed on 192 picked colonies of the subtractive hybridization library resulted in 126 different DNA fragments, of which 57 fragments were not found in the Salmonella serovar Typhimurium LT2 genome by using BLASTN analysis. After BLASTN and BLASTX analysis through GenBank, these 57 Salmonella serovar Typhimurium DT104 fragments were divided into four groups showing sequence similarity to either SGI-I (group A; n = 23), phage sequences (group B; n = 30), nonphage sequences (group C; n = 2), or nonsignificant sequences (group D; n = 2). Table 3 shows the BLAST search results for all fragments of groups B to D. The fragments of group A with sequence similarities to SGI-I were not further analyzed, because this Salmonella serovar Typhimurium DT104 island had already been sequenced (GenBank accession no. AF261825) (3). The fragments of group B were additionally divided into four phage subgroups showing sequence similarity to either (i) the Salmonella serovar Typhimurium DT64 bacteriophage ST64B, (ii) the Salmonella serovar Typhimurium DT104 bacteriophage ST104, (iii) the Escherichia coli (STEC) bacteriophage P27, or (iv) other prophages present in the genome of Salmonella serovar Typhi CT18, Salmonella serovar Typhimurium, E. coli K-12, E. coli O157:H7, or Shigella flexneri 2a.
Although fragments 22, 66, 75, and 84 were not similar to prophage sequences, these fragments were placed in the group of phages (see Table 3) because the adjacent genome regions of the matching BLAST hits were similar to prophage sequences (data not shown). Fragment 117, fragment 158, and all fragments of phage subgroups i and ii matched to sequences of Salmonella serovar Typhimurium origin. In addition, fragment 158 was the only fragment matching to a sequence of phage type DT104 origin that was not located on SGI-I or prophage ST104. All other fragments had not been associated with Salmonella serovar Typhimurium before. Notably, the fragments with DNA sequence similarities (phage subgroup i to iii fragments) could be clustered into a subgroup of similar origin, such as bacteriophage ST104, while the fragments with amino acid sequence similarity (phage subgroup iv and groups C and D) could not be clustered into subgroups of similar origin.
The presence of the 34 Salmonella serovar Typhimurium DT104 fragments of groups B to D was found, using BLASTN analysis, to be different in available finished and unfinished Salmonella genomes (Table 3). Ten fragments were found only in the Salmonella serovar Typhimurium DT104 genome, while the other fragments were randomly found in the other Salmonella genomes. Among all fragments, three fragments (62, 66, and 144) were found in a strain of S. bongori.
Identification of possible virulence factor candidates.
Based on sequence homology, three Salmonella serovar Typhimurium DT104 DNA fragments obtained could be associated with possible virulence factors: fragments 66, 117, and 144.
Fragment 66 was similar (91%) to a Salmonella serovar Typhi CT18 gene (orf STY1362). This Salmonella serovar Typhi CT18 gene is described as being homologous to a putative toxin subunit 1 gene of Bordetella pertussis based on the amino acid sequence. However, this gene represents a pseudogene due to at least one frameshift (19). Therefore, it is unlikely that fragment 66 encodes a virulence factor. In addition, four genes encoding the other subunits necessary to form the active B. pertussis toxin (18) were not found in the Salmonella serovar Typhimurium DT104 genome (data not shown).
Fragment 117 was highly similar (99%) to a part of the irsA gene of Salmonella serovar Typhimurium ATCC 14028. The irsA locus in Salmonella serovar Typhimurium ATCC 14028 is described as being involved in macrophage survival (1). Finally, fragment 144 was homologous (75%) to the lipopolysaccharide (LPS) assembly-related protein HldD (formerly named WaaD) of E. coli O157:H7, based on the amino acid sequence.
Detection of genomic DNA fragments by PCR.
The presence of five selected DNA fragments—fragment 117 (irsA), fragment 144 (HldD homologue), and three fragments homologous to prophage sequences (fragments 84, 168, and 180)—and a Gifsy-2 prophage control fragment was tested among 44 Salmonella serovar Typhimurium isolates by PCR (Table 4). The five selected fragments appeared to be present in all 17 Salmonella serovar Typhimurium DT104 isolates and absent in all 27 non-DT104 phage type isolates. In addition, the Gifsy-2 prophage control fragment was indeed present in all Salmonella serovar Typhimurium DT104 and non-DT104 isolates.
TABLE 4.
PCR results for the detection of six genomic fragments in different Salmonella serovar Typhimurium isolates
| Phage typea (no. of isolates) | irsA | Presence or absenceb of:
|
||||
|---|---|---|---|---|---|---|
| HldD homo- logue | Frag- ment 84 | Frag- ment 168 | Frag- ment 180 | Gifsy-2 control | ||
| DT104 | ||||||
| DT104 (6) | + | + | + | + | + | + |
| PT506 (11)c | + | + | + | + | + | + |
| Non-DT104 | ||||||
| ARS (2) | − | − | − | − | − | + |
| LT2 (2) | − | − | − | − | − | + |
| ND (4) | − | − | − | − | − | + |
| OS (4) | − | − | − | − | − | + |
| PT3 (2) | − | − | − | − | − | + |
| PT10 | − | − | − | − | − | + |
| PT296 (2) | − | − | − | − | − | + |
| PT301 | − | − | − | − | − | + |
| PT350 (2) | − | − | − | − | − | + |
| PT353 | − | − | − | − | − | + |
| PT401 (4) | − | − | − | − | − | + |
| PT507 | − | − | − | − | − | + |
| PT510 | − | − | − | − | − | + |
PT, phage types according to the Dutch phage-typing system. ND, not determined.
+, PCR product present; −, PCR product absent.
PT506 is typed as phage type DT104 in the English phage-typing system.
DISCUSSION
The objective of the present work was to identify and characterize Salmonella serovar Typhimurium DT104-specific sequences, which may lead to the identification of novel virulence factors. Therefore, genomic subtractive hybridization was performed between Salmonella serovar Typhimurium LT2 and DT104, which resulted in novel DNA fragments not found in Salmonella serovar Typhimurium DT104 before. Notably, a large number of fragments were homologous to prophage sequences.
Based on sequence homology, three Salmonella serovar Typhimurium DT104 DNA fragments identified were associated with possible virulence factors: fragments 66, 117, and 144. Fragment 66 was homologous to the putative toxin subunit 1 gene of B. pertussis found in Salmonella serovar Typhi CT18. As mentioned earlier, it is unlikely that fragment 66 encodes a virulence factor because of its similarity to a pseudogene and the lack of other genes in the Salmonella serovar Typhimurium DT104 genome necessary to form the B. pertussis toxin.
Fragment 117 was highly similar to a part of the irsA gene of Salmonella serovar Typhimurium ATCC 14028. The irsA locus in Salmonella serovar Typhimurium ATCC 14028 is described as being involved in macrophage survival (1). In contrast, the irsA amino acid sequence is 91% homologous to a CP933R prophage protein of E. coli O157:H7 with unknown function (GenBank accession no. AAG56427.1) and 73% homologous to Gifsy prophage proteins (GenBank accession no. AAL19954.1 and AAL21514.1). Due to unknown functionality and homology to common prophage sequences, the virulence association of irsA remains to be elucidated.
Finally, the possible virulence factor association of fragment 144, which resulted in homology to HldD of E. coli O157:H7, is further analyzed. Recent insight into E. coli O157:H7 LPS assembly showed that HldD, in addition to HldE (formerly named WaaE or RfaE), is involved in the nucleotide-activated glycero-manno-heptose biosynthesis for inner core oligosaccharide assembly (13, 26). The HldD homologue found in Salmonella serovar Typhimurium DT104 may also be involved in the glycero-manno-heptose biosynthesis pathway. Notably, all known Salmonella serovar Typhimurium LT2 waa genes were also found in Salmonella serovar Typhimurium DT104 by using BLASTX analysis (data not shown). Therefore, the HldD homologue will most likely be an additional protein in Salmonella serovar Typhimurium DT104. The HldD homologue, as an additional protein for inner core oligosaccharide assembly, may lead to a different inner core structure of the LPS. A different inner core structure can result in a more stable outer membrane or in altered host recognition, leading to an altered immune response (reviewed in reference 21), resulting in increased survival and/or virulence. However, more research is needed to assess this role of the HldD homologue in Salmonella serovar Typhimurium DT104 virulence.
The five DNA fragments selected from the subtractive hybridization library, fragment 117 (irsA), fragment 144 (HldD homologue), and three fragments homologous to prophage sequences (fragments 84, 168, and 180), were Salmonella serovar Typhimurium DT104 specific among the tested serovar Typhimurium isolates (Table 4). Notably, in our PCR results, the irsA fragment appeared to be Salmonella serovar Typhimurium DT104 specific; however, this fragment is also present in the non-DT104 strain Salmonella serovar Typhimurium ATCC 14028 (1). Additional BLAST searches revealed that the upstream DNA regions of irsA in Salmonella serovar Typhimurium ATCC 14028 and DT104 differ (data not shown). Therefore, the tested irsA fragment is not Salmonella serovar Typhimurium DT104 specific, but the genome locus may be DT104 specific.
Many DNA fragments obtained in our study were grouped into larger genome fragments, such as SGI-I and the ST64B and ST104 prophages (Table 3). In this and earlier subtractive hybridization studies, almost all differences between closely-related strains were found to be located on large transferable elements such as prophages, plasmids, or fimbrial operons (6, 7, 17). In addition, our PCR results revealed Salmonella serovar Typhimurium DT104-specific prophage DNA fragments (Table 4), similar to a previously described Salmonella serovar Typhimurium DT104-specific DNA fragment that encodes E. coli O157:H7 prophage homologues (14, 20). These findings lead us to the assumption that several DNA fragments obtained from our subtractive hybridization are probably located on a novel Salmonella serovar Typhimurium DT104-specific prophage. Matching the fragments obtained to the Salmonella serovar Typhimurium DT104 unfinished genome revealed that all fragments of prophage subgroup iv and groups C and D (see Table 3), including irsA and the HldD homologue, are clustered (data not shown). This specific prophage may have contributed to the successful clonal expansion of Salmonella serovar Typhimurium DT104, as with Salmonella serovar Typhimurium DT49 and DT204, which contain phage SopEΦ and emerged in the 1970s and 1980s (8, 10, 16).
In summary, genomic subtraction is a useful tool for finding strain-specific genes, including possible virulence factor candidates. In addition, the PCR method developed revealed that the irsA and HldD homologue fragments and the three prophage fragments 84, 168, and 180 were Salmonella serovar Typhimurium DT104 specific among the tested serovar Typhimurium isolates and can be useful for better detection and typing of Salmonella serovar Typhimurium DT104.
Acknowledgments
This study was supported by The Netherlands Organization for Health Research and Development, “Nutrition: Health, Safety and Sustainability” program.
We are grateful to Annelien Beuling and Sükrü Yigit for technical assistance. The Salmonella serovar Typhimurium DT104 food and human isolates were kindly provided by Wim Wannet, National Institute of Public Health and the Environment (RIVM), The Netherlands; Dik Mevius, CIDC-Lelystad, The Netherlands; and Ole Alvseike of the Norwegian Institute for Public Health.
REFERENCES
- 1.Baumler, A. J., J. G. Kusters, I. Stojiljkovic, and F. Heffron. 1994. Salmonella typhimurium loci involved in survival within macrophages. Infect. Immun. 62:1623-1630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bogush, M. L., T. V. Velikodvorskaya, Y. B. Lebedev, L. G. Nikolaev, S. A. Lukyanov, A. F. Fradkov, B. K. Pliyev, M. N. Boichenko, G. N. Usatova, A. A. Vorobiev, G. L. Andersen, and E. D. Sverdlov. 1999. Identification and localization of differences between Escherichia coli and Salmonella typhimurium genomes by suppressive subtractive hybridization. Mol. Gen. Genet. 262:721-729. [DOI] [PubMed] [Google Scholar]
- 3.Boyd, D., G. A. Peters, A. Cloeckaert, K. S. Boumedine, E. Chaslus-Dancla, H. Imberechts, and M. R. Mulvey. 2001. Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. J. Bacteriol. 183:5725-5732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Boyd, E. F., and H. Brussow. 2002. Common themes among bacteriophage-encoded virulence factors and diversity among the bacteriophages involved. Trends Microbiol. 10:521-529. [DOI] [PubMed] [Google Scholar]
- 5.Briggs, C. E., and P. M. Fratamico. 1999. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob. Agents Chemother. 43:846-849. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.DeShazer, D. 2004. Genomic diversity of Burkholderia pseudomallei clinical isolates: subtractive hybridization reveals a Burkholderia mallei-specific prophage in B. pseudomallei 1026b. J. Bacteriol. 186:3938-3950. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Emmerth, M., W. Goebel, S. I. Miller, and C. J. Hueck. 1999. Genomic subtraction identifies Salmonella typhimurium prophages, F-related plasmid sequences, and a novel fimbrial operon, stf, which are absent in Salmonella typhi. J. Bacteriol. 181:5652-5661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Figueroa-Bossi, N., S. Uzzau, D. Maloriol, and L. Bossi. 2001. Variable assortment of prophages provides a transferable repertoire of pathogenic determinants in Salmonella. Mol. Microbiol. 39:260-271. [DOI] [PubMed] [Google Scholar]
- 9.Glynn, M. K., C. Bopp, W. Dewitt, P. Dabney, M. Mokhtar, and F. J. Angulo. 1998. Emergence of multidrug-resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N. Engl. J. Med. 338:1333-1338. [DOI] [PubMed] [Google Scholar]
- 10.Hardt, W. D., H. Urlaub, and J. E. Galan. 1998. A substrate of the centisome 63 type III protein secretion system of Salmonella typhimurium is encoded by a cryptic bacteriophage. Proc. Natl. Acad. Sci. USA 95:2574-2579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hou, Y. M. 1999. Transfer RNAs and pathogenicity islands. Trends Biochem. Sci. 24:295-298. [DOI] [PubMed] [Google Scholar]
- 12.Humphrey, T. 2001. Salmonella typhimurium definitive type 104 A multi-resistant Salmonella. Int. J. Food Microbiol. 67:173-186. [DOI] [PubMed] [Google Scholar]
- 13.Kneidinger, B., C. Marolda, M. Graninger, A. Zamyatina, F. McArthur, P. Kosma, M. A. Valvano, and P. Messner. 2002. Biosynthesis pathway of ADP-l-glycero-β-d-manno-heptose in Escherichia coli. J. Bacteriol. 184:363-369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Malorny, B., A. Schroeter, C. Bunge, and R. Helmuth. 2002. Prevalence of Escherichia coli O157:H7 prophage-like sequences among German Salmonella enterica serotype Typhimurium phage types and their use in detection of phage type DT104 by the polymerase chain reaction. Vet. Microbiol. 87:253-265. [DOI] [PubMed] [Google Scholar]
- 15.McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L. Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S. Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan, H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, and R. K. Wilson. 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852-856. [DOI] [PubMed] [Google Scholar]
- 16.Mirold, S., W. Rabsch, M. Rohde, S. Stender, H. Tschape, H. Russmann, E. Igwe, and W. D. Hardt. 1999. Isolation of a temperate bacteriophage encoding the type III effector protein SopE from an epidemic Salmonella typhimurium strain. Proc. Natl. Acad. Sci. USA 96:9845-9850. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Morrow, B. J., J. E. Graham, and R. Curtiss III. 1999. Genomic subtractive hybridization and selective capture of transcribed sequences identify a novel Salmonella typhimurium fimbrial operon and putative transcriptional regulator that are absent from the Salmonella typhi genome. Infect. Immun. 67:5106-5116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Nicosia, A., M. Perugini, C. Franzini, M. C. Casagli, M. G. Borri, G. Antoni, M. Almoni, P. Neri, G. Ratti, and R. Rappuoli. 1986. Cloning and sequencing of the pertussis toxin genes: operon structure and gene duplication. Proc. Natl. Acad. Sci. USA 83:4631-4635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Parkhill, J., G. Dougan, K. D. James, N. R. Thomson, D. Pickard, J. Wain, C. Churcher, K. L. Mungall, S. D. Bentley, M. T. Holden, M. Sebaihia, S. Baker, D. Basham, K. Brooks, T. Chillingworth, P. Connerton, A. Cronin, P. Davis, R. M. Davies, L. Dowd, N. White, J. Farrar, T. Feltwell, N. Hamlin, A. Haque, T. T. Hien, S. Holroyd, K. Jagels, A. Krogh, T. S. Larsen, S. Leather, S. Moule, P. O'Gaora, C. Parry, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S. Whitehead, and B. G. Barrell. 2001. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413:848-852. [DOI] [PubMed] [Google Scholar]
- 20.Pritchett, L. C., M. E. Konkel, J. M. Gay, and T. E. Besser. 2000. Identification of DT104 and U302 phage types among Salmonella enterica serotype typhimurium isolates by PCR. J. Clin. Microbiol. 38:3484-3488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Raetz, C. R., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71:635-700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Schmieger, H., and P. Schicklmaier. 1999. Transduction of multiple drug resistance of Salmonella enterica serovar Typhimurium DT104. FEMS Microbiol. Lett. 170:251-256. [DOI] [PubMed] [Google Scholar]
- 23.Tanaka, K., K. Nishimori, S. Makino, T. Nishimori, T. Kanno, R. Ishihara, T. Sameshima, M. Akiba, M. Nakazawa, Y. Yokomizo, and I. Uchida. 2004. Molecular characterization of a prophage of Salmonella enterica serotype Typhimurium DT104. J. Clin. Microbiol. 42:1807-1812. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Threlfall, E. J. 2000. Epidemic Salmonella typhimurium DT 104—a truly international multiresistant clone. J. Antimicrob. Chemother. 46:7-10. [DOI] [PubMed] [Google Scholar]
- 25.Threlfall, E. J., J. A. Frost, L. R. Ward, and B. Rowe. 1994. Epidemic in cattle and humans of Salmonella typhimurium DT 104 with chromosomally integrated multiple drug resistance. Vet. Rec. 134:577. [DOI] [PubMed] [Google Scholar]
- 26.Valvano, M. A., P. Messner, and P. Kosma. 2002. Novel pathways for biosynthesis of nucleotide-activated glycero-manno-heptose precursors of bacterial glycoproteins and cell surface polysaccharides. Microbiology 148:1979-1989. [DOI] [PubMed] [Google Scholar]
- 27.Van Duijkeren, E., W. J. Wannet, D. J. Houwers, and W. van Pelt. 2002. Serotype and phage type distribution of Salmonella strains isolated from humans, cattle, pigs, and chickens in The Netherlands from 1984 to 2001. J. Clin. Microbiol. 40:3980-3985. [DOI] [PMC free article] [PubMed] [Google Scholar]