Skip to main content
eLife logoLink to eLife
. 2025 Jul 15;13:RP104048. doi: 10.7554/eLife.104048

Human formin FHOD3-mediated actin elongation is required for sarcomere integrity in cardiomyocytes

Dylan A Valencia 1, Angela N Koeberlein 1, Haruko Nakano 2,3, Akos Rudas 4, Aanand A Patel 1,†, Airi Harui 5, Cassandra Spencer 2, Atsushi Nakano 2,3,6,7,✉, Margot E Quinlan 1,6,✉
Editors: Alphee Michelot8, Jonathan A Cooper9
PMCID: PMC12263155  PMID: 40663059

Abstract

Contractility and cell motility depend on accurately controlled assembly of the actin cytoskeleton. Formins are a large group of actin assembly proteins that nucleate and elongate new actin filaments. Some formins may cap filaments while others sever or bundle filaments. The formin homology domain-containing protein (FHOD) family of formins is critical to the formation of the fundamental contractile unit in muscle, the sarcomere. Specifically, mammalian FHOD3L plays an essential role in cardiomyocytes. Despite our knowledge of FHOD3L’s importance in cardiomyocytes, its biochemical and cellular activities remain poorly understood. It was proposed that FHOD-family formins act by capping and bundling, as opposed to assembling new filaments. Here, we demonstrate that human FHOD3L nucleates actin and rapidly but briefly elongates filaments after temporarily pausing elongation. We designed function-separating mutants that enabled us to distinguish which biochemical roles are required in the cell. We found that FHOD3L’s elongation activity, but not its nucleation, capping, or bundling activity, is necessary for proper sarcomere formation and contractile function in neonatal rat ventricular myocytes. The results of this work provide new insight into the mechanisms by which formins build specific structures and will contribute to knowledge regarding how cardiomyopathies arise from defects in sarcomere formation and maintenance.

Research organism: Rat

Introduction

Higher-order actin-based structures, such as the sarcomere, are the foundation for specific cellular functions that demand precise spatial and temporal coordination. Other examples of actin-based structures, including filopodia, stress fibers, and the cytokinetic furrow, are required for a wide range of processes, such as cell migration, adhesion, and division (Blanchoin et al., 2014; Svitkina, 2018). Hundreds of actin-binding proteins, and specific combinations thereof, coordinate to assemble these complex structures by accelerating actin assembly, cross-linking and bundling filaments, and stabilizing and/or disassembling actin filaments (Dominguez and Holmes, 2011; Lappalainen et al., 2022; Pollard, 2016). There are three known classes of actin nucleators that stimulate de novo filament assembly. Each class functions by a distinct mechanism, resulting in a unique starting point for the structure it initiates. One such class of actin nucleators, known as formins, mediates both nucleation and continued elongation of actin filaments. Formins are defined by their formin homology (FH) domains 1 and 2. The FH2 domain is highly conserved and forms a donut-shaped homodimer, which is sufficient to nucleate new filaments. After nucleation, the FH2 domain remains processively associated with the faster-growing barbed end of actin filaments, modifying the rate of elongation. The FH1 domain is less well conserved but contains proline-rich tracts that bind profilin-actin to facilitate elongation of actin filaments (Courtemanche, 2018; Paul and Pollard, 2008; Paul and Pollard, 2009). The regulatory domains for most formins are on either side of these FH domains, and an intramolecular interaction leads to autoinhibition (Goode and Eck, 2007; Li and Higgs, 2005; Schönichen and Geyer, 2010). The timing and strength of formin activity differ between formins, allowing for distinct roles within a given cell (Homa et al., 2021).

Multiple classes of formins have been linked to sarcomere structure, including disheveled associated activator of morphogenesis (Daam1, 2), diaphanous (Diaph1-3), formin homology domain-containing proteins (FHOD1, 3), and others (Deng et al., 2021; Iskratsch et al., 2010; Li et al., 2011; Mi-Mi et al., 2012; Molnár et al., 2014; Rosado et al., 2014; Sanger et al., 2017; Shwartz et al., 2016; Sundaramurthy et al., 2020; Taniguchi et al., 2009). There are two mammalian isoforms in the FHOD family of formins, FHOD1 and FHOD3 (Bechtold et al., 2014; Kanaya et al., 2005; Schönichen and Geyer, 2010). FHOD1 is widely expressed and assembles stress fibers that contribute to adhesion and motility of various cell types (Gasteier et al., 2003; Iskratsch et al., 2013; Koka et al., 2003; Schulze et al., 2014). Despite its localization to intercalated discs, structures important for rapid signal transmission and synchronized contractions, FHOD1 seems to be dispensable in cardiomyocytes (Al Haj et al., 2015; Dwyer et al., 2014; Sanematsu et al., 2019). In contrast, FHOD3 is implicated in sarcomere assembly and maintenance (Fujimoto et al., 2016; Iskratsch et al., 2010; Kan et al., 2012a; Taniguchi et al., 2009; Ushijima et al., 2018).

There are four isoforms of FHOD3 reported in Uniprot. Major differences are due to alternative splicing in the N-terminal half. An eight-residue insert in the C-terminal half, an acidic sequence (T(D/E)5XE), is present only in Uniprot isoform 4, which is commonly referred to as FHOD3L (Iskratsch et al., 2010). In this paper, we adopt the commonly accepted nomenclature in which FHOD3S (short) indicates Uniprot isoform 1, and FHOD3L (long) indicates Uniprot isoform 4 (Figure 1). FHOD3L is predominantly expressed in striated muscle, whereas FHOD3S is more widely expressed (Iskratsch et al., 2010; Taniguchi et al., 2009). In cardiomyocytes, FHOD3L localizes to sarcomeres in a striated pattern (Iskratsch et al., 2010; Kan et al., 2012b; Taniguchi et al., 2009). Interestingly, FHOD3L does not localize at the barbed end of actin filaments within sarcomeres. Instead, a direct interaction between FHOD3L and cardiac myosin-binding protein C (cMyBP-C) drives localization of FHOD3L to the so-called C zone of sarcomeres (Matsuyama et al., 2018). In the absence of cMyBP-C, FHOD3L is diffuse and cardiac function is compromised, suggesting that the balance between these two proteins is critical for proper heart function in mice (Matsuyama et al., 2018).

Figure 1. Domain structure of human FHOD3.

GBD = GTPase binding domain, DID = diaphanous inhibitory domain, CC = coiled coil (putative), FH = formin homology, DAD = diaphanous autoregulatory domain. Mutations tested in this study are indicated with black arrows. Numbers correspond to the FHOD3L sequence (Uniprot isoform 4). The FHOD3L-CT construct spans residues 963–1622, including the FH1 domain, FH2 domain, and tail. The FHOD3S-CT construct spans residues 771–1422 (Uniprot isoform 1 numbering). FHOD3L-specific exons are in gray. The eight-residue exon (T(D/E)5XE) that distinguishes FHOD3L-CT from FHOD3S-CT is circled in red.

Figure 1.

Figure 1—figure supplement 1. Coomassie-stained polyacrylamide gel of purified FHOD3 constructs.

Figure 1—figure supplement 1.

Lower molecular weight contaminants were difficult to remove, were relatively consistent for each construct, and had no detectable impact on FHOD activity.
Figure 1—figure supplement 1—source data 1. PDF file containing original file for Coomasie-stained SDS-PAGE gel displayed in Figure 1—figure supplement 1, indicating the relevant bands and treatments.
Figure 1—figure supplement 1—source data 2. Original file for Coomasie-stained SDS-PAGE gel displayed in Figure 1—figure supplement 1.

Mutations in the FHOD3 gene are deemed causative in at least 1–2% of patients with hypertrophic cardiomyopathy (HCM), in addition to cases of left ventricular noncompaction, dilated cardiomyopathy, and progressive high-frequency hearing loss (Arimura et al., 2013; Boussaty et al., 2023; Myasnikov et al., 2022; Ochoa, 2018). Moreover, recent clinical studies show that HCM-linked FHOD3 mutations increase the risk of cardiovascular death and all-cause death, with the onset of the disease occurring as early as age 4 and as late as age 63 (Vodnjov et al., 2023; Wu et al., 2021).

Despite its known physiological significance, we lack a mechanistic understanding of FHOD3L’s role in cardiac development and function. Early biochemical analysis suggested that FHOD-family formins were an atypical class of formins. Both purified mammalian isoforms (FHOD1 and FHOD3) were found to decelerate, rather than accelerate, actin assembly in vitro (Schönichen et al., 2013; Taniguchi et al., 2009). In addition, actin bundling was observed for FHOD1 (Schönichen et al., 2013). Consistently, FHOD1 mediates nuclear movement by bundling and anchoring actin filaments (Antoku et al., 2023). However, it fails to complete this function when a highly conserved isoleucine in the FH2 domain is mutated (hereafter, referred to as the IA mutation) (Kutscheidt et al., 2014). The IA mutation is known to disrupt both nucleation and elongation in most, if not all, formins, indicating that FHOD1 may enhance actin assembly in vivo (Patel et al., 2018; Xu et al., 2004). In addition, FHOD proteins are required to form new sarcomeres in rat cardiomyocytes, human induced cardiomyocytes, worms, and mice (Iskratsch et al., 2010; Kan et al., 2012a; Mi-Mi et al., 2012; Taniguchi et al., 2009). FHODs with the IA mutation do not support the formation of new sarcomeres, suggesting that actin assembly activity is required for this process, in conflict with the biochemical data (Kan et al., 2012a; Shwartz et al., 2016; Taniguchi et al., 2009; Xu et al., 2004). Most recently, in the worm, FHOD protein was shown to cooperate with profilin to build muscle, providing strong evidence that it functions by elongating actin filaments (Kimmich et al., 2024). Previously, we found that Drosophila Fhod is a potent actin nucleator that can accelerate actin elongation under certain conditions (Bremer et al., 2024; Patel et al., 2018). We also showed that human FHOD1 can nucleate actin, but its activity is sensitive to the actin isoform (Patel et al., 2018). We confirmed that both of these Fhod-family formins lose activity when the IA mutation is introduced (Patel et al., 2018). Based on these biochemical results and the data regarding Fhod-family formins in muscle of multiple species, we asked whether human FHOD3L can also nucleate.

Here, we show that purified FHOD3L can accelerate actin assembly by both nucleation and elongation. We also confirm that FHOD3L potently caps filaments, in the absence of profilin, and bundles. Using function-separating mutations, we correlate FHOD3L’s biochemistry to the integrity of the sarcomere within cardiomyocytes. We found that reduced nucleation, capping, and bundling by FHOD3L are well tolerated in neonatal rat ventricular myocytes (NRVMs), whereas elongation activity is necessary for proper sarcomere formation and function.

Results

Biochemical characterization of human FHOD3

We purified the C-terminal half of human FHOD3L (FHOD3L-CT), encompassing the FH1 domain, FH2 domain, and C-terminal tail, which is typically sufficient for actin assembly in vitro and in vivo (Figure 1, Figure 1—figure supplement 1; Courtemanche, 2018; Patel et al., 2018). In contrast to an earlier report, we found that FHOD3L-CT enhances rabbit skeletal muscle actin (RSA) assembly in bulk pyrene assays (Figure 2A and B, Table 1; Taniguchi et al., 2009). (Table 1 summarizes all biochemical measurements.) Consistent with nucleation activity, when we visualized the products of similar reactions, we observed many more filaments in the presence of FHOD3L-CT compared to actin alone (Figure 2—figure supplement 1A). We also asked if the shorter, alternatively spliced FHOD3 isoform, FHOD3S-CT, nucleates actin. FHOD3S-CT, which lacks eight acidic residues at the end of its FH2 domain compared to FHOD3L-CT, accelerates actin assembly (~30%) more potently than FHOD3L-CT (Figure 2B, Figure 2—figure supplement 2A). We quantified the activity of each construct by plotting the slope of the actin assembly curve shortly after the reaction is initiated (t1/8 = time until reaction has reached 1/8th completion) as a function of the FHOD3L-CT added. The slopes of these data points are then used to compare specific activity levels. In the cases of FHOD3L-CT vs FHOD3S-CT, the slopes are 0.32 ±0.04 vs 0.42 ± 0.04, respectively. Thus, we conclude that the C-terminal half of both FHOD3 isoforms (hereafter, FHOD3S/L-CT) is able to nucleate actin filaments.

Figure 2. Biochemical characterization of human FHOD3L.

(A) Assembly of 4 µM actin (5% pyrene-labeled) and the indicated concentrations of FHOD3L-CT from a twofold dilution series. (Higher concentrations of FHOD3L-CT are darker shades of blue. Symbols reflect the highest, middle, and lowest concentrations tested. In this case, circle = 60 nM, square = 15 nM, and triangle = 3.75 nM FHOD3LT-CT.) The inset shows the first 200 s of data normalized to the plateau of actin alone. (B) Relative nucleation activities of FHOD3L-CT (n=5), FHOD3S-CT (n=4), FHOD3L-CT K1309A (n=3), and I1163A (n=3). Nucleation strength is described by the rate of assembly (i.e. slopes from traces like those in A), at an early timepoint, when nucleation dominates (t1/8), as a function of formin added. Data points are means, and error bars are standard deviations. Slopes reported are the average slopes of independent experiments. The asterisks indicate significance of difference from FHOD3L-CT (see below for details). (C) Barbed-end elongation assay. Final conditions were 0.25 µM F-actin seeds (~0.1 nM barbed ends), 0.5 µM actin (10% pyrene-labeled), and indicated concentrations of FHOD3L-CT. (D) Quantification of barbed-end affinity for FHOD3L-CT (from C), FHOD3S-CT (from Figure 2—figure supplement 2B), and FHOD3L-CT I1163A (see Figure 2—figure supplement 1C for extended axes). Raw data are shown, and lines are fit to all data points. The Kds reported are the averages of three independent trials (n=3, each; mean ± SD). (E) Barbed-end elongation assay with profilin. Final conditions as in (C) plus 1.5 µM Schizosaccharomyces pombe profilin. (F) Kymograph of a growing filament from a total internal reflection fluorescence (TIRF) assay with FHOD3L-CT. Conditions: 1 µM actin (10%-Alexa Fluor 488-labeled), 5 µM Hs profilin-1, and 0.1 nM FHOD3L-CT. The green lines indicate bright regions of growing filament. The yellow lines represent dim regions. The orange line is a pause. Rates calculated for each region are reported as subunits/s. (G) Kymograph of a growing filament from a TIRF assay without added FHOD3L-CT. Conditions: 1 µM actin (10%-Alexa Fluor 488-labeled), 5 µM Hs profilin-1. The green lines indicate bright regions of growing filament. The red lines represent dim regions. Rates calculated for each region are reported as subunits/s. (H) Elongation rates from TIRF assays. Average elongation rates (10–100 s of seconds) and elongation rates from brief (1–10 s) dim regions are shown separately (n=21, profilin-actin [avg]; n=27 profilin-actin [dim]; n=20, FHOD3L-CT [avg]; n=112, FHOD3L-CT [dim]; 3 channels for all samples; mean ± SD). (I) Coomassie-stained polyacrylamide gel of pellet fractions from low-speed bundling assays with 5 µM actin and 0–60 nM FHOD3L-CT. (J) Quantification of bundling from (I) via densitometry (n=3 each group; mean ± SD). *p<0.05, **p<0.001, ***p<0.0001. p-Values were determined by one-way ANOVA with post hoc Tukey test.

Figure 2—source data 1. PDF file containing original file for Coomasie stained SDS-PAGE gels displayed in Figure 2I, Figure 2—figure supplement 2H, indicating the relevant bands and treatments.
Figure 2—source data 2. Original file for Coomasie-stained SDS-PAGE gels displayed in Figure 2I, Figure 2—figure supplement 2H.

Figure 2.

Figure 2—figure supplement 1. Extended biochemical characterization of human FHOD3L.

Figure 2—figure supplement 1.

(A) Actin polymerized in the absence or presence of 12 nM FHOD3L-CT, stabilized with fluorescent phalloidin diluted to 5 nM (n=3, each; mean ± SD). Scale bars, 10 µm. (B) Pyrene fluorescence readings of 4 µM actin filaments (5% pyrene-labeled) incubated with different concentrations of FHOD3L-CT I1163A for 5 min (n=2; mean ± SD). (C) Quantification of barbed-end affinity (from Figure 2C and D) with axes extended. (D) Time-lapse images from total internal reflection fluorescence (TIRF) microscopy. Conditions: 1 µM actin (10%-Alexa Fluor 488-labeled), 5 µM Hs profilin-1 ±0.1 nM FHOD3L-CT. Yellow arrows indicate the beginning and end of the dim portion of the filament elongated by FHOD3L-CT. 2.5 s/frame. Scale bar, 10 µm. (E) Quantification of (dim) run lengths for FHOD3L-CT TIRF assays. (F) Duration of pauses observed before bursts in TIRF assays. (For E–F, n=112, FHOD3L-CT [dim]; 3 flow channels for all samples; mean ± SD.) (G) Comparison of dim event frequencies as a function of filament length. (H) Epifluorescence micrographs of phalloidin-stabilized filaments from low-speed bundling assays. Conditions: 5 µM actin without or with 15 nM FHOD3L-CT, diluted to 5 nM actin after centrifugation. Scale bars, 10 µm.
Figure 2—figure supplement 2. Comparison of FHOD3S to FHOD3L.

Figure 2—figure supplement 2.

(A) Assembly of 4 µM actin (5% pyrene-labeled) and the indicated concentrations of FHOD3S from a twofold dilution series. (Higher concentrations of FHOD3L-CT are darker shades of blue. Symbol reflects the highest, middle, and lowest concentration tested. In this case, circle = 48 nM, square = 12 nM, and triangle = 3 nM FHOD3LT-CT.) (B) Barbed-end elongation assay. Final conditions: 0.25 µM F-actin seeds (~0.1 nM barbed ends), 0.5 µM G-actin (10% pyrene-labeled), and 312.5 pM-5 nM FHOD3S-CT. (C) Kymograph of a growing filament from a total internal reflection fluorescence (TIRF) assay with FHOD3S-CT. Conditions: 1 µM actin (10%-Alexa Fluor 488-labeled), 5 µM Hs profilin-1, and 1 nM FHOD3S-CT. The green lines indicate bright regions of growing filament. The yellow lines represent dim regions. The orange lines are pauses. Rates calculated for each region are reported as subunits/s. (D) Elongation rates from TIRF assays. Average elongation rates (over 10 s of seconds) and formin-mediated elongation rates (dim) are shown separately. Conditions: 1 µM actin (10%-Alexa Fluor 488-labeled), 5 µM Hs profilin-1 ±0.1 nM FHOD3L-CT or 1 nM FHOD3S-CT (n=21, profilin-actin; n=20, 3L [avg]; n=24, 3S [avg], n=112, 3L [dim], n=78, 3S [dim]; 4 flow channels for 3S, 3 flow channels for all others; mean ± SD, p-values by one-way ANOVA with post hoc Tukey test). (E) Comparison of dim event frequencies as a function of filament length. (F) Quantification of (dim) run lengths for FHOD3S/L-CT TIRF assays (n=97, FHOD3L-CT; n=73, FHOD3S-CT; 3 flow channels for 3L, 4 flow channels for 3S; mean ± SD, p-values by Mann-Whitney U test). (G) Duration of capping events, i.e., pauses before bursts, by FHOD3L-CT vs FHOD3S-CT observed by TIRF microscopy (n=97, FHOD3L-CT; n=73, FHOD3S-CT; 3 flow channels for 3L, 4 flow channels for 3S; mean ± SD, p>0.05 by Mann-Whitney U test). (H) Coomassie-stained polyacrylamide gel of pellet fractions from low-speed bundling assays with 5 µM actin and 0–60 nM FHOD3S-CT. (I) Comparison of bundling for FHOD3S/L-CT via densitometry (n=3 each group; mean ± SD). *p<0.05, ***p<0.0001.
Figure 2—video 1. FHOD3S/L-CT pause actin filament elongation before brief acceleration.
Download video file (65.3MB, mp4)
Total internal reflection fluorescence (TIRF) elongation assays with either 100 pM FHOD3L-CT wild-type (WT) or 1 nM FHOD3S-CT WT. Conditions as in Figure 2F.

Table 1. Summary of biochemical measurements for FHOD3L-CT and mutants.

All data shown are means ± standard deviation, each from at least three independent experiments. n.d.=no data. Light gray columns are data acquired with bulk pyrene-actin-based assays without profilin added. Blue columns provide data from total internal reflection fluorescence (TIRF) analysis of individual filaments (profilin was present). The purple column reports data from the co-sedimentation assay.

Pyrene-actin-based assays TIRF-based assays Co-sedimentation
Nucleation strength (a.u./s) Barbed-end binding affinity (nM) Elongation rate (subunits/s) Run length (µm) Capping duration (s) Bundling (% actin pelleted at 60 nM)
FHOD3L-CT 0.32 ± 0.04 0.028 ± 0.005 39 ± 13 1.10 ± 0.49 11.8 ± 6.8 81.7 ± 2.9
FHOD3S-CT 0.42 ± 0.04* 0.750 ± 0.090* 33 ± 12 0.90 ± 0.33* 12.0 ± 7.8 56 ± 17
FHOD3L-CT I1163A –0.081 ± 0.002* 4.9 ± 1.4* n.d. n.d. n.d. n.d.
FHOD3L-CT K1309A 0.04 ± 0.02* n.d. n.d. n.d. n.d. n.d.
FHOD3L-CT K1193L 0.10 ± 0.02* 0.470 ± 0.090* 38 ± 12 1.11 ± 0.42 12.7 ± 5.6 30.8 ± 0.7
FHOD3L-CT GS-FH1 Nucleates similarly via TIRF nucleation assay 0.218 ± 0.016* n.d. n.d. n.d. 61.7 ± 0.7
*

Statistically different from FHOD3L-CT. Analysis by ANOVA and Tukey post hoc tests, p<0.05. More details are in the figure legends.

To further compare FHOD3L-CT to previously characterized formins, we introduced mutations at conserved residues of the FH2 domain, I1163A and K1309A (Xu et al., 2004). Like other formins, the I1163A mutant lacked nucleation activity, while the K1309A mutant reduced nucleation by ~85% (Figure 2B). We observed a reduction in the plateau of pyrene traces with wild-type FHOD3S/L-CT and the mutants. The decrease was more apparent at higher concentrations of the nucleator and seemed to be dose-dependent (Figure 2A, Figure 2—figure supplement 2A). Control experiments demonstrated that the fluorescence change does not reflect quenching due to side binding or bundling (Figure 2—figure supplement 1B). We, therefore, measured barbed-end binding. We asked whether FHOD3L-CT inhibits filament elongation by performing bulk seeded elongation assays. Indeed, we found that FHOD3L-CT potently slows barbed-end elongation (Kapp = 0.023 ±0.005 nM; Figure 2C and D). (The shapes of these traces reflect the presence of activity in addition to capping [perhaps nucleation or bundling], especially at high concentrations, which could affect our estimate of the binding affinity.) Barbed-end binding by FHOD3S-CT is over 30 times weaker (Kapp = 0.750 ±0.090 nM) (Figure 2D). The IA mutation is generally thought to disrupt binding to both actin monomers and filament barbed ends. However, FHOD3L-CT I1163A has an affinity of 4.9 ±1.4 nM for barbed ends of actin filaments (Figure 2D, Figure 2—figure supplement 2C). While the affinity is >200-fold weaker than FHOD3L-CT, it still binds barbed ends tightly. Therefore, we interpret the plateau decrease observed in bulk assembly assays as evidence of barbed-end capping.

To directly observe the impact of FHOD3L-CT on growing actin filaments, we used total internal reflection fluorescence (TIRF) microscopy in the presence of profilin. Initially, we could not confirm that FHOD3L-CT was bound to these filaments. Most of the filaments elongated at rates indistinguishable from actin alone. We, therefore, repeated bulk seeded elongation assays in the presence of profilin. Under these conditions, we observed increased rates of actin assembly at low doses of FHOD3L-CT, confirming that the formin accelerates elongation (Figure 2E). In contrast, at higher formin concentrations, we found that elongation was actually slower than actin alone. We attribute the complicated shapes and dose response of these data to the contributions of elongation and capping. We also note that the concentrations required for FHOD3L-CT to elicit measurable changes in actin assembly indicate a marked apparent decrease (500- to 1000-fold) in affinity for the barbed end when profilin is present (Figure 2E).

Upon closer observation of individual filaments in the TIRF assay, we detected short dim stretches along the filaments. The dim regions reflected ‘bursts’ of fast elongation (Figure 2F). During the bursts, the filaments elongated ~3-fold faster (39 ± 13 subunits/s), consistent with formin-mediated elongation (Figure 2F and H, Figure 2—figure supplement 1D, Figure 2—video 1). The average length of filament produced during these bursts was 1.10 ±0.49 μm (Figure 2—figure supplement 1E), which is similar to the characteristic run length of Drosophila Fhod-A (~2 μm), but very different from other formins, which often range from 20 to 200 μm (Bremer et al., 2024; Cao et al., 2018; Moseley and Goode, 2005; Patel et al., 2018; Vizcarra et al., 2014). Interestingly, a pause often preceded the burst, lasting ~12 s on average (Figure 2—figure supplement 1F). To confirm that the short dim regions were not simply fluorescence inhomogeneities, which are also observed in these assays, we analyzed filaments growing in the absence of formin. Here, the velocity of dim regions was indistinguishable from the average velocity of the filaments, and no pauses were observed (Figure 2G and H). In addition, the frequency of dim spots was substantially lower (Figure 2—figure supplement 1G). FHOD3S-CT induced bursts similar to FHOD3L-CT but at slightly lower frequency (Figure 2—figure supplement 2C–E). The bursts were slightly, albeit statistically significantly, shorter (characteristic run length of 0.90 ±0.33 μm), while the pauses were indistinguishable from those generated by FHOD3L-CT (Figure 2—figure supplement 2F and G). We note that the resolution of our data is at the limit for describing these events. It follows that the metrics must be taken as our best estimates. Additional experiments are needed for more rigorous measurements of the elongation rate and characteristic run length. Furthermore, we cannot exclude that capping, although frequent (preceding 38 of 40 bursts for FHOD3L-CT), could reflect nonspecific interaction with the slide surface. Therefore, we conservatively conclude that, for brief intervals, FHOD3S/L-CT accelerates profilin-actin elongation ~3-fold, following what may be pauses in growth.

Next, we investigated bundling by FHOD3L-CT. To do so, we visually examined the organization of phalloidin-stabilized actin filaments after incubating with FHOD3L-CT. Bundles were readily apparent (Figure 2—figure supplement 1H). To better characterize bundling activity, we performed low-speed bundling assays with a fixed concentration of actin filaments and several concentrations of FHOD3L-CT (Figure 2H and I). We also compared this activity to bundling by FHOD3S-CT. We found that FHOD3L-CT bundles filaments somewhat more potently than FHOD3S-CT, which is most apparent at concentrations above 15 nM (Figure 2—figure supplement 2H and I).

Overall, FHOD3S/L-CT nucleates and elongates actin filaments. FHOD3S-CT is a more potent nucleator, a weaker barbed-end capper, and a slightly weaker bundler compared to FHOD3L-CT (Table 1). These data suggest that the acidic T(D/E)5XE insertion of FHOD3L interacts with different surfaces of the actin monomer depending on the biochemical activity. Perhaps the marked increase in capping by FHOD3L-CT is mediated by binding to a basic region exposed at the barbed end of filaments. Decreased activity levels of FHOD3L-CT, such as nucleation and bundling, may be due to the fact that most of the actin surface is acidic.

Biochemical validation of function-separating mutants

We next designed FHOD3L-CT mutants to separate nucleation and elongation. We also assessed the impact of these mutations on capping and bundling. Previously, Baker et al. identified mutations in the FH2 domain of Bni1 that diminish nucleation while maintaining elongation activity (Baker et al., 2015). Based on sequence and structural alignments, FHOD3L K1193 approximates one of these, Bni1 K1467. FHOD3L-CT K1193L nucleated with less than 33% of the strength seen for wild-type (Figure 3A). The barbed-end affinity of FHOD3L-CT K1193L was 0.470 ±0.090 nM, ~12-fold weaker than wild-type (Figure 3B). Importantly, K1193L-mediated elongation of actin filaments was indistinguishable from wild-type (bursts were again evident, with no significant difference in elongation rate, run length, or capping duration) (Figure 3C, Figure 3—figure supplement 1). Low-speed bundling assays showed that K1193L bundling is ~2-fold weaker than wild-type (Figure 3D). Thus, elongation is maintained while nucleation and bundling are strongly reduced by the K1193L mutation.

Figure 3. Biochemical validation of function-separating mutants.

(A) Relative nucleation activity for FHOD3L-CT (n=5) and FHOD3L-CT K1193L (n=5). Data points are means, and error bars are standard deviations. Slopes reported are the average slopes of independent experiments. (B) Barbed-end affinity measurements for FHOD3L-CT, FHOD3L-CT GS-FH1, and FHOD3L-CT K1193L. Raw data are shown, and the line is a fit to all data points. The Kds reported are the average of three independent trials (n=3, each; mean ± SD). (C) Elongation rates from total internal reflection fluorescence (TIRF) assays. Conditions: 1 µM actin (10%-Alexa Fluor 488-labeled), 5 µM Hs profilin-1 ± 0.1 nM FHOD3L-CT or 1 nM FHOD3L-CT K1193L. Average elongation rates (over 10–100 s of seconds) and formin-mediated elongation rates (dim) are shown separately (n=19, FHOD3L-CT K1193L [avg]; n=67, FHOD3L-CT K1193L [dim]; 3 flow channels; mean ± SD, p-values by one-way ANOVA with post hoc Tukey test). (D) Quantification of bundling by FHOD3L-CT GS-FH1 and K1193L (n=3, each; mean ± SD). (E) Nucleation test. Quantification of the number of filaments per field of view (FOV) for FHOD3L-CT and FHOD3L-CT GS-FH1. Conditions: 4 µM actin with indicated construct. Reaction was diluted in Alexa Fluor 488 Phalloidin to 5 nM actin for visualization. Five images were taken per independent experiment (n=15 images, each; 3 biological replicates, each; mean ± SD, p-values by one-way ANOVA with post hoc Tukey test). Representative images are shown in Figure 3—figure supplement 2B. (F) Barbed-end elongation assay for FHOD3L-CT GS-FH1 in the presence of profilin. (Higher concentrations of FHOD3L-CT are darker shades of blue. Symbols highlight the highest, middle, and lowest concentrations tested. In this case, circle = 20 nM, square = 5 nM, and triangle = 1.25 nM FHOD3LT-CT.) Final conditions: 0.25 µM F-actin seeds (~0.1 nM barbed ends), 0.5 µM actin (10% pyrene-labeled), 1.5 µM S. pombe profilin, and 1.25 nM-20 nM FHOD3L-CT GS-FH1 (n=2; mean ± SD). **p<0.001, ***p<0.0001.

Figure 3.

Figure 3—figure supplement 1. FHOD3L-CT K1193L elongation data.

Figure 3—figure supplement 1.

(A) Kymograph of a growing filament from a total internal reflection fluorescence (TIRF) assay with FHOD3L-CT K1193L. Conditions: 1 µM actin (10%-Alexa Fluor 488-labeled), 5 µM Hs profilin-1, and 1 nM FHOD3L-CT K1193L. The green lines indicate bright regions of growing filament. The yellow lines represent dim regions. The orange line is a pause. Rates calculated for each region are given as subunits/s. (B) Quantification of run lengths for FHOD3L-CT and FHOD3L-CT K1193L (p>0.05 by Mann-Whitney U test). (C) Duration of capping events by FHOD3L-CT and FHOD3L-CT K1193L observed by TIRF microscopy (p>0.05 by Mann-Whitney U test).
Figure 3—figure supplement 2. Visualization of nucleation.

Figure 3—figure supplement 2.

(A) Total internal reflection fluorescence (TIRF) micrographs from nucleation assays using 4 µM actin diluted to 5 nM actin in the presence or absence of 46 nM FHOD3L-CT GS-FH1. Aggregates are apparent in the presence of FHOD3L CT GS-FH1. (B) TIRF micrographs from nucleation assays using 4 µM actin and indicated concentration of FHOD3 construct. Samples were diluted to 5 nM actin in Alexa Fluor 488 Phalloidin for visualization. The number of aggregates was negligible at lower concentrations of FHOD3L-CT GS-FH1. Quantification is shown in Figure 3E. Scale bars, 10 µm.

To remove FH1-mediated acceleration of elongation, we substituted glycine-serine linkers for the polyproline tracts in FHOD3L-CT (Zweifel and Courtemanche, 2020). (The FH2 domain alone was unstable in vitro.) Pyrene-based actin assembly assays were confounded by bundling/aggregation induced by this construct. Although low-speed co-sedimentation assays indicated that the bundling strength of FHOD3L-CT GS-FH1 is slightly weaker than that of wild-type, images show irregular shapes that may scatter light more, thereby disrupting the pyrene signal (Figure 3D, Figure 3—figure supplement 2A). Therefore, to compare the nucleation strength of FHOD3L-CT GS-FH1 with wild-type, we counted filaments using TIRF microscopy. We observed similar numbers of filaments generated in the presence of low concentrations (used to minimize bundling) of FHOD3L-CT wild-type or GS-FH1 (Figure 3E, Figure 3—figure supplement 2B). Barbed-end elongation assays in the absence of profilin demonstrated a weakened affinity of FHOD3L-CT GS-FH1 (Kapp = 0.218 ±0.016 nM) (Figure 3B). This finding suggests that the stiffness of the FH1 domain impacts barbed-end binding, but we cannot say whether the effect is direct or indirect. Interestingly, profilin did not decrease barbed-end binding of FHOD3L-CT GS-FH1 (Kapp = 0.21 ±0.13 nM; Figure 3F). Finally, and most importantly, only deceleration was observed in assays with profilin, confirming that elongation was not enhanced by FHOD3L-CT GS-FH1, at any concentration tested (Figure 3F). Thus, nucleation is maintained while acceleration of elongation is no longer detected.

Together, these mutations provide a range of nucleation, elongation, capping, and bundling activities (Table 1). We, therefore, used them to assess the correlation of biochemical activities with sarcomere formation and function in cardiomyocytes.

FHOD3L rescues sarcomere organization and contractility in NRVMs

In order to perform structure-function analysis in a cellular context, we established methods to knock down and rescue FHOD3L in NRVMs (similar to Taniguchi et al., 2009; Figure 4A). Briefly, freshly isolated NRVMs were treated with small interfering RNA (siRNA) targeting FHOD3 using reverse transfection (see Materials and methods for details). Adenoviral infection, driving expression of rescue constructs, was initiated 2 days after siRNA treatment, and cells were examined (fixed or live) 2 days after infection (Figure 4A). The rescue constructs contained human FHOD3L, which is not targeted by the siRNA used to remove endogenous rat FHOD3. In all cases, cells were treated with siRNA and adenovirus. For negative controls, AllStars Negative Control siRNA and/or empty virus were substituted for the FHOD3-specific reagents. Thus, we refer to the negative control experiment as a mock knockdown and the knockdown alone as a mock rescue. During assay development, we found that knockdown reduced FHOD3 mRNA to ~35% of original levels after 4 days, with either of two commercially available oligos (Figure 4—figure supplement 1A). At this time point, we detected an ~80% reduction in endogenous FHOD3 protein via western blot (Figure 4B and C).

Figure 4. FHOD3L rescues sarcomere organization in neonatal rat ventricular myocytes (NRVMs).

(A) Overview of the rescue-experiment protocol. Reverse transfection of small interfering RNA (siRNA) upon plating NRVMs followed by infection with adenovirus to drive exogenous expression. (B) Western blot showing depletion of endogenous FHOD3 after knockdown, and exogenous FHOD3L expression levels after rescue. GAPDH used as a loading control. (C) Quantification of western blot in (B) normalized to GAPDH for each lane and then normalized to endogenous levels in the mock knockdown (n=3, each; mean ± SD). (D) Sarcomere integrity indicated by immunofluorescent staining of α-actinin (green). Localization of exogenous HA-FHOD3L is shown in magenta. DAPI (blue) is included in the merged images. Wheat germ agglutinin (WGA) is not shown for clarity. (E) Quantification of sarcomere number per NRVM (n=160 cells, mock KD; n=334 cells, mock rescue; n=110 cells, FHOD3L rescue). (F) Average sarcomere lengths per NRVM (n=100 cells, mock KD; n=71 cells, mock rescue; n=92 cells, FHOD3L rescue). (G) Average sarcomere widths (Z-line lengths) per NRVM (n=100 cells, mock KD; n=71 cells, mock rescue; n=92 cells, FHOD3L rescue). (H) Epifluorescent micrographs showing mock knockdown and FHOD3L-rescued NRVMs stained, with phalloidin (green) to visualize thin filaments and anti-HA (magenta) to show expression of exogenous FHOD3L. (I) Quantification of thin filament lengths for mock knockdown and FHOD3L-rescued NRVMs (n=94 cells, mock KD; n=84 cells, wild-type [WT] rescue). For (E, F, G, I), data from three biological replicates for each condition are represented by different shades. Mean ± SD is shown. p-Values were calculated with Mann-Whitney U tests, *p<0.05; **p<0.001.

Figure 4—source data 1. PDF files containing original file western blots displayed in Figure 4B, indicating the relevant bands and treatments.
Figure 4—source data 2. Originals file for westerns blots displayed in Figure 4B.

Figure 4.

Figure 4—figure supplement 1. Method establishment for FHOD3L rescues in neonatal rat ventricular myocytes (NRVMs).

Figure 4—figure supplement 1.

(A) Relative mRNA expression of FHOD3 in NRVMs after knockdown with two different small interfering RNA (siRNA) oligos compared to GAPDH mRNA expression (n=2 wells, 1 biological replicate; mean). (B) Typical image of CellPose segmentation of wild-type FHOD3L-rescued NRVMs, used for per cell quantification of sarcomeres, overlaid with the α-actinin channel. Regions of interest (ROIs) are numbered. Scale bar, 20 µm. (C) Pairwise correlation of normalized DsRed vs HA fluorescence intensity from FHOD3L rescue, plotted per NRVM area. Correlation is too weak to use DsRed as an expression level reporter (n=347 cells; 1 biological replicate). (D) Normalized and background-corrected 3xHA-FHOD3L fluorescence intensity per NRVM area from rescue experiments. Magenta line indicates the upper expression level cutoff (2700 a.u./µm2) used to select cells for further analysis (n=913 cells; 3 biological replicates; mean ± SD). (E) Normalized and background-corrected 3xHA-FHOD3L fluorescence intensity per NRVM area from the same three replicates as in (D). These cells were randomly selected for further analysis. (F) Pairwise correlation of HA fluorescence intensity vs sarcomere number, sarcomere length, or sarcomere width from FHOD3L rescue, plotted per NRVM area. No correlation is detected. (Dashed line shows trend when cells lacking sarcomeres [red] are excluded. Solid line shows the trend for all cells analyzed.)

We analyzed sarcomere structure in fixed samples. To detect sarcomeres, we stained cells with anti-α-actinin antibodies (Figure 4D). To analyze on a per cell basis, we stained plasma membranes with wheat germ agglutinin (WGA) and segmented the NRVMs with CellPose (Stringer et al., 2021; Figure 4—figure supplement 1B). The DsRed reporter did not provide an accurate readout of exogenous 3xHA-FHOD3L (hereafter, FHOD3L) expression levels (Figure 4—figure supplement 1C). Therefore, we used anti-HA antibodies to quantify the expression of exogenous FHOD3 on a per cell basis. By western analysis, we found that average exogenous FHOD3L expression could be as high as ~190% above endogenous levels at the end of the rescue timeline (Figure 4B and C). We, therefore, examined the impact of FHOD3L expression level on sarcomere structure. We detected essentially no correlation (R2 ranges from 0.001 to 0.04) of sarcomere number, length, or width over a tenfold change in FHOD3L expression levels (Figure 4—figure supplement 1D–F). Despite the evidence that sarcomere structure was not a function of FHOD3 expression levels, we decided to exclude NRVMs that express very highly above endogenous FHOD3 levels. We set an upper cutoff for the normalized exogenous FHOD3L expression per cell area of 5% and applied that same intensity level as a cutoff for all other experiments (Figure 4—figure supplement 1D). We also set a lower cutoff slightly above background HA levels to exclude NRVMs not expressing exogenous FHOD3L.

We confirmed that sarcomeres remained organized upon mock knockdown, counting 12 ± 13 sarcomeres per cell (Figure 4D and E, Table 2). (Measurements from NRVMs are summarized in Table 2.) Sarcomeres were largely absent in the mock rescue (3 ± 7) with α-actinin puncta and aggregates visible by immunofluorescence (IF) (Figure 4D and E). Expression of wild-type FHOD3L was sufficient to rescue the loss of sarcomeres, and anti-HA staining demonstrated that exogenous FHOD3L localized to sarcomeres, as expected (Figure 4D). In fact, FHOD3L-rescued NRVMs formed significantly more sarcomeres than the mock knockdown NRVMs (19 ±14 vs 12 ± 13; Figure 4E). We note that the sarcomere number measurement has a high standard deviation because some cells within the expression level cutoffs, including at relatively high levels of detected FHOD3L, lacked sarcomeres (Figure 4—figure supplement 1F). Such right-tailed distributions are consistent with other reports of sarcomere numbers per cardiomyocyte (Neininger-Castro et al., 2023).

Table 2. Summary of FHOD3L and mutant rescue experiments in neonatal rat ventricular myocytes (NRVMs).

All data shown are means ± standard deviation, each from three independent experiments (except for GS-FH1 rescue: maximal contraction and relaxation velocity measurements and average % rhythmic contractions from two independent experiments due to one biological replicate not contracting). n.d.=no data. In the lightest columns, ‘–’ indicates treatment with negative control small interfering RNA (siRNA) or empty virus, ‘+’ indicates treatment with FHOD3 siRNA or corresponding FHOD3L adenovirus. Data in the orange columns were acquired from fixed and stained cells. Data in the red columns were acquired from live cells. Statistical analyses are described in the figure legends. ‘In the lightest columns’ should be ‘In the yellow columns’. Data in the ‘medium-colored columns’ should be ‘Data in the orange columns’. ‘Data in the darkest columns’ should be ‘Data in the red columns’.

Treatment Fixed samples Live samples
FHOD3 KD? FHOD3 AdV? Avg sarcomere number per NRVM Sarcomere length (µm) Z-line length (µm) Thin filament length (nm) Maximal contraction velocity (µm/s) Maximal relaxation velocity (µm/s) Avg % rhythmic contractions Avg % contracting NRCs in FOV
Mock knockdown – – 12 ± 13 1.71 ± 0.22 1.69 ± 0.43 925 ± 94 7.9 ± 1.6 6.0 ± 1.7 74 ± 9 98.2 ± 3.2
Mock rescue + – 3 ± 7* 1.46 ± 0.37* 1.38 ± 0.46* n.d. 6.0 ± 1.7* 4.4 ± 1.5* 14 ± 12 89 ± 11
FHOD3L rescue + + 19 ±14*, † 1.72 ± 0.18† 1.71 ± 0.46† 739 ±81*, † 7.5 ± 1.5† 6.1 ± 1.5† 72 ± 20 97.2 ± 4.8
K1193L rescue + + 17 ± 17 1.69 ± 0.16 1.73 ± 0.41 792 ± 79 ‡ 7.7 ± 1.6 5.9 ± 1.6 88 ± 21 98.2 ± 3.2
GS-FH1 rescue + + 2 ± 4 ‡ 1.42 ± 0.35 ‡ 1.23 ± 0.29‡ n.d. 5.6 ± 1.7‡ 3.6 ± 1.2 ‡ 3.7 ± 5.2 32 ± 32
FHOD3L overexpression – + n.d. n.d. n.d. n.d. 6.6 ± 1.6‡ 5.5 ± 1.6 ‡ 72 ± 21 76 ± 32
*

Statistically different from mock KD (mock rescue and Fhod3L rescue).

†

Statistically different from mock rescue (FHOD3L and GS-FH1).

‡

Statistically different from FHOD3L rescue (all mutant rescues and overexpression).

To analyze sarcomere integrity more closely, we measured sarcomere lengths (Z-line to Z-line) and widths (Z-line lengths). In the mock rescue cells, the sarcomeres that remained were both shorter and narrower than those in the mock knockdown cells (Figure 4F and G). When rescued with FHOD3L, sarcomere lengths (1.72 ±0.18 µm) and sarcomere widths (1.70 ±0.46 µm) recovered to lengths comparable to the mock knockdown control (Figure 4F and G). To measure thin filament length, we stained NRVMs with phalloidin and anti-HA. We observed shorter thin filament lengths in FHOD3L-rescued NRVMs (739 ±81 nm) compared to mock knockdown NRVMs (925 ±94 nm) (Figure 4H and I). The difference in thin filament length could reflect the increased number of sarcomeres in the rescued cells and/or could indicate that the sarcomeres have not reached their final steady state after 2 days of FHOD3L expression. Overall, FHOD3L-rescued NRVMs form sarcomeres de novo that well approximate the sarcomeres in the negative control. We compared further experimental results to FHOD3L rescue cells, due to the slight differences.

We next measured contractile function in FHOD3L-rescued NRVMs. To do so, we used a motionGUI MATLAB program that makes use of digital image correlation (DIC) to measure contractility (Huebsch et al., 2015; Nakano et al., 2017). Contraction and relaxation velocities inform us about systolic and diastolic function of the cardiomyocytes, respectively, and thus their ability to promote proper blood flow in organisms (Ferreira-Martins and Leite-Moreira, 2010). As expected, maximal contraction and relaxation velocities were both significantly decreased upon FHOD3 knockdown (Figure 5A, B, and D, Figure 5—figure supplement 1A). Both velocities recovered to mock knockdown levels by subsequent expression of FHOD3L (Figure 5A, C, and D, Figure 5—figure supplement 1A, Figure 5—video 1). We also examined the expression of FHOD3L in an otherwise untreated background (overexpression). Intensity of exogenous FHOD3L per NRVM was notably lower compared to the wild-type rescue despite infecting with the same titer, suggesting that NRVMs attempt to maintain FHOD3L levels below some maximum (Figure 5—figure supplement 2A). Consistent with this idea, contraction and relaxation velocities were reduced upon overexpression of FHOD3L (Figure 5—figure supplement 2B and C). These data further demonstrate that the expression levels in our rescue experiments, while higher on average than endogenous levels, are within an acceptable range.

Figure 5. FHOD3L rescues contractility in neonatal rat ventricular myocytes.

(A–C) Motion analysis by digital image correlation. Mock knockdown, mock rescue, and FHOD3L rescue beating patterns are shown. The first (•) and the second (▲) peak of each duplex represent the contraction and the relaxation, respectively. (D) Maximal contraction velocities quantified for mock knockdown, mock rescue, and FHOD3L wild-type rescue (n=82 regions of interest [ROIs], mock KD, n=81 ROIs, mock rescue, n=72, ROIs, FHOD3L rescue; 3 biological replicates, each; mean ± SD, p-values by Student’s two-sample, unpaired t-test). (E) Quantification of the percentage of analyzed ROIs from the videos that contained rhythmic contractions for mock knockdown, mock rescue, and FHOD3L wild-type rescue (n=3, each; mean ± SD). **p<0.001.

Figure 5.

Figure 5—figure supplement 1. Relaxation velocity and fraction contracting.

Figure 5—figure supplement 1.

(A) Maximal relaxation velocities quantified for mock knockdown, mock rescue, and FHOD3L rescue (n=82 regions of interest [ROIs], mock KD; n=81 ROIs, mock rescue; n=72, ROIs, FHOD3L rescue; 3 biological replicates, each; mean ± SD, p-values by Student’s two-sample, unpaired t-test). (B) Estimate of the percentage of neonatal rat ventricular myocytes (NRVMs) contracting in each video for mock knockdown, mock rescue, and FHOD3L rescue (n=3, each; mean ± SD). *p<0.05, **p<0.001, ***p<0.0001.
Figure 5—figure supplement 2. Overexpression of FHOD3L.

Figure 5—figure supplement 2.

(A) Comparison of 3xHA-FHOD3L fluorescence intensity per neonatal rat ventricular myocyte (NRVM) area from rescue experiments and overexpression experiments. Data are normalized and background-corrected as in Figure 4—figure supplement 1D. (B) Maximal contraction velocities quantified for mock knockdown and FHOD3L overexpression NRVMs (n=82 regions of interest [ROIs], mock KD; n=79 ROIs, FHOD3L overexpression; 3 biological replicates, each; mean ± SD, p-value by Student’s two-sample, unpaired t-test). (C) Maximal relaxation velocities quantified for mock knockdown and FHOD3L overexpression NRVMs (n=82 ROIs, mock KD, n=79 ROIs, FHOD3L overexpression; 3 biological replicates, each; mean ± SD, p-value by Student’s two-sample, unpaired t-test). (D) Quantification of rhythmic contractions as in Figure 5E for mock knockdown and overexpression NRVMs (n=3, each; mean ± SD). (E) Estimate of the percentage of NRVMs contracting in each video for mock knockdown and overexpression NRVMs (n=3, each; mean ± SD). *p<0.05, **p<0.001, ***p<0.0001.
Figure 5—video 1. Exogenous FHOD3L expression rescues rhythmic contractions in neonatal rat ventricular myocytes (NRVMs).
Download video file (15.1MB, mp4)
This video shows digital image correlation (DIC) analysis of NRVMs from control and rescue conditions as in Figure 5.

To assess the impact of FHOD3L depletion on cardiac rhythm, we measured the percentage of beating area in each video that exhibited consistent, rhythmic contractions (defined as no more than 1 beat out of sync in a 10 s period). We observed rhythmic contractions for both the mock knockdown NRVMs and FHOD3L-rescued NRVMs for ~75% of the analyzed videos (Figure 5A, C, and E, Figure 5—video 1). In contrast, primarily arrhythmic contractions were detected in FHOD3-depleted NRVMs, with only ~15% of the videos showing rhythmic beating (Figure 5B and E, Figure 5—video 1). To assess whether some NRVMs in these conditions were not contracting at all, we estimated the proportion of NRVMs that were contracting per video and found contractions throughout ~95% of the field of view on average for both mock knockdown NRVMs and wild-type FHOD3L-rescued NRVMs (Figure 5—figure supplement 1B). For FHOD3-depleted NRVMs, we observed a reduction in contractile area to ~80% (Figure 5—figure supplement 1B). This value was higher than expected based on other metrics (Figure 5D and E). We attribute some of the movement to neighboring cells pulling each other. We also quantified contractility when we overexpressed FHOD3L. FHOD3L overexpression did not clearly impact the rhythmic contractions or the area of contraction, though variance increased (Figure 5—figure supplement 2D and E), consistent with the idea that, at high enough levels, FHOD3L activity can be detrimental in NRVMs.

Loss of nucleation, but not elongation, is tolerated for sarcomere formation and cardiac function

Once we established baseline levels of sarcomere structure and contractility in NRVMs with the wild-type FHOD3L rescue, we asked which actin organizing activities of FHOD3L are important for its cellular function. To this end, we performed rescue experiments with the nucleation-hindering mutant (K1193L) and the elongation-hindering mutant (GS-FH1). Expression of the K1193L mutant resulted in expression levels similar to wild-type (Figure 6—figure supplement 1A and B). Little to no correlation between FHOD3 expression level and sarcomere metrics was observed (R2 ranges from 0.003 to 0.2; Figure 6—figure supplement 1D). Overall, cells expressing FHOD3L K1193L were almost indistinguishable from those expressing FHOD3L. FHOD3L K1193L localization was striated (Figure 6A), and the number of sarcomeres per NRVM was rescued to wild-type levels (15 ± 16) (Figure 6B). Sarcomere lengths and widths were indistinguishable from wild-type (Figure 6C and D). The only statistically significant difference was thin filament length, which was ~7% longer in the K1193L-rescued NRVMs (792 ±79 nm) compared to those in FHOD3L-rescued NRVMs (739 ± 81) (Figure 6A’ and E, Figure 6—figure supplement 2A). In agreement with the well-organized, near wild-type appearance of sarcomeres, contraction and relaxation velocities, as well as the proportion of rhythmically contracting NRVMs, were indistinguishable from the FHOD3L rescue (Figure 6F and G, Figure 6—figure supplement 2B and C, Figure 6—video 1). Thus, ~70% loss of nucleation, ~20-fold weaker barbed-end capping, and loss of over 50% of bundling activity had no deleterious impact on FHOD3L’s ability to function in NRVMs.

Figure 6. Loss of nucleation, but not elongation, is tolerated for sarcomere formation and function.

(A) Images of neonatal rat ventricular myocytes (NRVMs) rescued with K1193L or GS-FH1. Sarcomere integrity indicated by immunofluorescent staining of α-actinin (green). Localization of exogenous HA-FHOD3L is shown in magenta. DAPI (blue) is included in the merged images. Wheat germ agglutinin (WGA) is not shown for clarity. (B) Quantification of sarcomere number per NRVM in the FHOD3L, K1193L, and GS-FH1 rescues (n=148 cells, K1193L; n=259 cells GS-FH1; 3 biological replicates; mean ± SD, p-values by Mann-Whitney U test). (C) Average sarcomere lengths per NRVM in the FHOD3L, K1193L, and GS-FH1 rescues (n=95 cells, K1193L; n=73 cells, GS-FH1; 3 biological replicates; mean ± SD, p-value for FHOD3L comparison to GS-FH1 by Student’s two-sample, unpaired t-test, all other p-values by Mann-Whitney U test). (D) Average sarcomere widths (Z-line lengths) per NRVM in the FHOD3L, K1193L, and GS-FH1 rescues (n=95 cells, K1193L; n=73 cells, GS-FH1; 3 biological replicates; mean ± SD, p-values by Mann-Whitney U test). (E) Quantification of thin filament lengths for FHOD3L and K1193L-rescued NRVMs (n=99 cells, K1193L; 3 biological replicates, each; mean ± SD, p-value by Mann-Whitney U test). (F) Quantification of contracting NRVMs, as in Figure 5D, for FHOD3L, K1193L, and GS-FH1-rescued NRVMs (n=3, each; mean ± SD). (G) Quantification of rhythmic contractions, as in Figure 5E, for FHOD3L, K1193L, and GS-FH1-rescued NRVMs (n=3, FHOD3L and K1193L; n=2, GS-FH1; mean ± SD). **p<0.001.

Figure 6.

Figure 6—figure supplement 1. FHOD3L expression level does not predict sarcomere metrics.

Figure 6—figure supplement 1.

(A) Normalized and background-corrected 3xHA-FHOD3L fluorescence intensity per neonatal rat ventricular myocyte (NRVM) area from the FHOD3L, K1193L, and GS-FH1 rescues (n=897 cells, K1193L, n=536 cells, GS-FH1; 3 biological replicates, each; mean ± SD). (B) Fluorescence distributions of the cells randomly selected for further analysis. (C–E) Analysis of correlation between HA intensity per cell and sarcomere number, length, and width for indicated rescue constructs.
Figure 6—figure supplement 2. Potential pre-myofibrils in FHOD3L GS-FH1 rescue cells.

Figure 6—figure supplement 2.

(A) Epifluorescent micrographs showing K1193L-rescued neonatal rat ventricular myocytes (NRVMs) stained with phalloidin (green) to visualize thin filaments and anti-HA (magenta) to show expression of exogenous FHOD3L. (A’) 3× zoom of indicated region in phalloidin image. (B) Phalloidin staining (green) reveals that cardiomyocytes expressing GS-FH1 have actin puncta that may be aligned. Stress fibers from a fibroblast are visible in the upper right-hand corner of the image. HA-FHOD3L (magenta) shows diffuse GS-FH1 protein. (B’) 3× zoom of indicated region in phalloidin image. (C) Striated HA-FHOD3L demonstrates that the GS-FH1 mutant can localize correctly if sarcomeres are present. Sarcomere integrity indicated by immunofluorescent staining of α-actinin (green). Localization of exogenous HA-FHOD3L is shown in magenta. DAPI (blue) is included in the merged images. Wheat germ agglutinin (WGA) is not shown for clarity. (D) Maximal relaxation velocities for FHOD3L, K1193L, and GS-FH1-rescued NRVMs (n=81 regions of interest [ROIs], K1193L; n=31 ROIs, GS-FH1; 3 biological replicates, wild-type [WT] and K1193L; 2 for GS-FH1; mean ± SD, p-values from Mann-Whitney U test). (E) Estimate of the percentage of NRVMs contracting in each video for FHOD3L, K1193L, and GS-FH1-rescued NRVMs (n=81 ROIs, K1193L; n=31 ROIs, GS-FH1; 3 biological replicates, WT and K1193L; 2 for GS-FH1; mean ± SD; p-values determined with Mann-Whitney U-test). **p<0.001.
Figure 6—figure supplement 3. Expression levels of GS-FH1 do not predict phenotype.

Figure 6—figure supplement 3.

(A) HA intensity distributions from full complement of FHOD3L (wild-type [WT]) rescue experiments compared to those with HA intensity <720 a.u./μm2, those from the first biological replicate only, and with the GS-FH1 rescue dataset. (B) Comparison of sarcomere metrics for the four indicated distributions. aStatistically different from FHOD3L rescue. (C-E) Analysis of correlation between HA intensity per cell and sarcomere number, length, and width for the three indicated low-intensity populations.
Figure 6—video 1. Expression of FHOD3L function separating mutants in neonatal rat ventricular myocytes (NRVMs).
Download video file (14MB, mp4)
This video shows digital image correlation (DIC) analysis of NRVMs from rescue conditions as in Figure 6.

In contrast, the elongation-deficient mutant (GS-FH1) did not rescue FHOD3L loss in NRVMs. Based on total fluorescence per cell, we determined that GS-FH1 levels were lower than observed for wild-type or K1193L, despite infecting a similar proportion of NRVMs (Figure 6—figure supplement 1A). In most cells, the FHOD3L GS-FH1 localization was diffuse (Figure 6A, Figure 6—figure supplement 2B). In a few cells that probably escaped from RNAi knockdown, we observed striated doublets of FHOD3L GS-FH1 between Z-lines, demonstrating that the protein can fold and localize correctly if sarcomeres are intact (Figure 6—figure supplement 2C). The turnover rate of GS-FH1 may be higher than wild-type intrinsically or because there were few binding sites available, i.e., fewer sarcomeres to which GS-FH1 could bind. Phalloidin staining revealed actin puncta in most cells expressing GS-FH1 (Figure 6A’, Figure 6—figure supplement 2C). The puncta were smaller than expected for mature sarcomeres but were aligned in some cases, suggesting the possible formation of premyofibrils.

Importantly, GS-FH1 levels detected and analyzed were within the acceptable intensity range we established for FHOD3L (Figure 6—figure supplement 1A and B). As was true for the other rescues, there was no correlation between GS-FH1 expression levels and measured sarcomere metrics (R2 ranges from 0.002 to 0.07; Figure 6—figure supplement 1E). To further test for any impact due to low protein levels, we identified two subpopulations of FHOD3L rescue cells with HA intensity distributions similar to that of the GS-FH1 cells: the first biological replicate and all cells with HA intensity levels less than 720 a.u./µm2 (Figure 6—figure supplement 3A). We found no significant correlations between HA intensity levels and sarcomere metrics (Figure 6—figure supplement 3C–E). Furthermore, we found no difference in sarcomere numbers or Z-line lengths for these subgroups compared to the whole collection of FHOD3L cells (Figure 6—figure supplement 3B). There was a statistically significant, albeit small (~6%), decrease in the sarcomere lengths of cells in replicate 1, but sarcomere lengths in the HA<720 group were indistinguishable from the full FHOD3L dataset. Based on these findings, we conclude that the expression levels in the GS-FH1-rescued NRVMs are high enough to rescue the FHOD3 knockdown, in principle, supporting our conclusion that the defect is due to loss of elongation activity.

The sarcomere number per GS-FH1 rescue cell was only 2 ± 4, similar to the mock rescue (Figure 6A and B). Within the sarcomeres detected, sarcomere lengths and widths were both reduced (Figure 6C and D). We were not able to measure thin filament lengths with confidence, due to the lack of sarcomere organization. Not surprisingly, contractility was nearly abolished after rescuing with GS-FH1. Contraction and relaxation velocities were decreased, and contractions were largely arrhythmic (Figure 6F and G, Figure 6—figure supplement 2D and E, Figure 6—video 1). We note that barbed-end capping and bundling activities were weaker than wild-type in the GS-FH1 mutant, but they were equivalent to or greater than the activities found for the K1193L mutant, which rescued well (Figure 3B and D). Therefore, we conclude that the elongation activity of FHOD3L is the primary activity required for sarcomere formation, whereas reduced nucleation, barbed-end binding, and bundling activities are well tolerated.

Discussion

FHOD3L elongation is necessary for sarcomeres in NRVMs

Published rates of nucleation and elongation by formins both vary by at least an order of magnitude. It is generally thought that the specific actin assembly properties of a given formin are set for its function, i.e., the structure this formin will build. To directly test this idea, Homa et al. replaced Cdc12p, the formin critical to S. pombe cytokinesis, with several chimeras of differing nucleation strength (Homa et al., 2021). Indeed, they found a strong positive correlation between formins with nucleation strength similar to Cdc12p and their ability to drive cytokinesis. In a computational model that recapitulates yeast cable structure, it was found that nucleation and/or elongation could be tuned to build the cables (McInally et al., 2021). Thus, how formins are used is likely to differ from case to case.

We determined that FHOD3L can nucleate in vitro, albeit weakly compared to many formins. Unlike in cytokinesis, we found that this activity is not necessary for its function in NRVMs. The necessity of actin assembly, nucleation, and/or elongation, by Fhod-family formins, has been questioned but supported by the failure of the IA mutation to rescue in multiple species (Kan et al., 2012a; Kimmich et al., 2024; Kutscheidt et al., 2014; Shwartz et al., 2016; Taniguchi et al., 2009). However, the IA mutation is thought to diminish both nucleation and elongation. To assess the importance of nucleation more specifically, we tested a mutant variant that substantially reduces the nucleation activity without altering elongation (FHOD3L K1193L). This mutant had almost no impact on sarcomere formation or function in NRVMs. The only statistically significant difference we detected was in thin filament length (Figure 6E). A host of proteins is critical to establishing and maintaining thin filaments at a precise length (Szikora et al., 2022). No other studies have implicated FHOD3L in this process to date. Thus, we believe that the length difference is more likely to reflect the state of maturity of the cells (time post-infection) and/or the number of sarcomeres per cell. While we only have three data points at this time, sarcomere number and thin filament length were highly correlated (inversely) in our experiments, with an R2 of 0.90.

By rescuing NRVMs with FHOD3L K1193L, we also tested a formin that caps barbed ends with a Kd that is ~15 times higher than wild-type (i.e. ~15× weaker) and bundles filaments ~50% less potently than wild-type. The fact that the cardiomyocytes were indistinguishable from wild-type when expressing this mutant suggests that neither of these activities is required, and, certainly, they are not needed at wild-type levels. Assuming that FHOD3L activities are tuned to meet its in vivo functions, these magnitudes of change in activity would be expected to result in measurable phenotypes in function and/or morphology of the cell.

The fact that K1193L has no impact on the elongation properties of FHOD3L in vitro and still rescues sarcomeres leads to an indirect conclusion that elongation is the actin assembly activity that is important in NRVMs. Of course, the failure to rescue by FHOD3L GS-FH1, an elongation incompetent mutant, strongly supports this conclusion (Figure 6). The elongation properties of FHOD3L are unusual. Its elongation rate is among the highest known, including mDia1 and Cappuccino (Bor et al., 2012; Kovar et al., 2006). However, processivity is very brief, resulting in filaments of only ~1 μm. We previously found that the Drosophila splice variant FhodA has a similarly short characteristic run length (Patel et al., 2018). In principle, this characteristic run length is sufficient to build sarcomeric thin filaments, which are about 1 μm long in NRVMs. Notably, a splice variant of Drosophila Fhod that only differs by having a shorter tail, FhodB, typically elongates for ~20 μm, and the tails of mammalian and Drosophila formins are highly conserved (Bremer et al., 2024). These observations lead us to question whether the processivity of Fhod-family formins is somehow regulated in vivo such that it can build short filaments when needed and longer filaments in other contexts. Interestingly, a computational model describing Bni1-built actin cables demonstrates that tuning the length of individual filaments (set by elongation rate and processivity) to cell size is sufficient to account for cable differences in cells of different sizes (McInally et al., 2024).

The FH1 domain strongly influences the elongation rate in vitro. In NRVMs, we found that the replacement of the FH1 domain with a flexible linker (FHOD3L GS-FH1) resulted in a severe phenotype. These cells had very few sarcomeres. FHOD3L GS-FH1 was indistinguishable from mock rescue in sarcomere number, structure (shorter and narrower), and function (contraction and relaxation velocities are not different). The result could be because the expression level of FHOD3L GS-FH1 was lower, on average, than those for the other constructs. We argue against this based on multiple observations: First, similar expression levels of wild-type FHOD3L are sufficient to fully rescue the knockdown (Figure 6—figure supplement 3). Second, despite similar metrics in sarcomere structure and function, the rhythmicity of contraction was markedly diminished compared to the mock rescue (Figure 6G). Third, we do not believe that the low protein levels reflect protein instability. We detect FHOD3L GS-FH1 bound to residual sarcomeres, suggesting that it folds and is stable when binding sites within sarcomeres are available (Figure 6—figure supplement 2C). It is possible that the striated appearance of FHOD3L GS-FH1 in cells with sarcomeres is the result of protein stabilization through heterodimerization with residual endogenous FHOD3L. However, we favor a model in which low FHOD3L GS-FH1 levels reflect increased protein turnover due to the absence of sarcomeres.

Recent work in Caenorhabditis elegans is consistent with our findings. Kimmich et al. removed the endogenous coding region of the FH1 domain in worm Fhod-1 (the only worm Fhod gene) (Kimmich et al., 2024). Body wall muscle is severely impacted by this deletion. In addition, they found that profilin is required for Fhod-1 function. Together, these data strongly argue that elongation activity is important. Interestingly, the muscle phenotype is more severe in a strain predicted to delete part of the FH2 domain and the downstream sequence, but not the FH1 domain, fhod-1(tm2363) (Kimmich et al., 2024; Mi-Mi et al., 2012). Thus, nucleation activity may also be necessary in this animal. Ultimately, complete removal of any domain, as we do here with the GS-FH1 mutant, may be too blunt of an approach. We expect experiments with modified elongation (e.g. slower or more processive) to provide further insight.

Why does FHOD3L elongate in NRVMs?

Given these new data, what could FHOD3L be doing in the cell? In multiple species, premyofibrils are built, but they fail to mature into wild-type myofibrils in the absence of FHOD (Kan et al., 2012a; Kimmich et al., 2024; Shwartz et al., 2016). It follows that FHOD3 is not required to build the earliest thin filaments in the sarcomere. Instead, FHOD3 could contribute new thin filaments to expanding, maturing sarcomeres. If this were the case, we might expect nucleation to be more important than our data indicate. Instead, FHOD3L could be responsible for elongating filaments that are nucleated by a different protein. For example, FHOD3L and DAAM could collaborate, or they could contribute to the apparent redundancy and robustness built into sarcomerogenesis (Szikora et al., 2022). DAAM knockout mice have overlapping cardiac phenotypes with those of the FHOD3 knockout (Kan et al., 2012a; Li et al., 2011). Furthermore, a lack of sarcomere thickening and loss of sarcomere organization are common phenotypes in Drosophila knockdowns of Daam1 and Fhod (Molnár et al., 2014; Shwartz et al., 2016). While FHOD3L and DAAM cannot compensate for the loss of one or the other, they might help when one is compromised.

Alternatively, FHOD3L could be reinforcing the Z-line structure to facilitate sarcomere thickening. This idea is consistent with the narrow myofibrils and Z-body disorder observed in worms lacking functional Fhod-1 (Kimmich et al., 2024; Mi-Mi et al., 2012). If capping and bundling were important to the Z-line integrity, one would expect to find FHOD3L localized in the Z-line. However, FHOD localization varies between species and with development, suggesting that this role is not conserved, if it exists. In mouse heart tissue, FHOD3L appears to bind directly to MyBP-C, which localizes between the Z- and M-lines (Matsuyama et al., 2018), suggesting that it is not actively stabilizing the Z-line. Thus, transient actin assembly may be sufficient, consistent with our findings that capping and bundling are not essential in NRVMs.

Materials and methods

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Escherichia coli) BL21(DE3) Novagen/Sigma-Aldrich 69,450-M
RRID:Ecoli_0001
Cell line (Homo sapiens) HEK293T Dr. Kohnosuke Mitani, UCLA CRL-3216
Transfected construct and biological sample (human) pAdenoX-CMV-3xHA-FHOD3L-CMV-DsRed (plasmid and adenovirus) Takara Bio; this paper Cat. No. 632262 Adenoviral construct to
transfect and purify the adenovirus to express FHOD3L wild-type in NRVMs.
Biological sample (human) pAV-CMV-{3xHA-FHOD3L GS-FH1}:SV40 pA-CMV-mCherry (adenovirus) VectorBuilder Cat#AVS(VB230718-1114xtg) Adenovirus to
transfect and express FHOD3L GS-FH1 in NRVMs.
Biological sample (human) pAV-CMV-{3xHA-FHOD3L K1193L}:SV40 pA-CMV-mCherry (adenovirus) VectorBuilder Cat#AVS(VB230528-1145fkg) Adenovirus to
transfect and express FHOD3L K1193L in NRVMs.
Sequence-based reagent siRNA against rat FHOD3 QIAGEN Rn_LOC100360334_2 Flexitube siRNA
Sequence-based reagent AllStars Negative Control siRNA QIAGEN Cat. No. 1027281
Sequence-based reagent GAPDH_F This paper qPCR primers CCGCATCTTCTTGTGCAGTG
Sequence-based reagent GAPDH_R This paper qPCR primers CGATACGGCCAAATCCGTTC
Sequence-based reagent FHOD3_F This paper qPCR primers CAGCCAATCACGGAG
Sequence-based reagent FHOD3_R This paper qPCR primers TGCTGTCCTTGCCCTGA
Biological sample (Rattus norvegicus) Primary neonatal rat ventricular myocytes UCLA Cardiovascular Research Theme Core Freshly isolated from male and female Sprague-Dawley rats
Antibody anti-α-actinin (Mouse monoclonal) Sigma Cat. No. A7811, RRID:AB_476766 IF (1:250)
Antibody anti-HA (Rabbit monoclonal) Cell Signaling Technology Cat. No. 3724S,
RRID:AB_1549585
IF (1:500)
WB (1:1000)
Antibody anti-GAPDH (Mouse monoclonal) Santa Cruz Biotechnology Cat. No. sc-365062, RRID:AB_10847862 WB (1:1000)
Antibody anti-FHOD3 (Rabbit polyclonal) Abcam Cat. No. ab224463 WB (1:1000)
Antibody goat anti-rabbit IgG 800CW LiCor Biosciences Cat. No. 926–32211,
RRID:AB_621843
WB (1:10,000)
Antibody goat anti-mouse IgG 680RD LiCor Biosciences Cat. No. 926–68070,
RRID:AB_10956588
WB (1:10,000)
Antibody Alexa Fluor 488 goat anti-mouse Thermo Fisher Cat. No. A-11001,
RRID:AB_2534069
IF (1:500)
Antibody Alexa Fluor 647 goat anti-rabbit Thermo Fisher Cat. No. A-21244,
RRID:AB_2535812
IF (1:500)
Recombinant DNA reagent pGEX-6P-2-FHOD3LCT (plasmid) This paper Original template, EGFP-FHOD3L, gifted by Thomas Iskratsch (Iskratsch et al., 2010)
Chemical compound, drug Vectashield Plus Antifade mounting media Vector Laboratories Cat. No. H-1900–10
Chemical compound, drug Prolong Glass Antifade mountant Thermo Fisher Cat. No. P36980
Chemical compound, drug Alexa Fluor 488 Phalloidin Thermo Fisher Cat. No. A12379
Chemical compound, drug Wheat Germ Agglutinin (WGA) TMR Thermo Fisher Cat. No. W849
Chemical compound, drug Paraformaldehyde Fisher Scientific Cat. No. AC416780010
Software, algorithm Fiji NIH;
Schindelin et al., 2012
Software, algorithm MotionGUI MATLAB; denoviral infection, driving expression of rescue constructs,
Huebsch et al., 2015
Software, algorithm CellPose Stringer et al., 2021
Other DAPI stain Fisher Scientific Cat. No. EN62248 (1 μg/ml)

Protein expression, purification, and labeling

FHOD3L-CT (residues 963–1622) was cloned into pGEX-6P-2 with an N-terminal glutathione-S-transferase (GST) tag. The original template, EGFP-Fhod3L, was generously provided by T Iskratsch (Queen Mary University of London) (Iskratsch et al., 2010). Point mutations were generated by site-directed mutagenesis. Truncations were constructed using FastCloning (Liu and Naismith, 2008). pGEX-FHOD3L-CT GS-FH1, in which the polyproline tracts were replaced with GS linkers, was cloned via Gibson Assembly introducing a gBlock into pGEX-FHOD3L-CT (replacing the FH1 region).

The FHOD3L-CT wild-type and mutant constructs were transformed in Rosetta 2 (E. coli DE3) cells (Novagen), which were grown in 1 l of Terrific Broth supplemented with 100 mg/l ampicillin and 32 mg/l chloramphenicol. Expression was induced at an OD of 0.6–0.8 by adding 0.5 mM isopropyl β-D-1-thiogalacto-pyranoside (IPTG) and shaking overnight at 18°C, 210 rpm. The cells were harvested by centrifugation, washed in PBS, and flash-frozen in liquid nitrogen.

Cell pellets expressing GST-FHOD3L-CT wild-type and mutants were resuspended in 20 mM HEPES pH 7.5, 150 mM NaCl, 1 mM PMSF, 1 mM DTT, 2 μg/ml DNaseI. All subsequent steps were performed on ice or at 4°C. The cells were lysed with a microfluidizer, cleared by centrifugation at 20,000 × g for 20 min, and then purified using a 5 ml HitrapSP-FF cation exchange column (GE Life Sciences) with a gradient of 0.2–0.6 M NaCl over 1 column volume after a 1 column volume wash with 0.2 M NaCl. Peak fractions were dialyzed overnight into 20 mM HEPES pH 8, 200 mM NaCl, 1 mM DTT, and Prescission Protease was added to cleave off the GST-tag. This sample was centrifuged at 4°C for 48,000 rpm for 20 min and further purified on a MonoS cation exchange column (GE Life Sciences) with a gradient of 0.2–0.95 M NaCl over 40 column volumes after a 1 column volume wash with 0.2 M NaCl. Peak fractions were exchanged into storage buffer (10 mM Tris pH 8, 150 mM NaCl, 20% glycerol, 1 mM DTT), then flash-frozen in liquid nitrogen and stored at –80°C.

Cell pellets expressing GST-FHOD3S-CT were purified and stored similarly to GST-FHOD3L-CT wild-type, except 150 mM NaCl was used throughout the purification with a gradient of 0.15–0.95 M NaCl over 40 column volumes after a 1 column volume wash with 0.15 M NaCl on the MonoS cation exchange column (GE Life Sciences).

Concentrations of C-terminal FHOD3 constructs were determined by running a series of serial dilutions on a Sypro Red-stained quantitative gel using densitometry (ImageJ) with rabbit skeletal actin as the standard. All FHOD3L-CT concentrations are reported as dimer concentrations.

Human profilin-1 and S. pombe profilin were expressed and purified as described for Drosophila profilin (Chic) (Bor et al., 2012). Profilin-1 concentration was determined using the extinction coefficient of 14,992 M–1 cm–1. S. pombe profilin concentration was determined using 1.63 OD/mg/ml (Lu and Pollard, 2001).

We used RSA throughout the paper, based on FHOD3L’s role in skeletal and cardiac muscle. Skeletal muscle actin was isolated from rabbit back muscle acetone powder (Pel-Freez) according to the method described by Spudich and Watt, followed by gel purification (Spudich and Watt, 1971). Skeletal muscle actin was labeled with pyrene iodoacetamide (Thermo Scientific) or Alexa Fluor 488 NHS-ester (Thermo Scientific) as described (Sun et al., 2018).

Pyrene assays

Pyrene assays were performed essentially as described (Bor et al., 2012) on an Infinite 200 Pro plate reader (Tecan). FHOD3L-CT was diluted in buffer Z (2 mM Tris pH 8.0, 0.2 mM ATP, 0.1 mM CaCl2, 0.5 mM TCEP, 0.04% sodium azide) before addition to polymerization buffer (KMEH: 10 mM HEPES, pH 7, 1 mM EGTA, 50 mM KCl, 1 mM MgCl2). This mix was added to Mg2+-actin at a final concentration of 4 μM with 5% pyrene-labeled actin. For bulk assembly assays, nucleation strengths were calculated from the slope at t1/8. For seeded elongation assays, actin filaments were sheared by passing three times through a 24-gauge needle and then aliquoted into each well of a microplate. Proteins were added to the seeds and incubated for 2–4 min at room temperature. Seeds and additional proteins in KMEH were added to Mg2+-actin, at a final concentration of 0.5 μM actin with 10% pyrene-labeled actin, to initiate elongation. Elongation rates were determined by linear regression over the first 90 s and normalized against the rate of actin alone in each experiment. The affinity of FHOD3-CT for barbed ends was determined by fitting the data to the quadratic binding equation

r=a+b∗(([barbedends]+[FHOD3-CT]+Kd)−([barbedends]+[FHOD3-CT]+Kd)2−4∗[barbedends]∗[FHOD3-CT]),

where r is the normalized elongation rate, and a and b are offset and scaling constants, respectively.

Low-speed bundling assays

10 μM actin was polymerized for 1 hr at room temperature and diluted to 5 μM with varying amounts of FHOD3-CT constructs in KMEH. Samples were incubated for 30 min at room temperature and then spun for 20 min, 14,000 × g to separate the pellet and supernatant. The supernatant samples were carefully transferred to new tubes, and the pellet samples were resuspended in an equal volume of 1× sample loading buffer for quantitative comparison. Samples were boiled in 1× sample loading buffer for 10 min and run on 10% SDS-PAGE gels. The percentage of actin pelleted was determined via densitometry with Fiji (Schindelin et al., 2012).

TIRF microscopy

TIRF microscopy was utilized to measure the elongation rates and run lengths of the FHOD3-CT constructs. Coverslips were rinsed three times in MilliQ water, placed in 2% Hellmanex (Hellma Analytics) at 60–65°C for 2 hr, rinsed another five times in MilliQ water, and allowed to dry.

Parallel flow chambers of ~15 μl were assembled on the slide using strips of double-sided tape. Flow chambers were prepared with the following steps: (1) 20 μl of high-salt buffer (50 mM Tris pH 7.5, 600 mM NaCl) for 2 min; (2) 12.5 μl of 60 nM NEM-myosin (stock in 10 mM HEPES pH 7, 0.5 M KCl, 10 mM EDTA pH 7.0, 1 mM DTT, 50% glycerol, diluted in high-salt buffer); (3) 20 μl of high-salt BSA-containing buffer (1% BSA, 50 mM Tris pH 7.5, 600 mM NaCl); (4) 20 μl of low-salt BSA-containing buffer (1% BSA, 50 mM Tris pH 7.5, 150 mM NaCl); (5) 50 μl of magnesium-actin and additional proteins to be assayed for a final concentration of 1 μM actin (10% Alexa Fluor 488-labeled) and 5 μM human profilin-1 in 1× TIRF buffer (KMEH, 0.2 mM ATP, 50 mM DTT, 20 mM glucose, 0.5% methylcellulose [4000 cP]) supplemented with 250 μg/ml glucose oxidase and 50 μg/ml catalase.

The videos and images were acquired using a Zeiss Axio Observer 7 Basic Marianas Microscope with Definite Focus 2 equipped with a 3i Vector TIRF System, an Alpha Plan-Apochromat ×63 (1.46 NA) Oil TIRF Objective, and an Andor iXon3 897 512×512 10 MHz EMCCD Camera, using Slidebook 6 software. Experiments were performed at room temperature. Images were captured at 2.5 s intervals for 10 min. Filament lengths were quantified with the JFilament plug-in in Fiji (Schindelin et al., 2012; Smith et al., 2010). Bright and dim filaments were distinguished manually. Due to the transient nature of the dim portions of filaments generated by FHOD3L constructs, pauses for actin elongation were first visually identified as portions of roughly 0 slope deviating away from the best fit line off the subunits added vs. time plots of elongation. The corresponding times for the duration of the pauses were then more carefully examined. Events were defined as lasting at least 5 s, with slopes within –10 and 5. These pauses almost always preceded a burst of elongation by either FHOD3S/L-CT WT or K1193. To estimate the elongation rate, the dim region growth was fit to a line. It was confirmed that the elongation rate reduced back to that of profilin-actin alone when the filament intensity increased. The R2 value of these bursts of elongation was all >0.5, but in most cases >0.8.

Adenoviral generation, purification, and infection

We used HEK 293 cells solely for the production of adenoviral vectors. The HEK 293 cell line was obtained from the lab of Dr. Kohnosuke Mitani at UCLA. Dr. Mitani’s lab was one of the pioneering groups in the development of adenoviral vectors for gene therapy and maintained high standards of quality control for cell culture and maintenance. Because the success of adenoviral vector production heavily depends on the quality of HEK 293 cells, we relied on the robustness of the original cell source. Although we have not performed formal authentication of the cell line since the acquisition, we have strictly followed the protocols established by Dr. Mitani’s lab. This includes using cells with low passage numbers and closely monitoring cell morphology and functionality. The cells are cryopreserved in liquid nitrogen and maintained under controlled conditions.

Adenoviruses containing a full-length FHOD3L wild-type construct were generated by transiently transfecting HEK293 cells using the CalPhos Mammalian Transfection Kit (Catalog No. 631312, Takara Bio) with pAdenoX-CMV-3xHA-FHOD3L-CMV-DsRed after digesting with PacI (NEB) in Cutsmart buffer (NEB) for 1 hr at 37°C. HEK293 cells were cultured in 1X DMEM (Thermo Fisher, Catalog No. 11965092), 10% FBS (Thermo Fisher, Catalog No. 10082147), and 1% penicillin/streptomycin/amphotericin B (Thermo Fisher, Catalog No. 15240096). Cells were lysed 7–10 days later when noticeable cytopathic effect was present and centrifuged at 1.5k × g for 5 min at room temperature.

Additional crude adenovirus encoding full-length FHOD3L was harvested after infecting multiple 6 cm dishes of HEK293. Dilutions and subsequent infections were performed in PBS with magnesium chloride and calcium chloride (PBS+/+) (Thermo Fisher, Catalog No. 14040117) for 1 hr at room temperature, rotating the plate every 10–15 min. Plaque formation assays were then performed as in Baer and Kehn-Hall, 2014. Individual viral plaques were collected with a P1000 tip to isolate adenoviral clones of full-length FHOD3L. Clone variability was assessed by infecting HEK293 for each adenoviral clone and observing subsequent DsRed expression over time. Optimal adenoviral clones were selected for large-scale purification. Five 15 cm dishes of HEK293 were infected, then collected 2–3 days later for purification with the Adeno-X Maxi Purification Kit (Takara Bio, Catalog No. 631533).

Crude adenoviruses containing pAV-CMV-{3xHA-FHOD3L GS-FH1}:SV40 pA-CMV-mCherry and pAV-CMV-{3xHA-FHOD3L K1193L}:SV40 pA-CMV-mCherry were commercially generated and purchased from VectorBuilder. The amount of crude adenovirus was estimated by infecting serially diluted amounts of crude adenovirus in a six-well plate of HEK293 and then used to infect five 15 cm dishes of HEK293 for 1 hr at room temperature and collected 2–3 days later for purification with the Adeno-X Maxi Purification Kit (Takara Bio, Catalog No. 631533).

Particle titers of purified viruses were quantified by making three separate dilutions of each virus in 0.1% SDS (Thermo Fisher) and vortexing for 5 min, spinning down 13,000× rpm, 5 min, and then taking the average of the absorbance readings on the Nanophotometer N50-GO (Implen) to quantify particles/ml as per Maizel et al., 1968.

NRVM seeding, siRNA knockdown, and rescue

NRVMs were isolated from postnatal P1- to P3-day-old Sprague-Dawley rat pups of mixed gender by UCLA Cardiovascular Research Theme Core services. The ethical approval for use was obtained from the Animal Research Committee (ARC) for protocol 2008-126. Eight-well chamber slides (Corning, Catalog No. 354118) were prepared by coating with 10 mg/ml fibronectin (Sigma, Catalog No. F1141) and 20 mg/ml poly-D-lysine hydrobromide (Sigma, Catalog No. P6407) in PBS overnight at 4°C. NRVMs were seeded at 175,000 NRVMs/well in a mixture of 75% DMEM (Thermo Fisher, Catalog No. 11965092), 15% Medium-199 (Thermo Fisher, Catalog No. 11150059) supplemented with 2 mM L-glutamine (Thermo Fisher, Catalog No. A2916801) and 10 mM HEPES (Thermo Fisher, Catalog No. 15630080). For reverse transfection, the cells were treated with siRNA targeting FHOD3 (QIAGEN, Rn_LOC100360334_2 Flexitube siRNA) or AllStars Negative Control siRNA (QIAGEN, 20 nmol), Lipofectamine RNAiMAX transfection reagent (Thermo Fisher, Catalog No. 13778075) and Opti-MEM I Reduced Serum Medium (Thermo Fisher, Catalog No. 31985062) to dilute the siRNA. Media was changed 24 hr later to one containing penicillin/streptomycin (Thermo Fisher, Catalog No. 15140122). NRVMs were infected with an optimal amount of adenovirus (determined experimentally to be particle titer MOI 350 to minimize excessive damage to NRVMs while maintaining sufficient expression) as above 48 hr after seeding, and media containing penicillin/streptomycin was added on top of the PBS+/+ at the end of the infection. Media was changed 24 hr later, and cells were examined 48 hr after infection.

Gene expression analysis by quantitative reverse-transcriptase PCR

RNA was extracted from the NRVMs 4 days after reverse transfection of siRNA using the Direct-zol RNA mini prep kit (Zymo Research, Catalog No. R2050). RNA was reverse-transcribed into complementary DNA using the qScript cDNA synthesis kit (Quanta Biosciences, Catalog No. 95047-025). Quantitative reverse-transcriptase PCR was performed using PowerUp SYBR green master mix for qPCR (Applied Biosystems, Catalog No. A25742) on a Lightcycler 480 (Roche). Each qPCR was repeated three times. Forward and reverse primer sequences are as follows: GAPDH forward, CCGCATCTTCTTGTGCAGTG; GAPDH reverse, CGATACGGCCAAATCCGTTC; FHOD3 forward, CAGCCAATCACGGAG; FHOD3 reverse, TGCTGTCCTTGCCCTGA.

Western blots

NRVMs were lysed in 100 mM Tris pH 8, 150 mM NaCl, 0.5% Triton-X from eight-well chamber slides (Corning, Catalog No. 354118) after rescue experiments, and samples were vortexed for 1 min before centrifuging at 15,000 rpm, 4°C, for 10 min. The resulting supernatant was boiled in sample loading buffer at 100°C for 10 min and run on an SDS-PAGE gel. The gel was transferred to an Immobilon-FL polyvinylidene fluoride membrane (Millipore, IPFL00010) at 100 V for 90 min on ice. The membrane was blocked in 4% nonfat milk in low-salt TBST (20 mM Tris pH 7.6, 150 mM NaCl, 0.05% Tween-20, 0.01% sodium azide) for 30 min at room temperature. It was incubated, rotating at 4°C overnight, with Fhod3 polyclonal rabbit (Abcam, ab224463) or HA monoclonal rabbit (Cell Signaling Technologies, 3724S) and GAPDH monoclonal mouse (Santa Cruz Biotechnology, sc-365062) diluted 1:1000 in low-salt TBST. Membranes were washed three times for 5 min each the next day in high-salt TBST (20 mM Tris pH 7.6, 500 mM NaCl, 0.05% Tween-20, 0.01% sodium azide) and then incubated for 1 hr at room temperature, shaking, with 800CW goat anti-rabbit IgG secondary antibody (Li-Cor Biosciences, 926-32211) and 680RD goat anti-mouse IgG secondary antibody (Li-Cor Biosciences, 926-68070) diluted 1:10,000 in high-salt TBST. Membranes were washed three times for 10 min, each in high-salt TBST and then imaged on a Li-Cor Odyssey 9120 Infrared Imager (Li-Cor Biosciences).

In vitro contractility assay

Contractility assessments were performed by utilizing a video-based technique with the UCSF Gladstone-developed MATLAB program MotionGUI (Huebsch et al., 2015). Videos for contractility analysis were acquired using MicroManager software on a Leica SD AF Spinning Disc system using an HC PL Fluotar 10× (0.3 NA) dry objective lens with an ORCA-Flash4.0 LT C11440 camera (Hamamatsu) at 30 fps with live NRVMs incubated at 37°C, 5% CO2 (Tokai Hit). The videos were converted from ome.tif to a tiff stack with Fiji for analysis with MotionGUI. A pixel size of 0.538 μm was obtained from the metadata. Eight-pixel macroblocks were used for all assessments. All parameters of the MotionGUI program not specified here were set to their respective default values. Motion vectors were calculated, and the data were evaluated upon completion. All videos were subjected to the same post-processing procedures to ensure consistency during comparative analysis. Each video sample was post-processed using neighbor-based cleaning with the vector-based cleaning criterion within the program. The threshold for this post-processing method was set to two for all samples and was adequate for improving the signal-to-noise ratio enough to identify peaks clearly corresponding to beating events in most samples.

IF and image analysis

For sarcomere integrity analysis, NRVMs were stained before fixation with WGA TMR (Thermo Fisher, Catalog No. W849) for 10 min at 37°C with 5 μg/ml WGA, followed by two PBS washes. NRVMs were then fixed with 4% paraformaldehyde (Fisher Scientific, Catalog No. AC416780010) in PBS for 15 min at 37°C. Cells were washed three times in PBS for 5 min, each at room temperature. Cells were permeabilized and blocked with PBS/0.1% Triton-X/10% Goat Serum (Triton-X: Thermo Fisher, Catalog No. A16046.AP; Goat Serum: Sigma, Catalog No. S26-100ML) for 30 min at 37°C. Cells were incubated with primary antibodies overnight at 4°C. α-Actinin (mouse) primary antibody (Sigma, Catalog No. A7811) was diluted 1:250, and HA-tag (rabbit) primary antibody (Cell Signaling, Catalog No. 3724) was diluted 1:500 in PBS/0.1% Triton-X/5% Goat Serum. Cells were washed three times for 5 min, each with PBS/0.1% Triton-X/5% Goat Serum at room temperature. Incubation with secondary antibodies was for 1 hr at 37°C. Alexa Fluor 488 goat anti-mouse secondary (Thermo Fisher, Catalog No. A-11001) or Alexa Fluor 647 goat anti-rabbit secondary (Thermo Fisher, Catalog No. A-21244) was diluted 1:500 in PBS/0.1% Triton-X/5% Goat Serum. Cells were then washed twice in PBS/0.1% Triton-X/5% Goat Serum for 5 min each, followed by one PBS wash for 5 min before mounting in Vectashield Plus Antifade mounting media (Vector Laboratories, Catalog No. H-1900-10) with 1 μg/ml DAPI (Fisher Scientific, Catalog No. EN62248).

For thin filament determination, NRVMs were incubated with sterile-filtered Ringer’s relaxation buffer (6 mM potassium phosphate pH 7.0, 100 mM NaCl, 2 mM KCl, 0.1% glucose, 2 mM MgCl2, 1 mM EGTA) for 20 min, room temperature, followed by a brief PBS wash to start the WGA staining. Fixation and blocking were performed as above. Staining with HA-tag (rabbit) primary antibody and Alexa Fluor 647 goat anti-rabbit secondary antibody was performed as above. Cells were then washed twice in PBS/0.1% Triton-X/5% Goat Serum for 5 min each, and 200 nM Alexa Fluor 488 Phalloidin (Thermo Fisher, Catalog No. A12379) was added for 1 hr, room temperature in PBS/1% BSA. Cells were washed with PBS twice for 5 min before mounting in Prolong Glass Antifade Mountant (Thermo Fisher, Catalog No. P36980) with 1 μg/ml DAPI (Fisher Scientific, Catalog No. EN62248).

Twelve ×40 magnification images per biological replicate were acquired using a random coordinate generator (https://onlineintegertools.com/generate-integer-pairs), excluding the edges of the wells, for quantification of sarcomeres and thin filaments. Sample size with sufficient power was determined via a small-scale pilot study for sarcomere number, length, and width, as well as thin filaments between mock knockdown, mock rescue, and FHOD3L WT rescue, followed by inputting averages of the treatments on https://www.stat.ubc.ca/~rollin/stats/ssize/n1.html. Each well was treated as a 16×16 grid of ×40 magnification fields of view. 16-bit images were acquired on an AXIO Imager.D1 fluorescence phase contrast microscope (Zeiss) using an EC Plan-Neofluar 40x M27 (0.75 NA) objective lens with an AxioCam MRm camera (Zeiss). Images of NRVMs in figures were acquired with a Plan-Apochromat oil DIC M27 63× (1.4 NA) objective lens for visualization.

Images showing DsRed reporter fluorescence at the end of the rescue timeline for the NRVMs were taken on a CKX53 inverted phase contrast microscope (Olympus) using a UPLFLN 4× (0.2 NA) objective lens (Olympus) with an ORCA-spark digital CMOS camera (Hamamatsu).

Cells were segmented using CellPose (Stringer et al., 2021). Two-color images of the WGA membrane stain and nuclear stain were saved as jpeg files on Fiji. These images were then input to the CellPose environment for batch processing with a cell diameter of 210 pixels, 0.4 cell probability and flow thresholds, 0 stitch threshold, using the cyto2 model for segmentation. The text files of the outlines were saved and overlaid on the respective channels of the images individually using the provided Python file from CellPose as a macro through Fiji (imagej_roi_converter.py). CellPose segments with no nuclei or three or more nuclei, as well as cell segments on the edge of the image, were excluded from analysis.

Sarcomere analysis was performed manually in a single-blind manner (for mock knockdown, mock rescue, wild-type rescue, and the K1193L rescue) using blindrename.pl (https://github.com/davalencia0914/sarcApp_Cellpose_Merge, copy archived at Valencia, 2025) to generate the filenames and a key filename csv file for decoding after analysis. We attempted to blind all other rescue conditions, but they were too easily identified based on expression level and localization differences. Linescans were generated along myofibrils, perpendicular to the Z-lines, to make sarcomere length measurements from Z-line peak to Z-line peak. Z-line lengths were measured by visual inspection of the α-actinin channel and measured on Fiji with the line tool. Three or more consecutive Z-lines, at least 0.70 µm long in a row, were analyzed as sarcomeres.

Statistical analysis

To compare two or more groups for the rescue experiments in NRVMs, pair-wise comparisons were performed. In order to reduce the Type 1 error rate stemming from multiple comparisons, Bonferroni correction was applied to obtain a corrected alpha. Whether groups were normally distributed or not was determined by the Shapiro-Wilk test. To compare two normally distributed groups, Student’s two-sample, unpaired t-test was used. If either group was not normally distributed, the nonparametric Mann-Whitney U test was used. The same analysis was applied to analyze run lengths and capping duration from the TIRF seeded elongation assays.

For the nucleation assay, barbed-end binding assays, and TIRF elongation rate analysis, one-way ANOVAs were performed for three treatment comparisons with post hoc Tukey tests as the variances between all treatments tested were fairly equal.

In all cases when the sample size exceeded 20, we removed outliers from the bottom and upper 2.5% of data to perform all statistical tests, regardless of normality, to avoid introducing bias. However, all plots shown include these outliers.

Acknowledgements

We thank members of the Quinlan lab for experimental support and scientific feedback, the Reisler lab for valuable discussions, experimental support, and reagents, the Courtemanche lab for NEM-myosin, and T Iskratsch for the FHOD plasmids. We also thank Dr. Michael D Roth for access to his lab’s BSL II-equipped facilities, enabling the production of adenovirus. This work was supported by NIH grant R01 HL146159 to MEQ, and Ruth L Kirschstein National Research Service Award T32 GM007185 to DAV and T32 AR065972 to ANK. Confocal laser scanning microscopy was performed at the Advanced Light Microscopy/Spectroscopy Laboratory and Leica Microsystems Center of Excellence at the California NanoSystems Institute at UCLA (RRID:SCR_022789) with funding support from NIH Shared Instrumentation Grant S10OD025017 and NSF Major Research Instrumentation grant CHE-072251.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Atsushi Nakano, Email: anakano@ucla.edu.

Margot E Quinlan, Email: margot@chem.ucla.edu.

Alphee Michelot, Mechanobiology Institute, Singapore.

Jonathan A Cooper, Fred Hutchinson Cancer Research Center, United States.

Funding Information

This paper was supported by the following grants:

  • National Institutes of Health R01 HL146159 to Margot E Quinlan.

  • National Institutes of Health T32 GM007185 to Dylan A Valencia.

  • National Institutes of Health T32 AR065972 to Angela N Koeberlein.

Additional information

Competing interests

No competing interests declared.

Author contributions

Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review and editing.

Formal analysis, Investigation, Writing – review and editing.

Formal analysis, Supervision, Methodology, Project administration, Writing – review and editing.

Formal analysis, Writing – review and editing.

Conceptualization, Investigation.

Resources, Supervision, Methodology, Writing – review and editing.

Formal analysis.

Conceptualization, Funding acquisition, Methodology, Project administration, Writing – review and editing, Supervision.

Conceptualization, Data curation, Formal analysis, Funding acquisition, Methodology, Project administration, Writing – review and editing.

Ethics

The ethical approval of rat cardiomyocyte use was obtained from the Animal Research Committee (ARC) for protocol 2008-126.

Additional files

MDAR checklist

Data availability

All gels and western blots analysed during this study are included in the article and supporting files; source data files have been provided for Figures 1, 2, and 4. All code used can be found on GithHub (https://github.com/davalencia0914/sarcApp_Cellpose_Merge; copy archived at Valencia, 2025).

References

  1. Al Haj A, Mazur AJ, Radaszkiewicz K, Radaszkiewicz T, Makowiecka A, Stopschinski BE, Schönichen A, Geyer M, Mannherz HG. Distribution of formins in cardiac muscle: FHOD1 is a component of intercalated discs and costameres. European Journal of Cell Biology. 2015;94:101–113. doi: 10.1016/j.ejcb.2014.11.003. [DOI] [PubMed] [Google Scholar]
  2. Antoku S, Schwartz TU, Gundersen GG. FHODs: Nuclear tethered formins for nuclear mechanotransduction. Frontiers in Cell and Developmental Biology. 2023;11:1160219. doi: 10.3389/fcell.2023.1160219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arimura T, Takeya R, Ishikawa T, Yamano T, Matsuo A, Tatsumi T, Nomura T, Sumimoto H, Kimura A. Dilated Cardiomyopathy-Associated FHOD3 Variant Impairs the Ability to Induce Activation of Transcription Factor Serum Response Factor. 2013. [October 1, 2013]. https://www.jstage.jst.go.jp/article/circj/77/12/77_CJ-13-0255/_article [DOI] [PubMed]
  4. Baer A, Kehn-Hall K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. Journal of Visualized Experiments. 2014;52065:e52065. doi: 10.3791/52065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Baker JL, Courtemanche N, Parton DL, McCullagh M, Pollard TD, Voth GA. Electrostatic interactions between the Bni1p Formin FH2 domain and actin influence actin filament nucleation. Structure. 2015;23:68–79. doi: 10.1016/j.str.2014.10.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bechtold M, Schultz J, Bogdan S. FHOD proteins in actin dynamics--a formin’ class of its own. Small GTPases. 2014;5:11. doi: 10.4161/21541248.2014.973765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Blanchoin L, Boujemaa-Paterski R, Sykes C, Plastino J. Actin dynamics, architecture, and mechanics in cell motility. Physiological Reviews. 2014;94:235–263. doi: 10.1152/physrev.00018.2013. [DOI] [PubMed] [Google Scholar]
  8. Bor B, Vizcarra CL, Phillips ML, Quinlan ME. Autoinhibition of the formin cappuccino in the absence of canonical autoinhibitory domains. Molecular Biology of the Cell. 2012;23:3801–3813. doi: 10.1091/mbc.E12-04-0288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Boussaty EC, Ninoyu Y, Andrade L, Li Q, Takeya R, Sumimoto H, Ohyama T, Wahlin KJ, Manor U, Friedman RA. Altered Fhod3 Expression Involved in Progressive High-Frequency Hearing Loss via Dysregulation of Actin Polymerization Stoichiometry in The Cuticular Plate. bioRxiv. 2023 doi: 10.1101/2023.07.20.549974. [DOI] [PMC free article] [PubMed]
  10. Bremer KV, Wu C, Patel AA, He KL, Grunfeld AM, Chanfreau GF, Quinlan ME. Formin tails act as a switch, inhibiting or enhancing processive actin elongation. The Journal of Biological Chemistry. 2024;300:105557. doi: 10.1016/j.jbc.2023.105557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cao L, Kerleau M, Suzuki EL, Wioland H, Jouet S, Guichard B, Lenz M, Romet-Lemonne G, Jegou A. Modulation of formin processivity by profilin and mechanical tension. eLife. 2018;7:e34176. doi: 10.7554/eLife.34176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Courtemanche N. Mechanisms of formin-mediated actin assembly and dynamics. Biophysical Reviews. 2018;10:1553–1569. doi: 10.1007/s12551-018-0468-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Deng S, Silimon RL, Balakrishnan M, Bothe I, Juros D, Soffar DB, Baylies MK. The actin polymerization factor diaphanous and the actin severing protein flightless i collaborate to regulate sarcomere size. Developmental Biology. 2021;469:12–25. doi: 10.1016/j.ydbio.2020.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dominguez R, Holmes KC. Actin structure and function. Annual Review of Biophysics. 2011;40:169–186. doi: 10.1146/annurev-biophys-042910-155359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dwyer J, Pluess M, Iskratsch T, dos Remedios CG, Ehler E. The formin FHOD1 in cardiomyocytes. The Anatomical Record. 2014;297:1560–1570. doi: 10.1002/ar.22984. [DOI] [PubMed] [Google Scholar]
  16. Ferreira-Martins J, Leite-Moreira AF. Physiologic basis and pathophysiologic implications of the diastolic properties of the cardiac muscle. Journal of Biomedicine & Biotechnology. 2010;2010:807084. doi: 10.1155/2010/807084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fujimoto N, Kan-o M, Ushijima T, Kage Y, Tominaga R, Sumimoto H, Takeya R. Transgenic expression of the formin protein fhod3 selectively in the embryonic heart: role of actin-binding activity of fhod3 and its sarcomeric localization during myofibrillogenesis. PLOS ONE. 2016;11:e0148472. doi: 10.1371/journal.pone.0148472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gasteier JE, Madrid R, Krautkrämer E, Schröder S, Muranyi W, Benichou S, Fackler OT. Activation of the Rac-binding partner FHOD1 induces actin stress fibers via a ROCK-dependent mechanism. The Journal of Biological Chemistry. 2003;278:38902–38912. doi: 10.1074/jbc.M306229200. [DOI] [PubMed] [Google Scholar]
  19. Goode BL, Eck MJ. Mechanism and function of formins in the control of actin assembly. Annual Review of Biochemistry. 2007;76:593–627. doi: 10.1146/annurev.biochem.75.103004.142647. [DOI] [PubMed] [Google Scholar]
  20. Homa KE, Zsolnay V, Anderson CA, O’Connell ME, Neidt EM, Voth GA, Bidone TC, Kovar DR. Formin Cdc12’s specific actin assembly properties are tailored for cytokinesis in fission yeast. Biophysical Journal. 2021;120:2984–2997. doi: 10.1016/j.bpj.2021.06.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Huebsch N, Loskill P, Mandegar MA, Marks NC, Sheehan AS, Ma Z, Mathur A, Nguyen TN, Yoo JC, Judge LM, Spencer CI, Chukka AC, Russell CR, So PL, Conklin BR, Healy KE. Automated video-based analysis of contractility and calcium flux in human-induced pluripotent stem cell-derived cardiomyocytes cultured over different spatial scales. Tissue Engineering. Part C, Methods. 2015;21:467–479. doi: 10.1089/ten.TEC.2014.0283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Iskratsch T, Lange S, Dwyer J, Kho AL, dos Remedios C, Ehler E. Formin follows function: a muscle-specific isoform of FHOD3 is regulated by CK2 phosphorylation and promotes myofibril maintenance. The Journal of Cell Biology. 2010;191:1159–1172. doi: 10.1083/jcb.201005060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Iskratsch T, Yu CH, Mathur A, Liu S, Stévenin V, Dwyer J, Hone J, Ehler E, Sheetz M. FHOD1 is needed for directed forces and adhesion maturation during cell spreading and migration. Developmental Cell. 2013;27:545–559. doi: 10.1016/j.devcel.2013.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kan OM, Takeya R, Abe T, Kitajima N, Nishida M, Tominaga R, Kurose H, Sumimoto H. Mammalian formin Fhod3 plays an essential role in cardiogenesis by organizing myofibrillogenesis. Biology Open. 2012a;1:889–896. doi: 10.1242/bio.20121370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kan OM, Takeya R, Taniguchi K, Tanoue Y, Tominaga R, Sumimoto H. Expression and subcellular localization of mammalian formin Fhod3 in the embryonic and adult heart. PLOS ONE. 2012b;7:e34765. doi: 10.1371/journal.pone.0034765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kanaya H, Takeya R, Takeuchi K, Watanabe N, Jing N, Sumimoto H. Fhos2, a novel formin-related actin-organizing protein, probably associates with the nestin intermediate filament. Genes to Cells. 2005;10:665–678. doi: 10.1111/j.1365-2443.2005.00867.x. [DOI] [PubMed] [Google Scholar]
  27. Kimmich MJ, Sundaramurthy S, Geary MA, Lesanpezeshki L, Yingling CV, Vanapalli SA, Littlefield RS, Pruyne D. FHOD-1 and profilin protect sarcomeres against contraction-induced deformation> in C. elegans. Molecular Biology of the Cell. 2024;35:ar137. doi: 10.1091/mbc.E24-04-0145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Koka S, Neudauer CL, Li X, Lewis RE, McCarthy JB, Westendorf JJ. The formin-homology-domain-containing protein FHOD1 enhances cell migration. Journal of Cell Science. 2003;116:1745–1755. doi: 10.1242/jcs.00386. [DOI] [PubMed] [Google Scholar]
  29. Kovar DR, Harris ES, Mahaffy R, Higgs HN, Pollard TD. Control of the assembly of ATP- and ADP-actin by formins and profilin. Cell. 2006;124:423–435. doi: 10.1016/j.cell.2005.11.038. [DOI] [PubMed] [Google Scholar]
  30. Kutscheidt S, Zhu R, Antoku S, Luxton GWG, Stagljar I, Fackler OT, Gundersen GG. FHOD1 interaction with nesprin-2G mediates TAN line formation and nuclear movement. Nature Cell Biology. 2014;16:708–715. doi: 10.1038/ncb2981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lappalainen P, Kotila T, Jégou A, Romet-Lemonne G. Biochemical and mechanical regulation of actin dynamics. Nature Reviews. Molecular Cell Biology. 2022;23:836–852. doi: 10.1038/s41580-022-00508-4. [DOI] [PubMed] [Google Scholar]
  32. Li F, Higgs HN. Dissecting requirements for auto-inhibition of actin nucleation by the formin, mDia1. The Journal of Biological Chemistry. 2005;280:6986–6992. doi: 10.1074/jbc.M411605200. [DOI] [PubMed] [Google Scholar]
  33. Li D, Hallett MA, Zhu W, Rubart M, Liu Y, Yang Z, Chen H, Haneline LS, Chan RJ, Schwartz RJ, Field LJ, Atkinson SJ, Shou W. Dishevelled-associated activator of morphogenesis 1 (Daam1) is required for heart morphogenesis. Development. 2011;138:303–315. doi: 10.1242/dev.055566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Liu H, Naismith JH. An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol. BMC Biotechnology. 2008;8:91. doi: 10.1186/1472-6750-8-91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lu J, Pollard TD. Profilin binding to poly-L-proline and actin monomers along with ability to catalyze actin nucleotide exchange is required for viability of fission yeast. Molecular Biology of the Cell. 2001;12:1161–1175. doi: 10.1091/mbc.12.4.1161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Maizel JV, White DO, Scharff MD. The polypeptides of adenovirus I: evidence for multiple protein components in the virion and a comparison of types 2, 7A, and 12. Virology. 1968;36:115–125. doi: 10.1016/0042-6822(68)90121-9. [DOI] [PubMed] [Google Scholar]
  37. Matsuyama S, Kage Y, Fujimoto N, Ushijima T, Tsuruda T, Kitamura K, Shiose A, Asada Y, Sumimoto H, Takeya R. Interaction between cardiac myosin-binding protein C and formin Fhod3. PNAS. 2018;115:E4386–E4395. doi: 10.1073/pnas.1716498115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. McInally SG, Kondev J, Goode BL. Scaling of subcellular actin structures with cell length through decelerated growth. eLife. 2021;10:e68424. doi: 10.7554/eLife.68424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. McInally SG, Reading AJB, Rosario A, Jelenkovic PR, Goode BL, Kondev J. Length control emerges from cytoskeletal network geometry. PNAS. 2024;121:e2401816121. doi: 10.1073/pnas.2401816121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Mi-Mi L, Votra S, Kemphues K, Bretscher A, Pruyne D. Z-line formins promote contractile lattice growth and maintenance in striated muscles of C. elegans. The Journal of Cell Biology. 2012;198:87–102. doi: 10.1083/jcb.201202053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Molnár I, Migh E, Szikora S, Kalmár T, Végh AG, Deák F, Barkó S, Bugyi B, Orfanos Z, Kovács J, Juhász G, Váró G, Nyitrai M, Sparrow J, Mihály J. DAAM is required for thin filament formation and Sarcomerogenesis during muscle development in Drosophila. PLOS Genetics. 2014;10:e1004166. doi: 10.1371/journal.pgen.1004166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Moseley JB, Goode BL. Differential activities and regulation of Saccharomyces cerevisiae formin proteins Bni1 and Bnr1 by Bud6. The Journal of Biological Chemistry. 2005;280:28023–28033. doi: 10.1074/jbc.M503094200. [DOI] [PubMed] [Google Scholar]
  43. Myasnikov R, Bukaeva A, Kulikova O, Meshkov A, Kiseleva A, Ershova A, Petukhova A, Divashuk M, Zotova E, Sotnikova E, Kharlap M, Zharikova A, Vyatkin Y, Ramensky V, Abisheva A, Muraveva A, Koretskiy S, Kudryavtseva M, Popov S, Utkina M, Mershina E, Sinitsyn V, Kogan E, Blagova O, Drapkina O. A case of severe left-ventricular noncompaction associated with splicing altering variant in the FHOD3 Gene. Genes. 2022;13:309. doi: 10.3390/genes13020309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Nakano H, Minami I, Braas D, Pappoe H, Wu X, Sagadevan A, Vergnes L, Fu K, Morselli M, Dunham C, Ding X, Stieg AZ, Gimzewski JK, Pellegrini M, Clark PM, Reue K, Lusis AJ, Ribalet B, Kurdistani SK, Christofk H, Nakatsuji N, Nakano A. Glucose inhibits cardiac muscle maturation through nucleotide biosynthesis. eLife. 2017;6:e29330. doi: 10.7554/eLife.29330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Neininger-Castro AC, Hayes JB, Sanchez ZC, Taneja N, Fenix AM, Moparthi S, Vassilopoulos S, Burnette DT. Independent Regulation of Z-Lines and M-Lines during sarcomere assembly in cardiac myocytes revealed by the automatic image analysis software sarcApp. eLife. 2023;1:e0651. doi: 10.7554/eLife.87065.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ochoa JP. Formin homology 2 domain containing 3 (FHOD3) Is a genetic basis for hypertrophic cardiomyopathy. J Am Coll Cardiol. 2018;13:2457–2467. doi: 10.1016/j.jacc.2018.10.001. [DOI] [PubMed] [Google Scholar]
  47. Patel AA, Oztug Durer ZA, van Loon AP, Bremer KV, Quinlan ME. Drosophila and human FHOD family formin proteins nucleate actin filaments. The Journal of Biological Chemistry. 2018;293:532–540. doi: 10.1074/jbc.M117.800888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Paul AS, Pollard TD. The role of the FH1 domain and profilin in formin-mediated actin-filament elongation and nucleation. Current Biology. 2008;18:9–19. doi: 10.1016/j.cub.2007.11.062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Paul AS, Pollard TD. Review of the mechanism of processive actin filament elongation by formins. Cell Motility and the Cytoskeleton. 2009;66:606–617. doi: 10.1002/cm.20379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Pollard TD. Actin and actin-binding proteins. Cold Spring Harb Perspect Biol A018226. 2016;1:e8226. doi: 10.1101/cshperspect.a018226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Rosado M, Barber CF, Berciu C, Feldman S, Birren SJ, Nicastro D, Goode BL. Critical roles for multiple formins during cardiac myofibril development and repair. Molecular Biology of the Cell. 2014;25:811–827. doi: 10.1091/mbc.E13-08-0443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sanematsu F, Kanai A, Ushijima T, Shiraishi A, Abe T, Kage Y, Sumimoto H, Takeya R. Fhod1, an actin-organizing formin family protein, is dispensable for cardiac development and function in mice. Cytoskeleton. 2019;76:219–229. doi: 10.1002/cm.21523. [DOI] [PubMed] [Google Scholar]
  53. Sanger JW, Wang J, Fan Y, White J, Mi-Mi L, Dube DK, Sanger JM, Pruyne D. In: Handbook of Experimental Pharmacology. Wang J, Fan Y, editors. Springer Nature; 2017. Assembly and maintenance of myofibrils in striated muscle; pp. 39–75. [DOI] [PubMed] [Google Scholar]
  54. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. Fiji: an open-source platform for biological-image analysis. Nature Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Schönichen A, Geyer M. Fifteen formins for an actin filament: a molecular view on the regulation of human formins. Biochimica et Biophysica Acta. 2010;1803:152–163. doi: 10.1016/j.bbamcr.2010.01.014. [DOI] [PubMed] [Google Scholar]
  56. Schönichen A, Mannherz HG, Behrmann E, Mazur AJ, Kühn S, Silván U, Schoenenberger CA, Fackler OT, Raunser S, Dehmelt L, Geyer M. FHOD1 is a combined actin filament capping and bundling factor that selectively associates with actin arcs and stress fibers. Journal of Cell Science. 2013;126:1891–1901. doi: 10.1242/jcs.126706. [DOI] [PubMed] [Google Scholar]
  57. Schulze N, Graessl M, Blancke Soares A, Geyer M, Dehmelt L, Nalbant P. FHOD1 regulates stress fiber organization by controlling the dynamics of transverse arcs and dorsal fibers. Journal of Cell Science. 2014;127:1379–1393. doi: 10.1242/jcs.134627. [DOI] [PubMed] [Google Scholar]
  58. Shwartz A, Dhanyasi N, Schejter ED, Shilo BZ. The Drosophila formin Fhos is a primary mediator of sarcomeric thin-filament array assembly. eLife. 2016;5:e16540. doi: 10.7554/eLife.16540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Smith MB, Li H, Shen T, Huang X, Yusuf E, Vavylonis D. Segmentation and tracking of cytoskeletal filaments using open active contours. Cytoskeleton. 2010;67:693–705. doi: 10.1002/cm.20481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Spudich JA, Watt S. The regulation of rabbit skeletal muscle contraction. Journal of Biological Chemistry. 1971;246:4866–4871. doi: 10.1016/S0021-9258(18)62016-2. [DOI] [PubMed] [Google Scholar]
  61. Stringer C, Wang T, Michaelos M, Pachitariu M. Cellpose: a generalist algorithm for cellular segmentation. Nature Methods. 2021;18:100–106. doi: 10.1038/s41592-020-01018-x. [DOI] [PubMed] [Google Scholar]
  62. Sun H, Luo Y, Miao Y. Purification of globular actin from rabbit muscle and pyrene fluorescent assays to investigate actin dynamics in vitro. Bio-Protocol. 2018;8:e3102. doi: 10.21769/BioProtoc.3102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Sundaramurthy S, Votra S, Laszlo A, Davies T, Pruyne D. FHOD-1 is the only formin in Caenorhabditis elegans that promotes striated muscle growth and Z-line organization in a cell autonomous manner. Cytoskeleton. 2020;77:422–441. doi: 10.1002/cm.21639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Svitkina T. The actin cytoskeleton and actin-based motility. Cold Spring Harbor Perspectives in Biology. 2018;10:a018267. doi: 10.1101/cshperspect.a018267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Szikora S, Görög P, Mihály J. The mechanisms of thin filament assembly and length regulation in muscles. International Journal of Molecular Sciences. 2022;23:5306. doi: 10.3390/ijms23105306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Taniguchi K, Takeya R, Suetsugu S, Kan-o M, Narusawa M, Shiose A, Tominaga R, Sumimoto H. Mammalian formin Fhod3 regulates actin assembly and sarcomere organization in striated muscles. Journal of Biological Chemistry. 2009;284:29873–29881. doi: 10.1074/jbc.M109.059303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Ushijima T, Fujimoto N, Matsuyama S, Kan-o M, Kiyonari H, Shioi G, Kage Y, Yamasaki S, Takeya R, Sumimoto H. The actin-organizing formin protein Fhod3 is required for postnatal development and functional maintenance of the adult heart in mice. Journal of Biological Chemistry. 2018;293:148–162. doi: 10.1074/jbc.M117.813931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Valencia DA. sarcApp_Cellpose_Merge. swh:1:rev:33bf5fa8ede8fdb3596eb1db71e3b0c81f4643a0Software Heritage. 2025 https://archive.softwareheritage.org/swh:1:dir:681a7e8ac52cb2488b5a51e1b81cd30ad3093893;origin=https://github.com/davalencia0914/sarcApp_Cellpose_Merge;visit=swh:1:snp:fc0220c408798fe2ad5bed14bb4ab770bc962290;anchor=swh:1:rev:33bf5fa8ede8fdb3596eb1db71e3b0c81f4643a0
  69. Vizcarra CL, Bor B, Quinlan ME. The role of formin tails in actin nucleation, processive elongation, and filament bundling. The Journal of Biological Chemistry. 2014;289:30602–30613. doi: 10.1074/jbc.M114.588368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Vodnjov N, Toplišek J, Maver A, Čuturilo G, Jaklič H, Teran N, Višnjar T, Škrjanec Pušenjak M, Hodžić A, Miljanović O, Peterlin B, Writzl K. A novel splice-site FHOD3 founder variant is a common cause of hypertrophic cardiomyopathy in the population of the Balkans-A cohort study. PLOS ONE. 2023;18:e0294969. doi: 10.1371/journal.pone.0294969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wu G, Ruan J, Liu J, Zhang C, Kang L, Wang J, Zou Y, Song L. Variant spectrum of formin homology 2 domain-containing 3 gene in chinese patients with hypertrophic cardiomyopathy. Journal of the American Heart Association. 2021;10:e018236. doi: 10.1161/JAHA.120.018236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Xu Y, Moseley JB, Sagot I, Poy F, Pellman D, Goode BL, Eck MJ. Crystal structures of a formin homology-2 domain reveal a tethered dimer architecture. Cell. 2004;116:711–723. doi: 10.1016/s0092-8674(04)00210-7. [DOI] [PubMed] [Google Scholar]
  73. Zweifel ME, Courtemanche N. Competition for delivery of profilin-actin to barbed ends limits the rate of formin-mediated actin filament elongation. The Journal of Biological Chemistry. 2020;295:4513–4525. doi: 10.1074/jbc.RA119.012000. [DOI] [PMC free article] [PubMed] [Google Scholar]

eLife Assessment

Alphee Michelot 1

Valencia et al. combine elegant in vitro biochemical experiments with functional assays in cardiomyocytes to determine which properties of the FHOD3 formin are essential for sarcomere assembly. Using separation-of-function mutants, they show that FHOD3's elongation activity, rather than its nucleation, capping, or bundling activities, is key to its sarcomeric function. This is an important finding and the data presented in the manuscript are convincing; however, the presence of FHOD3 at filament barbed ends in the TIRF elongation assays should probably be verified directly in a future study.

Reviewer #1 (Public review):

Anonymous

Summary:

Formins are complex proteins with multiple effects on actin filament assembly, including nucleation, capping with processive elongation, and bundling. Determining which of these activities are important for a given biological process and normal cellular function is a major challenge.

Here, the authors study the formin FHOD3L, which is essential for normal sarcomere assembly in muscle cells. They identify point mutants of FHOD3L in which formin nucleation and elongation/bundling activities are functionally separated. Expression of these mutants in neonatal rat ventricular myocytes shows that the control of actin filament elongation by formin is the major activity required for normal assembly of functional sarcomeres.

Strengths:

The strength of this work is to combine sensitive biochemical assays with excellent work in neonatal rat ventricular myocytes. This combination of approaches is highly effective for analyzing the function of proteins with multiple activities in vitro. The authors have pushed the experiments and data analysis as far as possible with the technologies available to them.

Weaknesses:

FHOD3L is not the easiest formin to study because of its relatively weak nucleation activity and the short duration of capping events. This difficulty imposes rigorous biochemical analysis and careful interpretation of the data. As the authors acknowledge, it will be important in future to perform complementary multi-color TIRF experiments to confirm that the brief accelerations in the elongation of actin filaments are indeed due to FHOD3 binding.

Reviewer #3 (Public review):

Anonymous

Valencia et al. aim to elucidate the biochemical and cellular mechanisms through which the human formin FHOD3 drives sarcomere assembly in cardiomyocytes. To do so, they combined rigorous in vitro biochemical assays with comprehensive in vivo characterizations, evaluating two wild type FHOD3 isoforms and two function-separating mutants. Surprisingly, they found that both wild type FHOD3 isoforms can nucleate new actin filaments, as well as elongate existing actin filaments in conjunction with profilin following barbed-end capping. This is in addition to FHOD3's proposed role as an actin bundler. Next, the authors focused on the longer isoform FHOD3L due to its essential role in sarcomere assembly in cardiomyocytes. They asked whether FHOD3L promote sarcomere assembly through its activity in actin nucleation or rather elongation. To do so, the authors designed two function-separating mutants: the K1193L mutation in the FH2 domain, known for its importance in actin nucleation, and the glycine-serine linker substitution in the FH1 domain ("GS-FH1",) known for its requirement in actin elongation. They demonstrated that while K1193L maintains its elongation activity and greatly diminishes nucleation and bundling, in GS-FH1 keeps its nucleation activity while lose its capacity to drive elongation. Armed with these tools, the authors attempted to rescue FHOD3L siRNA-treated neonatal rat ventricular myocytes (NRVM) with transgenes carrying wild type, K1193L, or GS-FH1 mutant forms of human FHOD3. In each condition, they evaluated the numbers and morphology of sarcomeres, as well as their ability to beat and generate cardiac rhythm. The authors found that while the wild type FHOD3L and the K1193L mutant can rescue sarcomere morphology and physiology, the GS-FH1 mutant fails to do so. Given that in GS-FH1 mainly elongation activity is compromised, the authors concluded that the elongation activity of FHOD3 is essential for its role in sarcomere assembly in cardiomyocytes, while its nucleator activity is dispensable. Overall, this important study provided a broadened view on the biochemical activities of FHOD3, and a pioneering view on a possible cellular mechanism of how FHOD3L drives sarcomere assembly. If further validated, this can lead to new mechanistic models of sarcomere assembly and potentially new therapeutic targets of cardiomyopathy.

The conclusions of this paper are mostly well supported by the comprehensive biochemical analyses performed by the authors. In my original assessment, I raised the point that the extreme low level of GS-FH1 signal in transfected cells in Figure 6A may reflect a failure of actin-binding by this construct in vivo, rather than its inability of driving elongation. The authors have thoroughly addressed this concern by: (1) providing new images of the GS-FH1 rescue condition with HA-FHOD3L signal intensities matching that of the K1193L rescue condition, and (2) quantitatively demonstrating that the expression levels in the GS-FH1 rescue condition are comparable with that of wild type FHOD3L rescue condition. This is nicely complemented by the new phalloidin staining of the GS-FH1 rescue condition, which showcased additional details of actin puncta reminiscent of that present in muscle stress fibers or premyofibrils. Overall, I am now convinced that the GS-FH1 cannot rescue sarcomere formation even when expressed at comparable levels. Given that GS-FH1 demonstrates actin elongation defects in vitro, it is reasonable to conclude that the actin elongation function of FHOD3L is essential for sarcomere formation in vivo.

eLife. 2025 Jul 15;13:RP104048. doi: 10.7554/eLife.104048.3.sa3

Author response

Dylan A Valencia 1, Angela N Koeberlein 2, Haruko Nakano 3, Akos Rudas 4, Aanand A Patel 5, Airi Harui 6, Cassandra Spencer 7, Atsushi Nakano 8, Margot E Quinlan 9

The following is the authors’ response to the original reviews.

Public Reviews:

Reviewer #1 (Public review):

Summary:

Formins are complex proteins with multiple effects on actin filament assembly, including nucleation, capping with processive elongation, and bundling. Determining which of these activities is important for a given biological process and normal cellular function is a major challenge.

Here, the authors study the formin FHOD3L, which is essential for normal sarcomere assembly in muscle cells. They identify point mutants of FHOD3L in which formin nucleation and elongation/bundling activities are functionally separated. Expression of these mutants in neonatal rat ventricular myocytes shows that the control of actin filament elongation by formin is the major activity required for the normal assembly of functional sarcomeres.

Strengths:

The strength of this work is to combine sensitive biochemical assays with excellent work in neonatal rat ventricular myocytes. This combination of approaches is highly effective for analyzing the function of proteins with multiple activities in vitro.

Weaknesses:

FHOD3L does not seem to be the easiest formin to study because of its relatively weak nucleation activity and the short duration of capping events. This difficulty imposes rigorous biochemical analysis and careful interpretation of the data, which should be improved in this work.

We thank the reviewer for their praise and appreciation of our work. Indeed, FHOD3L is a challenging formin to work with.

Important points are raised here and below regarding the brief elongation events we reported. As suggested, we performed more rigorous analysis of the data and present it in the revised manuscript. We now report that from 45 dim regions analyzed, in three independent experiments with wild type FHOD3L, we detected 40 bursts. (The remaining five could be formin falling off too quickly to detect or the dim spots could be regions of inhomogeneity in intensity, not due to formin.) For comparison to the presented data with FHOD3L-CT, we analyzed the filaments in TIRF assays with no formin present. As the reviewers point out, inhomogeneities in filament intensity are normal. Thus, we examined any dim spots for pauses and/or bursts. As is now reported in Figure 2G,H, the velocity of growth of these dim spots is indistinguishable from the velocity of the rest of the filament. We acknowledge that our numbers may not be perfectly accurate, due to the noise in our system, we believe that the difference of 3-4 fold increase versus no change in rate is substantial and convincing.

We also determined the number of dim spots per length of filament. We found a higher frequency when FHOD3L-CT or FHOD3S-CT was present vs no formin, as now shown in Figure 2 – supplements 1G and 2E.

We were asked about the pauses we observe before bursts of elongation and how we know they are functionally relevant. The short answer is that we do not know. We reported them because they were so common: Of the 40 bursts, pauses preceded the burst in 38 cases. We cannot rule out that this pause reflects an interaction with the surface but might expect the frequency to be lower if it were. We revise the text to make our conclusions about pauses more circumspect.

We are convinced that the brief dim events we observed in the presence of FHOD3L-CT, in fact, reflect formin-mediated elongation and worked hard to improve their presentation, in addition to the added analysis. We include new kymographs, including examples from FHOD3L, FHOD3S, K1193L, and actin alone. We hope that the reviewers are also convinced.

This does not preclude our interest in the microfluidics and two-color assays, which will be pursued in the future. We have reached out to a colleague who is set up to repeat these measurements with microfluidics-assisted TIRF. The noise should be greatly reduced and the system is also optimal for directly visualizing labeled FHOD3, as suggested. We expect these experimental approaches will provide additional insights.

Reviewer #2 (Public review):

This article elucidates the biochemical and cellular mechanisms by which the FHOD-family of formins, particularly FHOD3, contributes to sarcomere formation and contractility in cardiomyocytes. Formins are mainly known to nucleate and elongate actin filaments, with certain family members also exhibiting capping, severing, and bundling activities. Although FHOD3 has been well-established as essential for sarcomere assembly in cardiomyocytes, its precise biochemical functions and contributions to actin dynamics remain poorly understood.

In this study, the authors combine in vitro biochemical assays with cellular experiments to dissect FHOD3's roles in actin assembly and sarcomere formation. They demonstrate that FHOD3 nucleates actin filaments and acts as a transient elongator, pausing elongation after an initial burst of filament growth. Using separation-of-function mutants, they show thatFHOD3's elongation activity - rather than its nucleation, capping, or bundling capabilities - is key for its sarcomeric function.

The experiments have been conducted rigorously and well-analyzed, and the paper is clearly written. The data presented support the authors' conclusions. I appreciate the detailed description and rationale behind the FHOD3 constructs used in this study.

We are happy to hear others find paper to be clearly written and well described.

However, I was somewhat surprised and a bit disappointed that while the authors conducted single-color TIRF experiments to observe the effects of FHOD3 on single filaments, they did not use fluorescently labeled FHOD3 to directly visualize its behavior. Incorporating such experiments would significantly strengthen their conclusions regarding FHOD3's bursts of elongation interspersed with capping activity. While I understand this might require a few additional weeks of experiments, these data would add considerable value by directly testing the proposed mechanism.

We appreciate the suggestion and hope to incorporate a two-color approach soon. As noted, FHOD3L is not always easy to work with and we do not have a functional labeled copy of the protein at this time.

There is a typo in the word "required" in line number 30. The authors also use fit data to extract parameters in several panels (e.g., Figures 2b, 2d, 3a, and 3b). While these fit functions may be intuitive to actin experts, explicitly describing the fit functions in the figure legends or methods would greatly benefit the broader readership.

Thank you for these comments. We updated the indicated figures and described the analysis in greater detail.

Reviewer #3 (Public review):

Valencia et al. aim to elucidate the biochemical and cellular mechanisms through which the human formin FHOD3 drives sarcomere assembly in cardiomyocytes. To do so, they combined rigorous in vitro biochemical assays with comprehensive in vivo characterizations, evaluating two wild-type FHOD3 isoforms and two function-separating mutants. Surprisingly, they found that both wild-type FHOD3 isoforms can nucleate new actin filaments, as well as elongate existing actin filaments in conjunction with profilin following barbed-end capping. This is in addition to FHOD3's proposed role as an actin bundler. Next, the authors asked whether FHOD3L promotes sarcomere assembly in cardiomyocytes through its activity in actin nucleation or rather elongation. With two function-separating mutants, the authors evaluated the numbers and morphology of sarcomeres, as well as their ability to beat and generate cardiac rhythm. The authors found that while the wild-type FHOD3L and the K1193L mutant can rescue sarcomere morphology and physiology, the GS-FH1 mutant fails to do so. Given that in GS-FH1 mainly elongation activity is compromised, the authors concluded that the elongation activity of FHOD3 is essential for its role in sarcomere assembly in cardiomyocytes, while its nucleator activity is dispensable. Overall, this important study provided a broadened view on the biochemical activities of FHOD3, and a pioneering view on a possible cellular mechanism of how FHOD3L drives sarcomere assembly. If further validated, this can lead to new mechanistic models of sarcomere assembly and potentially new therapeutic targets of cardiomyopathy.

The conclusions of this paper are mostly well supported by the comprehensive biochemical analyses performed by the authors. However, the sarcomere assembly defect phenotype in the GS-FH1 rescue condition requires further investigation, as the extremely low level of GS-FH1 signal in transfected cells in Figure 6A may reflect a failure of actin-binding by this construct in vivo, rather than its inability to drive elongation. Though the authors do show in Figure 6 that GS-FH1 can bind to normal-looking sarcomeres when they are present, this may be due to a lack of siRNA activity in these cells, such that endogenous FHOD3L is still present. In this possible scenario, GS-FH1 may dimerize with endogenous FHOD3L. The authors should demonstrate that GS-FH1 alone can indeed interact with existing actin filaments in vivo. While this has been clearly demonstrated in vitro, given the more complex biochemical environment in vivo where additional unknown binding partners may present, cautions should be made when extrapolating findings from the former to the latter.

The reviewer is concerned about the low protein levels in the GS-FH1 rescue experiments as reflected in the HA fluorescence intensity distributions shown in Fig. 5 Supplement 2A. While the scenario proposed could explain our observations with the GSFH1 rescues it is quite complex. Nor does the scenario preclude the conclusion that the FH1 domain is critical. We agree that the observed sarcomeres are likely to be residual in cells with incomplete RNAi. We now include the image of a cell that is still full of sarcomeres and note that the GH-FH1 is expressed at a relatively high level and striated throughout the cell. We interpret this as evidence that GS-FH1 is stable when suitable binding sites are available. We cannot exclude that there is more GS-FH1 because there was more endogenous FHOD3L with which to heterodimerize. If the GS-FH1 heterodimer were simply poisoning the wild type protein, we do not expect that it would be bound correctly to sarcomeres. If, instead, heterodimers have some activity, it seems far from sufficient to rescue sarcomere formation, suggesting that two functional FH1 domains are critical.

Furthermore, we do not see evidence of correlation between protein levels and rescue at the level present in these cells (addressed below). Unfortunately, the proposed IP to test whether FHOD3L binds actin in vivo would only potentially report on filament side binding (both direct and indirect). It would not address whether the GS-FH1 mutant functions as a nucleator, elongator, bundler and/or capping protein in vivo.

The critical question that we can address is whether the phenotype is due to low protein levels, assuming the protein present is functional, or due to loss of elongation activity by FHOD3L. To address this question, we returned to our data.

First, we plotted the distributions of the intensities of the cells we analyzed further, in addition to the automated readout of all of the cells in the dish (Fig. 4 supplement 1). These cells were selected randomly and, as should be the case, the distributions of their intensities agree well with the original distributions for the three different rescue constructs: FHOD3L, K1193L, and GS-FH1 (Fig. 6 supplement 1). We then asked whether there was any correlation in HA intensities with the sarcomere metrics. As seen in our pilot data, no correlation is evident in any of the three cases across the range of intensities we collected (400 – 2700 a.u.) (old Fig. 6 supplement C,D,E). We now replace the data from pilot experiments with analysis of HA intensities and sarcomere metrics from the data sets included in the paper (new Fig 6. Supplement 1). Again, little to no correlation was observed (the single highest r-squared value is 0.2 and the remaining eight values are less than or equal to 0.08).

To more specifically address the question of whether low HA fluorescence intensity is likely to reflect sufficient protein levels to build sarcomeres we re-examined two data sets from the FHOD3L WT rescue data. We found that, by chance, the first replicate of data from the wild type rescue has a comparable intensity distribution to that of the GSFH1 rescues (580 +/- 261 / cell vs. 548 +/- 105 / cell). In addition, we collected all of the data from cells with intensity levels <720, designed to mimic the distribution of the GS-FH1 cells (Fig. 6 supplement 3). We then compared the sarcomere metrics (sarcomere number, sarcomere length, sarcomere width) between the full data set and the two low intensity subsets:

• Sarcomere number is the only non-normal metric. We therefore used the Mann Whitney U test, which shows no difference between all 3 WT distributions.

• We compared Z-line lengths by one-way ANOVA and Tukey's post hoc tests, again finding no significant difference for all distributions.

• Sarcomere length shows a weakly significant difference (p=0.038) between the whole WT data set and bio rep 1, but no difference between the whole WT data set and the HA<720 group.

Thus, cells expressing wild type FHOD3L at levels comparable to levels detected in GS-FH1 mutant rescues, are fully rescued. Based on these findings we conclude that the expression levels in the GS-FH1 are high enough to rescue the FHOD3 knock down, supporting our conclusion that the defect is due to loss of elongation activity. We have added this analysis and discussion to the revised manuscript.

Recommendations for the authors:

Reviewing Editor Comments:

You will see that the 3 reviewers are very positive about your work and appreciate the elegant combination of biochemical assays and functional tests in cardiomyocytes. We've had a long discussion with them and we all agree that two experiments deserve further effort to make the conclusions of your paper more convincing.

Thank you.

The first experiment is the TIRF elongation assay, where the two biochemist Reviewers remain doubtful that these short events are really due to the presence of a formin at the end of the filament. One of them suggests that two-color imaging with a labeled formin should clearly prove this point.

We agree that the elongation assays can be improved. Given the similarity of processivity of Fhod3L, Fhod3S and Drosophila FhodA (measured by a distinct method), we are inclined to believe them. However, the reviewer raises an excellent point about the accuracy of the measurements given the resolution (and noise) of the data. We are interested in the two-color imaging assay but do not believe it will necessarily simplify the analysis. We suspect that Fhod spends more time at/near the barbed end than is apparent based on elongation rates. The fact that we see repeated events on individual filaments at such low concentrations of FHOD3L (0.1 nM) supports this idea. Otherwise, the likelihood of FHOD3L finding barbed ends so often is really quite low.

We will return to these experiments, using alternate methods, curious to see what else we learn. In the meantime, we conducted more thorough analysis, including controls, and improved visualization of example traces. Data for elongation analysis and kymographs were acquired with Jfilament. We stretched the x-axis (time) in kymographs for FHOD3L-CT (Fig. 2F), FHOD3S-CT (Fig. 2, supplement 2C), FHOD3L-CT K1193L (Fig. 3, supplement 1A), and actin alone (Fig 2G), and highlighted regions of analysis. The slopes for these regions, separated based on intensity, were fit to the data in KaleidaGraph. The fits are offset from the data such that they do not obscure the filaments and corresponding rates are given. The fact that we never see fast dim regions when FHOD3 is not present, as shown in Fig. 2H and that the frequency of dim events is markedly increased (Fig. 2-supplements 1G and 2E) give us confidence that the events are real. We acknowledge in the text that the precise values of the short events may be inaccurate due to the resolution of our experiments. We hope the reviewers are convinced by the improved analysis.

The second experiment is the sarcomere assembly defect phenotype in the GS-FH1 rescue condition. This requires further investigation, as the extremely low level of GS-FH1 signal in transfected cells in Figure 6A may reflect a failure of actin-binding/nucleation in vivo, rather than its inability to elongate F-actin. Although you show that GS-FH1 can bind to sarcomeres when they are present, this may be due to a lack of siRNA activity in these cells, such that endogenous FHOD3L is still present. In this possible scenario, GS-FH1 could dimerize with endogenous FHOD3L.

We agree that the sarcomeres we see are likely to be residual and could reflect some remaining endogenous FHOD3. The reviewers are concerned about the low protein levels in the GSFH1 rescues. First, we do not agree that the levels are “extremely” low. Through careful analysis, we established that 3xHA-FHOD3L intensities between 300 and 3000 a.u./um2 were sufficient for full rescue. The mean for the GSFH1 experiments is 533 +/- 93, which is well within this range. Furthermore, we did not observe correlation between sarcomere number, length, or width and HA intensity over the full range collected for wild type FHOD3L or within the GS-FH1 data. We previously showed pilot data but now show correlation analysis for every analyzed cell (Fig. 4 – figure supplement 1 D-F). We conducted this analysis on all of the mutant rescue experiments (Fig. 6-supplement 1). Finally, we identified two subpopulations of the wildtype rescue data. One is all of the cells with HA intensity < 720, which gives a distribution of mean 545 +/- 85. The second set is the first biological replicate of wild type rescue, which has a distribution of mean 560 +/- 160. Again correlation shows little relationship between HA levels and sarcomere metrics. Nevertheless, we show intensity level matched images in Fig 6, as opposed to images reflecting average intensities.

The critical question remains whether the phenotype is due to low protein levels or due to loss of elongation by FHOD3L. Notably, we now show a cell that is full of sarcomeres and has relatively high FHOD3L levels as well, consistent with available binding sites stabilizing mutant protein but not ruling out heterodimerization (Fig. 6 – figure supplement 2C). Others have expressed mutant FHOD3L in a wild type background in mice. They observed poisoning, consistent with heterodimerization. Thus, it is possible that, as suggested, the FHOD3L-GSFH1 detected in sarcomeres is in fact heterodimerized with residual endogenous FHOD3L. In this case, we would still conclude that the protein is not functional enough to rescue, supporting a role for the FH1 domain.

In the future, we plan to perform experiments with compromised, but not inactive, FH1 domains, as we discuss in the paper.

We hope that you will find these comments useful.

Yes, the comments were thoughtful and helped us write a better paper. Thank you.

Reviewer #1 (Recommendations for the authors):

Some experiments should be described and analyzed more carefully. This lack of clarity calls into question the interpretation of some experiments. Overall, this study is not yet as convincing as it should be.

Main recommendations:

(1) Formin elongation phases in the TIRF experiment are not convincing. They are rare and it is difficult to see any significant difference between the control movie without FHOD3L-CT and the movie with FHOD3L-CT. Filaments assembled in the absence of FHOD3L-CT also show some fluorescence inhomogeneity (which is normal), and measurements of formin elongation rates and capping times are not convincing (for example, the kymograph of the control profilin-actin situation in Figure 2F also shows a fast elongation phase on the right).

Please see response above. We conducted more thorough analysis and created improved visualizations. We hope the data are more convincing now.

It is also difficult to understand how an accurate measurement can be made from these noisy kymographs, and the method section should explain that precisely.

This is a valid point. We added details of analysis to the methods section and we discuss the fact that the measurements are at the limit of our resolution in the paper. We rely on the large (~3-fold) difference in elongation, more than specific elongation rates for our interpretation.

One of the problems is that these events are too transient to quantify well with noisy data. I noticed that the formin concentration used in these movies is quite low (0.1 nM FHOD3L-CT). Is there a reason for this? Is it possible to increase the formin concentration to increase the number of formin capping/elongation events and provide more convincing movies?

We acknowledge that the data are noisy. We felt that it was necessary to perform experiments with filaments only tethered at one end, leaving the growing end free. We did so, in part, because when we did experiments with biotinylated actin to anchor the filaments down, we observed pauses in the absence of formin. Ultimately, we compromised, using anchored seeds and a relatively low concentration of NEM-myosin to decrease motion of the actin filaments.

The experiments were performed with such low FHOD3L-CT because it was a potent nucleator in TIRF assays, making data analysis nearly impossible with more formin present. FHOD3S-CT and FHOD3L-CT K1193L behaved somewhat differently between these experiments and we were able to perform them with 1 nM formin.

Not seeing formin at the tip of the filaments is an additional difficulty because we do not know if these pauses occur because formin is stuck to the coverslips (which could very well happen with these sticky proteins) or freely bound at the end of a filament as the text suggests. Is there any argument in favor of one scenario over the other?

This will be an important experiment. As described above, we suspect that Fhod spends more time at/near the barbed end than is apparent based on elongation data. The fact that we see repeated events on individual filaments at such low concentrations of FHOD3L (0.1 nM) supports this idea. Otherwise, the likelihood of FHOD3L finding barbed ends so often is really quite low. In order to address the question about the cause of pauses, we reviewed our data, finding that 38 of 40 bursts were preceded by pauses. We do, however, discuss that we cannot rule out non-specific interactions with the surface.

(2) Pyrene elongation assays in the presence of profilin are actually more convincing to test the elongation ability of formins. However, such an assay is not presented for all mutants. It should be.

While we agree to some extent with this comment, we did not include the pyrene data for all of the mutants because the shapes of the curves were even more complicated than those seen with wild type FHOD3L-CT rendering them uninterpretable.

(3) Some experiments (e.g. in Figure 2E) are performed with yeast profilin, while others (e.g. in Figure 2F) are performed with human profilin. Obviously, both profilins could modulate formin activity differently and the side-by-side interpretation of both experiments is difficult. Could the authors stick to human profilin for all experiments?

We used to always perform pyrene assays with yeast profilin because it was known to be insensitive to pyrene. These data were collected before we realized that the affinity of human profilin for actin is so high that we could probably do everything with this profilin. We have compared the two profilins for other formins, e.g. Delphilin, Capu, and did not observe detectable differences.

Minor recommendations:

(1) The pyrene assays with the light blue colored curve choice are not ideal. I have difficulties seeing some of the curves.

Thank you. We added symbols to a subset of the traces to make them more visible.

(2) In the same curves, I can't understand what the +3.75 and 0.078 numbers mean. Could these results be plotted in a clearer way?

These values are the lowest concentrations in the range tests. They were matching light blue with black outline for visibility. We added symbols and changed the color of the numbering for improved visibility/understanding.

(3) In Figure 2D, is the Kd of I1163A really determined only from 2 experimental data points?

Of course not. We now show the figure with extended axes in Fig. 2 - figure supplement 1C.

(4) In Figure 2C, the shape of the curves suggests that this is not a pure capping assay, but a mix of capping and nucleation. It's not dramatic but could lead to an under-estimation of the capping efficiency.

We agree with the reviewer that the complicated shapes confound interpretation. Our analysis is based on the earliest slopes, in part, for this reason. We added discussion of this complication to the text.

Reviewer #3 (Recommendations for the authors):

Suggestions for additional experiments:

(1) To evaluate whether GS-FH1 alone can indeed interact with existing actin filaments in vivo, the authors may consider performing immunoprecipitation assays with GS-FH1 extracted from rescued NRVMs.

An IP of GS-FH1 from cells could show actin filament side binding but, unfortunately, will not provide any information about filament end binding, which is of much greater interest.

It will be helpful to show phalloidin staining in GS-FH1 rescues in a similar manner as in Figure 6-supplement 1, panel B, and compare that with mock rescue in Figure 4 panel D. It will be essential to prove this prior to concluding that actin elongation activity is essential for sarcomere assembly.

This is an excellent suggestion. We now include images of phalloidin stained cells from both K1193L and GS-FH1 rescues (Fig. 6A’ – supplement 2A,B). We were intrigued to see small actin punctae that were sometimes aligned. We speculate that these could be pre-premyofibrils and suggest that this is further evidence that the GS-FH1 protein is not completely unstable.

(2) Prior to sarcomere assembly, a-actinin is known to form short bundles with actin filaments (I-Z-I complex) without clearly defined periodicity. This semi-ordered state then transforms into the more ordered sarcomeres with periodic spacing. It will be valuable to show the phalloidin staining in addition to the a-actinin IF consistently across all conditions. This may lead to further insights into the defects of sarcomere assembly. Along the same vein, higher magnification images showcasing several sarcomeres will help the readers evaluate these defects.

We agree that there are additional valuable measurements to be made. In order to favor synchronized contraction, we plated the cells at too high a density to reliably identify IZI complexes. We have included some zoomed in images of the phalloidin staining.

Recommendations for improving the writing:

The authors mentioned the interaction between cardiac MyBP-C and FHOD3L as essential for the localization of FHOD3L to the C-line of the sarcomere. Can they discuss whether this interaction is important for the role of FHOD3L in sarcomere assembly? If so, how?

This is a very interesting question that we cannot answer at this time.

Minor corrections to the text and figures:

In the legend of Figure 2-Figure Supplement 1, the labels of (F) and (E) are swapped.

Thank you for catching this.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—figure supplement 1—source data 1. PDF file containing original file for Coomasie-stained SDS-PAGE gel displayed in Figure 1—figure supplement 1, indicating the relevant bands and treatments.
    Figure 1—figure supplement 1—source data 2. Original file for Coomasie-stained SDS-PAGE gel displayed in Figure 1—figure supplement 1.
    Figure 2—source data 1. PDF file containing original file for Coomasie stained SDS-PAGE gels displayed in Figure 2I, Figure 2—figure supplement 2H, indicating the relevant bands and treatments.
    Figure 2—source data 2. Original file for Coomasie-stained SDS-PAGE gels displayed in Figure 2I, Figure 2—figure supplement 2H.
    Figure 4—source data 1. PDF files containing original file western blots displayed in Figure 4B, indicating the relevant bands and treatments.
    Figure 4—source data 2. Originals file for westerns blots displayed in Figure 4B.
    MDAR checklist

    Data Availability Statement

    All gels and western blots analysed during this study are included in the article and supporting files; source data files have been provided for Figures 1, 2, and 4. All code used can be found on GithHub (https://github.com/davalencia0914/sarcApp_Cellpose_Merge; copy archived at Valencia, 2025).


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES