Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Jul 22.
Published in final edited form as: Am J Physiol Gastrointest Liver Physiol. 2025 May 16;329(2):G307–G312. doi: 10.1152/ajpgi.00117.2025

ASBT governs neonatal bile acid homeostasis early in life despite its strong ileal repression

Joyce Morales Aparicio 1, Zhengzheng Hu 1, Amy M Peiper 1, Lufuno Phophi 1, Haley M Wilt 1, Meera S Nair 1, Harrison Winton 1, Katherine Blessing 1, Gabriela R Gonzalez 1, Stephanie M Karst 1,*
PMCID: PMC12279447  NIHMSID: NIHMS2087502  PMID: 40380125

Abstract

Neonatal bile acid metabolism is distinct from that of adults due to developmental regulation of key transporters and enzymes. The apical sodium-dependent bile acid transporter (ASBT) is transiently repressed in the intestine after birth, yet its role in neonatal bile acid homeostasis remains unclear. Here, we demonstrate that ASBT plays a crucial role in limiting fecal bile acid loss and suppressing hepatic bile acid synthesis in neonates. ASBT-deficient pups exhibited a marked decrease in serum bile acids and concomitant increase in fecal bile acids, accompanied by upregulated hepatic bile acid synthesis genes, including CYP7A1, CYP7B1, and CYP27A1. We also illuminated a tissue-specific distinction in neonatal negative feedback regulation of bile acid synthesis, with intact hepatic regulation but impaired intestinal regulation. Our study identifies ASBT as a key regulator of neonatal bile acid homeostasis despite its strong repression early in life, highlighting its role in bile acid retention and synthesis regulation.

Graphical Abstract

graphic file with name nihms-2087502-f0001.jpg

NEW & NOTEWORTHY

Despite being repressed after birth, ASBT is essential for neonatal bile acid homeostasis. This study reveals that ASBT limits fecal bile acid loss and suppresses hepatic bile acid synthesis in neonates. ASBT-deficient pups showed reduced serum bile acids, increased fecal loss, and upregulation of bile acid synthesis genes. Notably, feedback regulation of bile acid synthesis was intact in the liver but impaired in the intestine, uncovering tissue-specific control mechanisms in early life.

INTRODUCTION

Bile acids (BAs) are essential for lipid absorption and serve as key regulators of metabolic, immune, and microbiota-related processes1-5. In adults, their homeostasis is maintained through enterohepatic circulation, a tightly controlled process involving bile acid synthesis in the liver, secretion into the proximal intestine and reabsorption in the distal intestine for recycling back to the liver6. The apical sodium-dependent bile acid transporter (ASBT), expressed in ileal enterocytes, mediates the active reabsorption of bile acids in the gut, preventing their fecal loss.

Bile acid synthesis is tightly regulated such that only a small fraction escape hepatic reclamation to enter circulation where they can reach peripheral organs7,8. Highlighting the importance of this regulatory network, disrupted bile acid homeostasis resulting in increased systemic bile acid levels has been associated with numerous metabolic, neurodegenerative, and cardiovascular diseases9-11 and certain cancers9-12. Regulation of bile acid synthesis is primarily governed by the farnesoid X receptor (FXR), which responds to bile acid levels to maintain homeostasis. FXR activation in the intestine following ASBT-mediated transport into intestinal epithelial cells induces fibroblast growth factor 15 (FGF15; FGF19 in humans), which circulates to the liver to inhibit cytochrome P450 family 7 subfamily 1 member 1 (CYP7A1), the rate-limiting enzyme in bile acid synthesis. Additionally, hepatic FXR induces small heterodimer partner (SHP) which represses bile acid synthesis.

Neonatal bile acid metabolism differs significantly from that of adults due to developmental regulation of key transporters and enzymes. In particular, intestinal ASBT is expressed during fetal development but is rapidly repressed after birth, only to be reactivated at weaning13,14. While mechanisms regulating these dynamic changes in ASBT expression are incompletely understood, there is evidence for posttranscriptional, hormonal, and dietary regulation15-18. The timing of ASBT upregulation at or near weaning is also consistent with microbiota influences. Moreover, the functional significance of this transient repression remains unclear, but it may serve to prevent elevated systemic bile acids before hepatic reclamation processes have matured, protect the neonatal liver from excessive bile acid accumulation, or provide a compensatory signal to enhance hepatic bile acid synthesis17. Relatedly, the functional state of FXR-mediated regulatory processes in neonates remains poorly understood, although constitutive FXR activation has been linked to growth retardation and neonatal lethality19. Given the dynamic changes in ASBT expression during early life, it is critical to determine how ASBT influences bile acid metabolism and whether FXR-mediated regulatory pathways function in this developmental window.

In this study, we investigated bile acid metabolism in ASBT-deficient (Asbt−/−) neonatal mice, reporting that ASBT plays a major role in limiting fecal bile acid loss and suppressing hepatic bile acid synthesis in early life. Furthermore, we illuminated a tissue-specific distinction in FXR-mediated regulation of bile acid synthesis in neonates, with an impaired ileal response but intact hepatic response.

Results

ASBT prevents fecal bile acid loss in early life despite low ileal ASBT expression.

Consistent with previous reports13,14, ASBT expression was strongly repressed in the ileum of wild-type neonatal C57BL/6 (B6) mice, with significant upregulation occurring only at weaning (Fig. 1a). Despite this minimal expression, Asbt−/− pups exhibited a 3.5-fold decrease in total serum bile acids (Fig. 1b) and a 4.0-fold increase in total fecal bile acids (Fig. 1c) at postnatal day 5 (P5) compared to wild-type controls. The increase in fecal bile acids correlated with elevated levels of multiple taurine-conjugated bile acids that we previously reported to be the most abundant bile acid species in neonatal stool20 (Fig. 1d). The marked reduction in serum bile acids and concomitant elevation in fecal bile acid levels in knockout pups demonstrates that ASBT regulates bile acid homeostasis in neonates despite its low ileal expression.

Figure 1. Bile acid homeostasis is regulated by ASBT early in life despite minimal ileal ASBT expression.

Figure 1.

Open in a new tab

a) Ileal tissue was collected from neonatal B6 mice at P0 (n = 7), P1 (n = 5), P3 (n = 5), P5 (n = 13), P7 (n = 10), P10 (n = 10), P14 (n = 9), and P21 (n = 5) and expression of ASBT was examined by quantitative RT-PCR. Each sample was tested in triplicate, and values were normalized to the GAPDH housekeeping gene. b) Serum collected from B6 and Asbt−/− litters at P5 (n = 7 litters per strain) was pooled and analyzed for total bile acids. c-d) Feces collected from B6 and Asbt−/− litters at P5 (n = 5 litters per strain) was pooled and analyzed for total bile acids (c) and 90 individual bile acids (d). For panel d, only data for bile acids detected above the limit of detection are shown. Each value represents a pooled litter. Statistical significance was calculated using unpaired Student’s t test for panels b-c and two-way ANOVA for panel d.

Neonatal ASBT limits hepatic bile acid synthesis gene expression early in life.

To determine whether increased fecal bile acids in the absence of ASBT were due to compensatory hepatic synthesis, we examined the expression of key bile acid synthesis genes in the livers of B6 and Asbt−/− pups throughout lactation. Key enzymes involved in the classical bile acid synthesis pathway – CYP7A1, CYP8B1, and CYP27A1 – displayed a biphasic pattern: expression was reduced at birth in Asbt−/− pups but became elevated by P5-P7 and remained elevated through weaning (Fig. 2a-c). Enzymes involved in bile acid conjugation, such as sterol carrier protein 2 (SCP2) and bile acid CoA:amino acid N-acyltransferase (BAAT), exhibited reduced expression at birth but stabilized to control levels postnatally and were slightly elevated at weaning (Fig. 2d-f). Thus, ASBT markedly limits hepatic bile acid synthesis gene expression early in life.

Figure 2. ASBT expression dynamically regulates bile acid synthesis early in life.

Figure 2.

Open in a new tab

a-f) Liver tissue was collected from neonatal B6 mice at P0 (n = 8), P5 (n = 14), P7 (n = 12), P14 (n = 9) and P21 (n = 5) and Asbt−/− mice at P0 (n = 5), P5 (n = 13), P7 (n = 5), P14 (n = 6) and P21 (n = 3) and expression of the indicated genes was examined by quantitative RT-PCR. Each sample was tested in triplicate, and values were normalized to the GAPDH housekeeping gene. Statistical analysis was performed using two-way ANOVA.

Hepatic, but not ileal, FXR-mediated regulation of bile acid synthesis is intact in early life.

FXR is a key regulator of bile acid synthesis, functioning through ileal FGF15-mediated and hepatic SHP-dependent inhibition of CYP7A121-24. We next examined whether reduced bile acid synthesis in B6 pups was driven by FXR-mediated negative regulation. Ileal FGF15 expression was not influenced by neonatal ASBT expression (Fig. 3a). However, hepatic SHP expression was significantly reduced in Asbt−/− pups compared to B6 controls (Fig. 3b), consistent with reduced serum bile acids (Fig. 1b) and elevated CYP7A1 expression (Fig. 2a). Overall, we conclude that ASBT regulates enterohepatic circulation of bile acids despite its strong repression in neonatal mice.

Figure 3. Hepatic, but not ileal, FXR-mediated regulation of bile acid synthesis is intact early in life.

Figure 3.

Open in a new tab

Ileal and liver tissue was collected from neonatal B6 mice (n = 8-17) and Asbt−/− mice (n = 19) at P5, and expression of the indicated genes was examined by quantitative RT-PCR. Each sample was tested in triplicate, and values were normalized to the GAPDH housekeeping gene. Statistical analysis was performed using two-way ANOVA with Tukey’s multiple comparison tests.

DISCUSSION

In adults, bile acid levels are tightly regulated through enterohepatic recycling and negative feedback loops. The intestinal bile acid transporter ASBT plays a key role in this process by actively transporting nearly all bile acids from the intestine back to the liver. Following transport, bile acid levels are sensed by FXR in intestinal epithelial cells, resulting in the induction of FGF15 which enters portal circulation to inhibit CYP7A1 expression in the liver. FXR also senses bile acid levels in the liver, resulting in expression of SHP which inhibits CYP7A1. Neonatal bile acid metabolism is distinct from that of adults, yet the mechanisms governing bile acid regulation during early life remain incompletely understood. A key gap in knowledge is how neonatal bile acid synthesis and reabsorption are coordinated to maintain homeostasis despite the developmental repression of intestinal ASBT13,14. Our study provides new insight into this process by demonstrating that ASBT plays a major role in suppressing hepatic bile acid synthesis and limiting fecal bile acid loss in neonates, even while its own expression in the intestine is developmentally downregulated.

Our findings suggest that ASBT is crucial for neonatal bile acid retention, preventing excessive depletion of the bile acid pool. The marked decrease in serum bile acids and increase in fecal bile acids observed in Asbt−/− pups highlights the importance of ASBT in maintaining bile acid balance during early life. While not examined directly in our study, the reduction in serum bile acids in Asbt−/− pups suggests that other components of ileal bile acid transport (e.g., IBABP and OSTa-OSTb) are functional early in life. In response to increased fecal bile acid loss in Asbt−/− pups, hepatic bile acid synthesis genes were significantly upregulated, suggesting a compensatory mechanism aimed at preserving bile acid homeostasis. This underscores ASBT’s role as a key regulator of bile acid metabolism in neonates.

Our results also illuminate a tissue-specific distinction in FXR-mediated sensing of bile acid levels in neonates. While there was no ASBT-dependent change in ileal FGF15 levels as would be expected upon FXR engagement of bile acids, there was significantly elevated SHP expression in B6 pups consistent with a role in suppressing CYP7A1 expression in response to elevated serum bile acid levels25-28. In addition to its well-characterized role in the intestine, ASBT is also expressed at lower levels in the kidney and bile ducts, where it functions to reclaim bile acids from urine and participate in cholehepatic shunting, respectively16,29-31. ASBT expression in the kidney is not developmentally regulated16,31, while its developmental regulation in the gallbladder has not been examined. The contribution of renal and biliary ASBT to bile acid homeostasis in neonates remains unclear but could play a role in our findings. Reduced bile acid reclamation from urine in Asbt−/− pups may exacerbate fecal bile acid loss and further stimulate hepatic synthesis. Additionally, impaired cholehepatic shunting could alter bile acid signaling within the liver, potentially contributing to the disruption of FXR-SHP regulation. Future studies should explore how ASBT function in these extra-intestinal sites influences neonatal bile acid metabolism.

In conclusion, our study demonstrates that ASBT-mediated bile acid retention is a key determinant of bile acid pool size and synthesis in early life. Further studies are needed to explore how ASBT interacts with other regulatory networks to maintain bile acid balance during this critical developmental period.

METHODS

Mice.

Specific pathogen-free (SPF) mice used in this study were bred and housed in animal facilities at the University of Florida. Neonatal mice at postnatal day P0 (P0) through P21 in approximately equal sex proportion were used in all experiments. All animal experiments were performed in strict accordance with federal and university guidelines and approved by the Institutional Animal Care and Use Committee at the University of Florida (study numbers 202300000338 and 202200000065). The conditions in animal rooms used in this study fall within the standards set by the “Guide for the Care and Use of Laboratory Animals.” C57BL/6J mice (Jackson no. 000664, referred to as B6) and C57BL/6NJ-Slc10a−/− mice32 (kindly provided by Paul Dawson, Emory University; referred to as Asbt−/−) mice were used.

RNA extraction and quantitative RT-PCR.

RNA was extracted from liver and ileal tissue collected from B6 and Asbt−/− mice at indicated time points using the RNeasy Plus Kit (Qiagen), treated with Turbo DNase (Invitrogen), and 1 μg RNA was used for cDNA synthesis with the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher). Quantitative PCR (qPCR) was performed using the SYBR Green Master Mix (ThermoFisher) using primers specific to: ASBT (F: TTGCCTCTTCGTCTACACC, R: CCAAAGGAAACAGGAATAACAAG), CYP7A1 (F: GAAGCAATGAAAGCAGCCTC, R: GTAAATGGCATTCCCTCCAG), CYP8B1 (F: AGTACACATGGACCCCGACATC, R: GGGTGCCATCCGGGTTGAG), CYP27A1 (F: ACAAGGCTATGTGCTGCACTTG, R: TGATCCATGTGGTCTCTTATTG), SCP2 (F: TTGGTTCTGCAAAGCCTCAGT, R: CAATGCCTTCTGGCCTGCTTC), BACL (F: TGTAACGTCCCTGAGCAACC, R: TAAGCCCACATTGCCCTCTG), BAAT (F: GGTTGCTGTAAAACTACTGTTTTGG, R: TGTGCACAGGCTCATCAACA), FGF15 (F: CCAACTGCTTCCTCCGAATCC, R: TACAGTCTTCCTCCGAGTAGC), SHP (F: CAGCGCTGCCTGGAGTCT, R: AGGATCGTGCCCTTCAGGTA), LRH-1 (F: CCCTGCTGGACTACACGGTTT, R: CGGGTAGCCGAAGAAGTAGCT), HNF4A (F: CCAAGAGGTCCATGGTGTTTAAG, R: GTGCCGAGGGACGATGTAGT), and GAPDH housekeeping gene (F: CATGGCCTTCCGTGTTCCTA, R: CCTGCTTCACCACCTTCTTGAT). Each sample was analyzed in triplicate reactions, and the expression of target genes was normalized to GAPDH.

Total bile acid quantification.

Neonatal feces were collected from P5 mice, pooled per litter, and stored at −80°C. Pooled fecal samples were resuspended in 3 μL of ultra-pure water per 1 mg of feces, vortexed, centrifuged at 12,000 rpm for 10 min, and supernatants diluted 1:125 prior to analysis. Neonatal blood was collected from P5 mice, serum was prepared by centrifuging in serum separator tubes, pooled per litter, and diluted 1:5 prior to analysis. Total bile acids were quantified using the Total Bile Acids Assay Kit (Millipore Sigma, Cat # MAK309) according to the manufacturer’s protocol. Samples were tested in duplicate and compared to standard curves.

Bile acid profiling.

For mouse fecal bile acid profiling, stool was collected from P5 neonatal mice and pooled. Each sample was mixed with 20 μL of acetonitrile per mg of raw material. The samples were then homogenized on a MM 400 mixer mill at 30 Hz for 3 min, followed by sonication for 3 min in an ice-water bath. The samples were centrifuged at 21,000 g for 10 min. 20 μL of the clear supernatant of each sample was mixed with 180 μL of the internal standard solution. The mixture was loaded onto a reversed-phase solid-phase extraction cartridge (60mg/1mL). After sample loading under a positive pressure, the cartridge was washed with 2 mL of water. Bile acids were eluted with 1 mL of methanol under positive pressure. The collected fraction was dried in a nitrogen gas evaporator. The residue was reconstituted in 40 μL of 50% acetonitrile. 10 μL aliquots of each fecal sample solution and each of the calibration solutions were then injected into an Agilent 1290 UHPLC system coupled to an Agilent 6495B QQQ mass spectrometer. The MS instrument was operated in the multiple-reaction monitoring (MRM) mode with negative ion detection. A Waters C18 column (2.1*150 mm, 1.7 μm) was used for LC separation and the mobile phase was 0.01% formic acid in water and in acetonitrile for binary-solvent gradient elution. A mixed solution of all the targeted bile acids at 10 μM of each compound was prepared in an internal standard solution of 14 deuterium-labeled bile acids in 50% acetonitrile. This solution was further diluted step by step to have 10 calibration solutions. Linear-regression calibration curves of individual bile acids were constructed with the data acquired from injection of the serially diluted calibration solutions. Concentrations of bile acids detected in the samples were calculated by interpolating the calibration curves of individual bile acids with the analyte-to-internal standard peak area ratios measured from injection of the sample solutions. Bile acid profiling was performed by Creative Proteomics.

Statistical analysis.

All data were analyzed with GraphPad Prism software. P values were determined using unpaired Student’s t tests or two-way ANOVA with corrections for multiple comparisons. Error bars denote standard errors of mean in all figures.

Acknowledgements

This work was supported by the National Institutes of Health (NIH) grants R01AI162970 (S.M.K.), R56AI141478 (S.M.K.), T32AI007110 (J.M.A.), and F30AI172364 (A.M.P.). The data from this study are tabulated in the main paper. All reagents are available from S.M.K. under a material transfer agreement with the University of Florida. The graphical abstract was created using BioRender (Created in BioRender. Peiper, A. (2025) https://BioRender.com/6oiw7py).

REFERENCES

  • 1.Mohanty I, Allaband C, Mannochio-Russo H, El Abiead Y, Hagey LR, Knight R, Dorrestein PC. The changing metabolic landscape of bile acids – keys to metabolism and immune regulation. Nat Rev Gastroenterol Hepatol. Nature Publishing Group; 2024. Apr 4;1–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Su X, Gao Y, Yang R. Gut microbiota derived bile acid metabolites maintain the homeostasis of gut and systemic immunity. Front Immunol. 2023. May 15;14:1127743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mohammed AD, Ball RAW, Kubinak JL. The interplay between bile acids and mucosal adaptive immunity. PLOS Pathog. 2023. Jun 22;19(6):e1011356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bertolini A, Fiorotto R, Strazzabosco M. Bile acids and their receptors: modulators and therapeutic targets in liver inflammation. Semin Immunopathol. 2022. Jul;44(4):547–564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fogelson KA, Dorrestein PC, Zarrinpar A, Knight R. The Gut Microbial Bile Acid Modulation and Its Relevance to Digestive Health and Diseases. Gastroenterology. 2023. Jun;164(7):1069–1085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ridgway N, McLeod R. Biochemistry of Lipids, Lipoproteins and Membranes. 7th ed. Elsevier; 2021. [Google Scholar]
  • 7.Qi L, Tian Y, Chen Y. Circulating Bile Acid Profiles: A Need for Further Examination. J Clin Endocrinol Metab. 2021. Nov 1;106(11):3093–3112. [DOI] [PubMed] [Google Scholar]
  • 8.Angelin B, Björkhem I, Einarsson K, Ewerth S. Hepatic Uptake of Bile Acids in Man. J Clin Invest. 1982. Oct;70(4):724–731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wang S, Xu C, Liu H, Wei W, Zhou X, Qian H, Zhou L, Zhang H, Wu L, Zhu C, Yang Y, He L, Li K. Connecting the Gut Microbiota and Neurodegenerative Diseases: the Role of Bile Acids. Mol Neurobiol. 2023. Aug 1;60(8):4618–4640. [DOI] [PubMed] [Google Scholar]
  • 10.Guan B, Tong J, Hao H, Yang Z, Chen K, Xu H, Wang A. Bile acid coordinates microbiota homeostasis and systemic immunometabolism in cardiometabolic diseases. Acta Pharm Sin B. 2022. May;12(5):2129–2149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Sah DK, Arjunan A, Park SY, Jung YD. Bile acids and microbes in metabolic disease. World J Gastroenterol. 2022. Dec 28;28(48):6846–6866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Shulpekova Y, Zharkova M, Tkachenko P, Tikhonov I, Stepanov A, Synitsyna A, Izotov A, Butkova T, Shulpekova N, Lapina N, Nechaev V, Kardasheva S, Okhlobystin A, Ivashkin V. The Role of Bile Acids in the Human Body and in the Development of Diseases. Molecules. 2022. May 25;27(11):3401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Craddock AL, Love MW, Daniel RW, Kirby LC, Walters HC, Wong MH, Dawson PA. Expression and transport properties of the human ileal and renal sodium-dependent bile acid transporter. Am J Physiol. 1998. Jan;274(1):G157–169. [DOI] [PubMed] [Google Scholar]
  • 14.Shneider BL, Setchell KDR, Crossman MW. Fetal and Neonatal Expression of the Apical Sodium-Dependent Bile Acid Transporter in the Rat Ileum and Kidney. Pediatr Res. Nature Publishing Group; 1997. Aug;42(2):189–194. [DOI] [PubMed] [Google Scholar]
  • 15.Hwang ST, Henning SJ. Ontogenic regulation of components of ileal bile acid absorption. Exp Biol Med Maywood NJ. 2001. Jul;226(7):674–680. [DOI] [PubMed] [Google Scholar]
  • 16.Christie DM, Dawson PA, Thevananther S, Shneider BL. Comparative analysis of the ontogeny of a sodium-dependent bile acid transporter in rat kidney and ileum. Am J Physiol. 1996. Aug;271(2 Pt 1):G377–385. [DOI] [PubMed] [Google Scholar]
  • 17.Chen F, Shyu AB, Shneider BL. Hu antigen R and tristetraprolin: Counter-regulators of rat apical sodium-dependent bile acid transporter by way of effects on messenger RNA stability. Hepatology. 2011;54(4):1371–1378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Little JM, Lester R. Ontogenesis of intestinal bile salt absorption in the neonatal rat. Am J Physiol. 1980. Oct;239(4):G319–G323. [DOI] [PubMed] [Google Scholar]
  • 19.Cheng Q, Inaba Y, Lu P, Xu M, He J, Zhao Y, Guo GL, Kuruba R, de la Vega R, Evans RW, Li S, Xie W. Chronic Activation of FXR in Transgenic Mice Caused Perinatal Toxicity and Sensitized Mice to Cholesterol Toxicity. Mol Endocrinol. 2015. Apr;29(4):571–582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Peiper AM, Morales J, Hu Z, Phophi L, Helm EW, Rubinstein RJ, Phillips M, Williams CG, Subramanian S, Cross M, Iyer N, Nguyen Q, Newsome RC, Jobin C, Langel SN, Bucardo F, Becker-Dreps S, Tan XD, Dawson PA, Karst SM. Metabolic immaturity of newborns and breast milk bile acids are central determinants of heightened neonatal vulnerability to norovirus diarrhea. Cell Host Microbe. 2024;32(9):1488–1501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Fleishman JS, Kumar S. Bile acid metabolism and signaling in health and disease: molecular mechanisms and therapeutic targets. Signal Transduct Target Ther. Nature Publishing Group; 2024. Apr 26;9(1):1–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, Hull MV, Lustig KD, Mangelsdorf DJ, Shan B. Identification of a nuclear receptor for bile acids. Science. 1999. May 21;284(5418):1362–1365. [DOI] [PubMed] [Google Scholar]
  • 23.Tu H, Okamoto AY, Shan B. FXR, a Bile Acid Receptor and Biological Sensor. Trends Cardiovasc Med. 2000. Jan 1;10(1):30–35. [DOI] [PubMed] [Google Scholar]
  • 24.Chiang JYL, Ferrell JM. Up to date on cholesterol 7 alpha-hydroxylase (CYP7A1) in bile acid synthesis. Liver Res. 2020. Jun 1;4(2):47–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Dawson PA. Roles of Ileal ASBT and OSTα-OSTβ in Regulating Bile Acid Signaling. Dig Dis Basel Switz. 2017;35(3):261–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ballatori N, Fang F, Christian WV, Li N, Hammond CL. Ostα-Ostβ is required for bile acid and conjugated steroid disposition in the intestine, kidney, and liver. Am J Physiol-Gastrointest Liver Physiol. American Physiological Society; 2008. Jul;295(1):G179–G186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Rao A, Haywood J, Craddock AL, Belinsky MG, Kruh GD, Dawson PA. The organic solute transporter α-β, Ostα-Ostβ, is essential for intestinal bile acid transport and homeostasis. Proc Natl Acad Sci. Proceedings of the National Academy of Sciences; 2008. Mar 11;105(10):3891–3896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ferrebee CB, Li J, Haywood J, Pachura K, Robinson BS, Hinrichs BH, Jones RM, Rao A, Dawson PA. Organic Solute Transporter α-β Protects Ileal Enterocytes From Bile Acid–Induced Injury. Cell Mol Gastroenterol Hepatol. 2018. Jan 12;5(4):499–522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Krones E, Pollheimer MJ, Rosenkranz AR, Fickert P. Cholemic nephropathy – Historical notes and novel perspectives. Biochim Biophys Acta BBA - Mol Basis Dis. 2018. Apr 1;1864(4, Part B):1356–1366. [DOI] [PubMed] [Google Scholar]
  • 30.Abbas A. Toxicity of Bile Salts in Mice: Liver-Kidney Axis [Internet]. [Egypt: ]: South Valley University; 2019. [cited 2025 Feb 2]. Available from: https://www.researchgate.net/publication/340279249_AYA_THESIS [Google Scholar]
  • 31.Shneider BL, Setchell KDR, Crossman MW. Fetal and Neonatal Expression of the Apical Sodium-Dependent Bile Acid Transporter in the Rat Ileum and Kidney. Pediatr Res. Nature Publishing Group; 1997. Aug;42(2):189–194. [DOI] [PubMed] [Google Scholar]
  • 32.Truong JK, Li J, Li Q, Pachura K, Rao A, Gumber S, Fuchs CD, Feranchak AP, Karpen SJ, Trauner M, Dawson PA. Active enterohepatic cycling is not required for the choleretic actions of 24-norUrsodeoxycholic acid in mice. JCI Insight. 8(6):e149360. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES