Investigating the effects of pcDNA3 polybia-MP1 on the apoptosis induction in lung cancer cell line

Abstract

Polybia-MP1 is an antimicrobial peptide (AMP) with significant anticancer efficacy. The aim of this study is to investigate the changes in the expression levels of the long non-coding RNAs (lncRNAs) MALAT1, LUCAT1, and BANCR in lung cancer cells after stimulation with pDNA/Polybia-MP1 complexes. This research seeks to understand the molecular mechanisms underlying Polybia-MP1’s anticancer effects, specifically focusing on the involvement of these lncRNAs in lung cancer pathology and treatment response. The nucleic acid sequence of polybia-MP1 was inserted into the pcDNA3.1(+) Mammalian Expression Plasmid. The correctness of cloning was evaluated using PCR and enzyme digesting methodologies. The vectors were introduced into cells by transfection using LipofectamineTM2000. The A549 cancer cells were assessed using flow cytometry and wound healing studies. The expression levels of lncRNAs and apoptotic genes were evaluated using real-time PCR, with a significance threshold of P < 0.05. The pDNA/polybia-MP1 vector was effectively produced, and the gene sequence exhibited absolute consistency (100% similarity) with the polybia-MP1 gene. The proportions of early apoptosis, late apoptosis, necrosis, and viable A549 cells in the pDNA/polybia-MP1 group were 26%, 17%, 3%, and 54%, respectively. The RT-PCR analysis revealed that the introduction of pDNA/polybia-MP1 into A549 cells led to a reduction in the expression of PCA3, MALAT1, and LUCAT1 lncRNAs, as compared to the control group treated with PBS. Moreover, it increased the transcription of BANCR long non-coding RNA. The results showed a significant increase in the activity of transcription factors involved in programmed cell death after treatment with pDNA/polybia-MP1 (**P < 0.01). The study’s findings suggest that pDNA/polybia-MP1 has the potential to significantly alter gene transcription in cancer cells, particularly concerning lncRNAs engaged in cell apoptotic pathways. The pDNA/polybia-MP1 compound, with its potent anticancer properties, has the capacity to induce apoptosis in cells, thereby offering a promising avenue for cancer treatment.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-13439-9.

Introduction

Lung cancer has significant global prevalence and fatality rates and is categorized into small-cell lung cancer or non-small cell lung cancer (NSCLC) based on its histological features^1,2. NSCLC is the predominant form, representing about 80 to 85% of all occurrences^1,3. Despite improvements in therapy, the outlook for NSCLC remains unfavorable⁴. Therefore, it is crucial to identify genetic biomarkers associated with tumorigenic pathways that may facilitate early detection and prompt treatment^4–6.

Long noncoding RNAs (lncRNAs), characterized as RNA molecules longer than 200 nucleotides that do not encode proteins, are becoming essential regulators in cellular life and disease^6,7. These molecules can perform several regulatory activities, including modulating mRNA interactions and acting as precursors for other noncoding RNAs, such as microRNAs^8–10. lncRNAs are increasingly acknowledged for their roles in several cancer-related signaling pathways, often displaying oncogenic or tumor-suppressive properties. Their abnormal expression has been associated with the onset and advancement of several malignancies, such as lung, liver, brain, and breast cancers, rendering them appealing candidates for molecular biomarkers in diagnosis and prognosis^10–12. Specific lncRNAs identified in peripheral blood, urine, or tissue samples have demonstrated potential as independent or adjunct cancer biomarkers. MALAT1, LUCAT1, and BANCR are among the most extensively researched, each having defined roles in lung cancer^11–13. Nuclear lncRNA MALAT1 (Metastasis-Associated Lung Adenocarcinoma Transcript 1), an 8,700-nucleotide entity located on chromosome 11q13.1, is highly conserved and frequently upregulated in non-small cell lung cancer (NSCLC), facilitating tumorigenesis, cellular proliferation, metastasis, and apoptosis inhibition through interactions with miRNAs and anti-apoptotic proteins^14–16. MALAT1 additionally plays a role in cisplatin resistance^17–19. Likewise, LUCAT1, a newly discovered lncRNA, is often upregulated in lung and other cancers, and its inhibition markedly impedes tumor proliferation both in vitro and in vivo^20–22. BRAF-activated noncoding RNA (BANCR), a 693 base-pair lncRNA located on chromosome 9, exhibits a dual role as either an oncogene or a tumor suppressor contingent upon the cancer type; in lung cancer, its elevated expression correlates with lymph node metastasis and diminished patient survival^23–25.

Simultaneously, peptide-based therapies have garnered considerable interest in cancer therapy, with venom-derived peptides demonstrating notable potential due to their diminutive size, tumor-penetrating capacities, and specific anticancer properties^26–28. One peptide of interest is Polybia-MP1, derived from the Brazilian wasp Polybia paulista. Initially acknowledged for its extensive antibacterial properties without adversely affecting red blood cells, Polybia-MP1 has exhibited significant anticancer effectiveness^27–29. The process entails selective attachment to anionic lipid vesicles typical of cancer cell membranes, resulting in hole formation and consequent cell necrosis while demonstrating reduced toxicity towards normal, zwitterionic membranes. Polybia-MP1 demonstrates selective activity against multiple cancer cell lines, including prostate, bladder, leukemia, and glioblastoma^30,31. Nonetheless, its systemic injection in mice has demonstrated significant adverse effects, including renal failure and hemolysis, presenting a hurdle for in vivo application. Nonetheless, Polybia-MP1’s distinctive capacity to directly engage with cancer cell membranes and induce apoptosis indicates that it may elicit downstream cellular responses beyond cytotoxicity^32,33.

Given the critical regulatory roles of lncRNAs in cancer progression and the distinct membrane-disrupting and cytotoxic mechanisms of Polybia-MP1, it is plausible that the interaction of this peptide with cancer cells could influence the expression of key oncogenic or tumor-suppressive lncRNAs. Although no direct evidence currently links Polybia-MP1 to lncRNA regulation, its profound impact on cancer cell viability and membrane integrity may initiate signaling cascades that modulate gene expression, including that of lncRNAs. Understanding such indirect effects is crucial for a comprehensive understanding of Polybia-MP1’s therapeutic potential. Therefore, this study aimed to investigate the influence of Polybia-MP1, particularly in a plasmid-delivered format (pDNA/Polybia-MP1), on the gene expression regulation of the crucial lncRNAs MALAT1, LUCAT1, and BANCR in lung cancer cells, to elucidate potential novel molecular mechanisms underlying its anticancer effects.

Polybia-MP1, a promising toxin, holds potential for influencing gene expression in specific cancers. This study specifically investigated how Polybia-MP1 affects the regulation of the lncRNAs MALAT1, LUCAT1, and BANCR in lung cancer cells. We chose these particular lncRNAs due to their established roles in lung cancer progression, proliferation, and metastasis. By examining their response to Polybia-MP1, we aim to uncover novel molecular mechanisms by which this peptide exerts its anticancer effects. Our findings will provide empirical evidence supporting Polybia-MP1’s potential as a therapeutic agent for lung cancer, offering insights into its direct impact on key regulatory pathways associated with the disease.

Materials and methods

Bioinformatics methodology for polybia-MP1 characterization

To characterize Polybia-MP1, a series of bioinformatics analyses were conducted. The peptide’s theoretical physical and chemical attributes, including its scaled solubility and isoelectric point (pI), were predicted using computational tools. The structural integrity of the peptide model was assessed through various analyses, including a Ramachandran plot to evaluate dihedral angles and the QMEANDisCo Global score to validate the overall spatial structure. To confirm the successful construction of the recombinant plasmid, its sequence was subjected to a similarity search using the Blast algorithm against public databases, such as GenBank, to ensure high resemblance to the Polybia-MP1 protein. Furthermore, the presence of the specific Polybia-MP1 amino acid sequence was verified. Finally, a comprehensive set of physiochemical properties for the Polybia-MP1 protein were retrieved and documented from online protein analysis platforms, such as Expasy ProtParam.

Plasmid construction

The nucleic acid sequence was generated by the GENEray company (GENEray, China) and then inserted into the pcDNA3.1(+) Mammalian Expression Plasmid (GENEray, China). The peptide sequence of Polybia-MP1 was acquired from the NCBI website using the accession number P0C1Q4.1. Subsequently, the peptide sequence was converted into nucleic acid utilizing the Reverse Translate website (https://www.bioinformatics.org/sms2/rev_trans.html). The oligodeoxynucleotides of Polybia-MP1 were inserted between the restriction enzymes ECOR1 (G^AATT_C) and Xba1 (T^CTAG_A) in a sandwich-like arrangement.

Confirmation of the cloning

A polymerase chain reaction (PCR) procedure was performed utilizing appropriate primers. PCR reactions were performed using the manufacturer’s protocol (ZistYar Sanat, Iran; http:/zys-group.ir/). PCR amplification involved 30 cycles (94 °C for 40s, 60 °C for 40s, 72 °C for 40s) after an initial 95 °C/5min denaturation, followed by a final 72 °C/5min extension, with products visualized on a 1% agarose gel and the recombinant vector subsequently digested with ECOR1 and Xba1 for sequencing (GENEray, China).

Propagation of recombinant plasmid

The Cacl₂ method was employed to introduce all plasmids into E. coli TOP10F. The selection of altered recombinant bacteria was determined using certain antibiotic concentrations: The optimal ampicillin concentration for E. coli is 100 µg/ml. The modified genetically engineered bacteria were preserved at a temperature of − 20 °C.

Extraction of replicated plasmid from bacterial cells

Plasmid purification was performed using the Favorgen Endo-free Plasmid DNA Extraction kit (Favorgen, Taiwan), following the manufacturer’s protocol, with the quality of the extracted DNA assessed by electrophoresis on a 1% agarose gel before storage at -20 °C. The final plasmid concentration and its purity, as indicated by the A260/A280 ratio, were determined using a Nanodrop spectrophotometer.

Cell culture and transfection

The A549 human cancers and HLF cells were initially obtained from Parsian BioProducts (Shahrekord, Iran). All cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS) and pen/strep antibiotic supplements unless otherwise noted. The culture was incubated at 37 °C in a humidified incubator with an atmosphere of 95% air and 5% carbon dioxide (CO₂). The lipofections were performed by introducing 3 × 10⁵ cells into six-well tissue culture plates with 1 µg of the appropriate plasmid. By the manufacturer’s instructions, this was accomplished by employing the Lipofectamine 2000 reagent from Invitrogen, Carlsbad, CA. Colony selection was used to create stable cell lines, and a 500 µg/ml G418 concentration from Invitrogen was used for two weeks. During the selection process, the cultural media experienced daily fluctuations. The cell proliferation rate assessment involved placing 5 × 10⁶ cells (unless specified differently) on six-well plates. After 4 days, the cells were observed and quantified using a light microscope, employing the Trypan-Blue exclusion experiment. we assessed transfection efficiency by the percentage of cells that exhibit gene expression within a single cell population. Flow cytometry method that parses the distribution of gene expression in a pool of cells was used to calculate transfection efficiency.

Transfection Efficiency = Number of Expressing Cells ÷ Total Number of Cells.

In vitro proliferation assay

Cells were inoculated onto 24-well plates at a density of 3 × 10⁵ cells/well in 0.5 mL of complete medium and incubated at 37 °C with 5% CO2. The subjects were subsequently administered pDNA/Polybia-MP1, free Polybia-MP1, pcDNA3.1, or PBS at a dosage of 100, 50, 25, 12.5, 6.25, 3.125, and 1.56 µg/mL for 24 h. Cell viability was evaluated with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma Aldrich) solution at a final concentration of 0.5 mg/mL, incubated for 4 h at 37 °C. Following the removal of the medium, the formazan crystals were solubilized in DMSO, and absorbance was quantified at 570 nm. The absorbance from wells containing only medium and MTT (blanks) was removed from all samples to adjust for non-specific coloration.

Flow cytometric assays

The Annexin-V/PI test assessed the apoptotic activation of A549 cancer cells and HLF cells. The apoptosis ratio of A549 cancer cells and HLF cells was evaluated by subjecting them to pDNA/polybia-MP1, polybia-MP1, pcDNA3.1, and PBS. The cells were subsequently examined utilizing an Annexin V/propidium iodide (PI) assay based on the instructions provided by the manufacturer. To summarize, the cells were suspended again in a solution called 1X binding buffer after being washed twice with cold PBS. The concentration of cells per well was 5 × 106 cells. Afterwards, the solution was transferred into a culture tube with a 5 ml capacity, resulting in a final volume of 100 µl. 5 µl of FITC Annexin V and 5 µl of PI were added to the tubes. It is advised to use a mild swirling motion, followed by 15 min of keeping the sample in a dark environment at a temperature of 25 °C. The tubes were supplied with 400 µl of 1X binding buffer. The study utilized flow cytometry for one hour. The cells that were not treated were employed as a control in the experiment.

Cell cycle analysis

For cell cycle analysis, cells were fixed in 100% ethanol for 24 h, washed twice with PBS, and then stained for 15 min with PI/RNase staining solution (BD Bioscience Pharmingen). The DNA content of the cell population was determined using FACS flow cytometry, acquiring at least 20,000 events per sample. A standard gating strategy was employed, initially excluding doublets based on FSC-A vs. FSC-H and then gating on single cells. Cell cycle phases (G0/G1, S, G2/M) were then identified based on DNA content using PI fluorescence. The cell cycle data was subsequently analyzed utilizing FlowJo V10 software (Tree Star, Ashland, OR).

Transcription of apoptosis-related genes by quantitative real-time PCR

This work utilized a quantitative real-time PCR approach with SYBR green detection to evaluate MALAT1, LUCAT1, BANCR, P53, BAX, BCL2, and AKT3 transcription levels. The RNA was isolated using the RNX TM-PLUS method (sinaclon, Iran) following the manufacturer’s instructions. Subsequently, the process of cDNA synthesis was carried out utilizing the Parsian BioProducts Manufacturers Kit (PBP, Iran). Quantitative real-time PCR was performed using the SYBR^® Premix Ex TaqTM II kit (Takara, Japan) and particular primers (Table 1), following the instructions provided by the manufacturer. The relative gene transcription levels were quantified by normalizing the expression of each gene to the reference gene GAPDH. The experiments were carried out on two distinct occasions.

Table 1.

List of specific primers used in this research.

Gene	Primer	Sequence (5’→3’)	TM (°C)	Product size (bp)
LUCAT1	LUC-F LUC-R	AGATGGATAAACAGAGGCAACCC GTGAGGGGATGAGAATACTGGC	60	104
BANCR	BAN-F BAN-R	GAAGGGACAATACTGAAGAGAC GCCACTCCACTCAGCACCC	60	196
MALAT1	MAL-F MAL-R	TAGATAAAACCACTCAAACTCTGC TTATGCCTGGTTAGGTATGAGC	60	112
P53	P53-F P53-R	GGCCCACTTCACCGTACTAA GTGGTTTCAAGGCCAGATGT	60	156
BAX	BAX -F BAX -R	TCTGACGGCAACTTCAACTG TTGAGGAGTCTCACCCAACC	60	188
BCL2	BCL2-F BCL2-R	AAGGGGGAAACACCAGAATC ATCCTTCCCAGAGGAAAAGC	60	180
AKT3	AKT3-F AKT3-R	CAGTAGACTGGTGGGGCCTA ATCAAGAGCCCTGAAAGCAA	60	169
GAPDH	GDH-F GDH-R	GCCAAAAGGGTCATCATCTCTGC GGTCACGAGTCCTTCCACGATAC	60	183

Statistical analysis

The data were examined and subjected to statistical analyses using GraphPad Prism 5.0. The data provided included the average and the measure of variability known as the standard deviation. A unidirectional analysis of variance (ANOVA) was employed to compare the means, followed by a Tukey-Kramer post hoc analysis with a 95% confidence interval. The differences were statistically significant at p ≤ 0.05 and highly significant at p ≤ 0.01. The study utilized a minimum of three biological replicates, with each biological replicate containing three technical replicates.

Results

Generating and identifying recombinant pDNA/polybia-MP1

The construction of the recombinant pDNA/polybia-MP1 plasmid involved incorporating the polybia-MP1 gene into the pcDNA3.1(+) expression plasmid (Fig. 1A). The genetic structure of the recombinant plasmid was used to assess the effectiveness of the cloning technique. Furthermore, the gene sequence of the engineered plasmid displayed absolute similarity, as verified through DNA sequencing, with the polybia-MP1 gene. The plasmid was digested utilizing the restriction enzymes ECOR1 and Xba1. The synthesis of the recombinant plasmid was validated using an electrophoretic technique to differentiate the fragments resulting from the digestion of the polybia-MP1 gene.

Fig. 1.

Molecular characterization and structural prediction of the pDNA-Polybia-MP1 construct. (A) Plasmid map of pDNA-Polybia-MP1. (B) Predicted solubility of the Polybia-MP1 peptide. The bar chart compares the calculated solubility value of the query Polybia-MP1 peptide (QuerySol) against the average solubility of typical proteins (PopAvrSol). The red line indicates a solubility threshold of 0.45, suggesting the peptide’s potential for soluble expression. (C) Predicted three-dimensional structure of the Polybia-MP1 peptide. (D) Disulfide bond formation and problematic residues in Polybia-MP1. This structural representation highlights specific residues (A37 ASP, A31 ASP, B28 ILE, B37 ASP) that might be involved in potential disulfide bond formation or represent areas of structural strain. (E) Ramachandran plot analysis of the predicted Polybia-MP1 peptide structure. This plot displays the distribution of the ϕ (phi) and ψ (psi) dihedral angles for each amino acid residue in the predicted Polybia-MP1 structure. The green shaded regions represent favored and allowed conformational regions, with individual residues plotted as points, indicating the structural stability and quality of the predicted model. (F) Procheck analysis and model quality assessment. This plot compares the overall quality (GMEAN4 score) of the predicted Polybia-MP1 peptide model (indicated by a red star) against a non-redundant set of known PDB structures of varying protein sizes (residues). The position of the red star within the distribution provides an indication of the model’s reliability and agreement with validated structures. Z-scores indicate the deviation from the average quality of comparable structures.

Polybia-MP1 peptide characterization

Figure 1B displayed the expected scaled solubility, which was found to be 0.787, along with the isoelectric point (pI) value of 10.090. In addition, the arrangement of the fusion peptide is illustrated in Fig. 1C. The diagram by Ramachandran displayed no bad bonds and just 6 bad angles out of 818 angles (6/818) (Fig. 1D). The peptide’s Ramachandran Plots were displayed in Fig. 1E, demonstrating a Ramachandran Favored score of 100.00%. This indicates that the model has an adequate spatial structure. The peptide structural model was validated using QMEANDisCo Global, which yielded a score of 0.11 ± 0.68 (Fig. 1F). Since QMEAN is below 0.3 (0.11 ± 0.68), it means that the model is not of very good quality and this model has some limitations. The results of the sequencing of the recombinant plasmid were assessed utilizing the Blast algorithm. The blast analysis showed that the recombinant plasmids had a query cover of 100% and a Per. Ident of 100.00%, indicating a high resemblance to the polybia-MP1 protein (GenBank: P0C1Q4.1). The protein sequence analysis detected the existence of the sequence MIDWKKLLDAAKQIL. The website expasy/protparam (https://web.expasy.org) presented and documented a multitude of physical and chemical attributes of the Polybia-MP1 protein in Table 2.

Table 2.

Calculating different physical and chemical characteristics for Recombinant Polybia-MP1 peptide recorded in expasy/protparam.

Symbol		Polybia-MP1
Sequence		MIDWKKLLDAAKQIL
Formula		C83H140N20O21S1
Total number of atoms		265
Number of amino acids		15
Molecular weight		1786.21Da
Theoretical pI		8.25
Total number of negatively charged residues (Asp + Glu)		2
Total number of positively charged residues (Arg + Lys)		3
Estimated half-life	mammalian reticulocytes, in vitro	30 h
	yeast, in vivo	> 20 h
	Escherichia coli, in vivo	> 10 h
Aliphatic index		143.33
Extinction coefficients		5500
Grand average of hydropathicity (GRAVY)		0.187

Recombinant pDNA/polybia-MP1/E. coli was successfully performed

The introduction of the recombinant constructs into the bacterium using co-transfection generated Fig. 2. Plasmid extraction was performed on bacterial cells, and the findings on agarose gel demonstrated the efficacy of the plasmid extraction process. Furthermore, the nanodrop device yielded a plasmid concentration of 540 ng/µl.

Fig. 2.

Bacterial Transformation with Recombinant pDNA-Polybia-MP1. This image displays the results of E. coli bacterial transformation. The petri dish on the left, labeled “PC Polybia,” shows bacterial colonies successfully transformed with the recombinant pDNA-Polybia-MP1 plasmid, indicating successful uptake and expression of the construct. The petri dish on the right, labeled “NC” (Negative Control), shows no colony growth, confirming the effectiveness of the selection process and the absence of contamination or spontaneous resistance.

Cytotoxicity assays

A study evaluated the cytotoxic effects of various formulations on A549 and control HLF cells. This work employed the MTT test to examine the potential anticancer effects of different formulations on A549 and control HLF cell lines. No adverse effects of the various formulations on the control HLF cell lines were seen within the range of dilutions examined. According to the current findings, it was demonstrated that the pDNA/polybia-MP1 and polybia-MP1 did not cause any detrimental effects when applied to control HLF cell lines within the tested dilution ranges (Fig. 3). The study’s results suggest that pDNA/polybia-MP1 and polybia-MP1 had anticancer capabilities. This is supported by the discovery that A549 cells demonstrated survival rates of 28% and 43% when exposed to pDNA/polybia-MP1 and polybia-MP1, respectively. The results demonstrate a significant decrease in the viability of A549 cells when treated with pDNA/polybia-MP1 (P ≤ 0.01) (Fig. 3). Polybia-MP1 and its pDNA/Polybia-MP1 complex exhibited selective cytotoxicity, demonstrating no adverse effects on normal cells while effectively reducing the viability of A549 lung cancer cells. Notably, the IC50 values for Polybia-MP1 and pDNA/Polybia-MP1 in A549 cells were determined to be 50 µg/ml and 25 µg/ml, respectively (Fig. 3).

Fig. 3.

MTT test to examine the potential anticancer effects of PBS, free pDNA, polybia-MP1 and pDNA/polybia-MP1 on HLF and A549 cell lines. ANOVA test was performed for this test. *p ≤ 0.05, and **p ≤ 0.01.

Cancer cells are susceptible to apoptosis induced by pDNA/polybia-MP1

The apoptotic activity of each group (PBS control, Free pDNA, polybia-MP1, and pDNA/polybia-MP1) in A549 and HLF cell lines was evaluated by staining them with Annexin V-PI to determine their propensity for programmed cell death. Figure 4A depicts the percentage of cells that have undergone early apoptosis, late apoptosis, necrosis, or remain viable. The percentages of early apoptosis, late apoptosis, and necrotic cells were less than 15% in the A549 cancer cells when exposed to the PBS control and Free pDNA treatment. Nevertheless, the proportion of viable cells surpassed 85%. The A549 cells exhibited a distribution of 14% early apoptosis, 12% late apoptosis, 6% necrosis, and 68% viable cells with the administration of polybia-MP1. As demonstrated in Fig. 4A, the A549 cells treated with pDNA/polybia-MP1 showed a distribution of 26% early apoptosis, 17% late apoptosis, 3% necrosis, and 54% viable cells (P ≤ 0.01). When the HLF cells were subjected to the PBS control and Free pDNA treatment, the proportions of early apoptosis, late apoptosis, and necrotic cells were below 10%. However, the percentage of viable cells exceeded 90%. Upon treatment with polybia-MP1, the HLF cells displayed a distribution of 8% early apoptosis, 6% late apoptosis, 6% necrosis, and 80% viable cells. Figure 4A illustrates that the HLF cells, when treated with pDNA/polybia-MP1, exhibited 9% early apoptosis, 4% late apoptosis, 8% necrosis, and 79% viable cells.

Fig. 4.

(A) Identification of apoptotic and necrotic cells using a flow cytometer to A549 and HLF cells. (B) Cell cycle analysis of A549 and HLF cells treated with different formulations. The data were provided as the mean value ± the standard deviation (SD). ANOVA test was performed for this test. *p ≤ 0.05, and **p ≤ 0.01.

Cell cycle analysis

We experimented to evaluate the impact of pDNA/polybia-MP1 on the cell cycle of A549 and HLF cells. The cell cycle progress was assessed using flow cytometry. The average duration of the cell cycle is 24 h. The G0/G1 phase lasts for a period of 6–12 h, the S phase lasts for a period of 6–8 h, and the G2/M phase lasts for 3–5 h. An evaluation of the cell cycle of A549 cancer cells treated with PBS revealed a noteworthy rise in the percentage of cells in the Sub-G1 and G0/G1 phases, with 36% of cells in these phases. Furthermore, 33% of the cells were found to be in the S phase, while 31% were observed to be in the G2/M phase. This discovery suggests that A549 cells have a reproductive capacity of 31%. Furthermore, comparable outcomes were achieved in A549 cells exposed to Free pDNA, with no statistically significant difference (P ≥ 0.05). Nevertheless, the A549 cells in the polybia-MP1 treated group displayed a distribution of 8%, 32%, 39%, and 21% of cells in the Sub-G1, G0/G1, S, and G2/M phases, respectively. The A549 cells treated with pDNA/polybia-MP1 showed a distribution of 5% in the Sub-G1 phase, 42% in the G0/G1 phase, 43% in the S phase, and 10% in the G2/M phase. This finding demonstrates that the utilization of pDNA/polybia-MP1 significantly enhances the reduction in the proliferation of cancer cells (p ≤ 0.01) (Fig. 4B). In addition, the HLF cell lines, when exposed to pDNA/polybia-MP1, showed a distribution of 12% in the Sub-G1 phase, 31% in the G0/G1 phase, 15% in the S phase, and 42% in the G2/M phase (Fig. 4B).

pDNA/polybia-MP1 inhibits MALAT1, LUCAT1 and increase transcription of BANCR LncRNA

We thoroughly examined the changes that exposure to pDNA/polybia-MP1 caused in the transcription of genes within the cells. This study suggested a relationship between pDNA/polybia-MP1 and the activation of BANCR lncRNA. The expression level of the BANCR lncRNA gene was significantly increased in A549 cells treated with pDNA/polybia-MP1 and polybia-MP1, compared to the group treated with PBS or free pDNA. The transcription ratios of the BANCR lncRNA gene in the pDNA/polybia-MP1 and polybia-MP1 group were 3.8 and 1.9, respectively. In contrast, the level of transcription in the PBS and free pDNA groups was 0.58 and 0.66, respectively. The findings demonstrated a significant 6fold rise in the transcription level of the BANCR lncRNA gene, which is associated with programmed cell death, following treatment with pDNA/polybia-MP1 (***P < 0.001) and a 3fold rise in polybia-MP1 group (**P < 0.01) (Fig. 5A).

Fig. 5.

The expression levels of the BANCR (A,D), MALAT1 (B,E) and LUCAT1 (C,F) lncRNA genes were measured in the groups treated with pDNA/polybia-MP1, polybia-MP1, Free pDNA and PBS. The findings obtained from the qRT-PCR test were normalized using the GAPDH (reference gene). *P < 0.05, **P < 0.01, ***P < 0.001 and ns: non-significant.

However, transcription of the MALAT1 and LUCAT1 lncRNA genes was significantly reduced when A549 cells treated with pDNA/polybia-MP1 and polybia-MP1 were compared to the group given PBS and free pDNA. The expression levels of the MALAT1 and LUCAT1 lncRNA genes in the pDNA/polybia-MP1 group were 0.52 and 0.64, respectively. The polybia-MP1 group had relative transcription levels of 0.59 and 0.73 for the MALAT1 and LUCAT1 lncRNA genes, respectively (Fig. 5B and C).

In contrast, MALAT1 and LUCAT1 lncRNA transcription in the PBS group was 0.97 and 0.91, respectively. The findings demonstrated a notable reduction of 50% in the transcription of MALAT1 and LUCAT1 lncRNA genes following treatment with pDNA/polybia-MP1 (**P < 0.01) (Fig. 5B and C).

The BANCR lncRNA gene transcription ratios in the pDNA/polybia-MP1 and polybia-MP1 groups were 0.17 and 0.19, respectively, in the HLF cells. On the other hand, the PBS and free pDNA groups had transcription levels of 0.15 and 0.16, respectively. No significant difference was observed in BANCR lncRNA transcription (p ≥ 0.05) (Fig. 5D). In the HLF cells, the pDNA/polybia-MP1 groups’ MALAT1 and LUCAT1 lncRNA gene transcription ratios were 0.21 and 0.16, respectively. In contrast, the PBS groups’ MALAT1 and LUCAT1 lncRNA transcription levels were 0.23 and 0.17, respectively. The transcription of MALAT1 and LUCAT1 lncRNAs did not change significantly (p ≥ 0.05) (Fig. 5E and F). Results related to AKT gene expression and scratch test were presented in Supplementary Material 1 and Supplementary Material 2. Supporting information 2 was shown Scratch analysis of cells treated with free plasmid (pDNA), Polybia-MPI peptide, and pDNA/Polybia-MPI complexes over time (0 h, 9 h, and 18 h).

pDNA/polybia-MP1 inhibits AKT signaling pathway

We examined the relationship between pDNA/polybia-MP1 and the AKT pathway. Using the P53, BAX, BCL2, and AKT3 genes, we predicted the apoptotic potential of pDNA/polybia-MP1. This study proposed a correlation between P53, BAX, BCL2, and AKT3 stimulation by pDNA/polybia-MP1. The P53, and BAX gene expression levels, which promote apoptosis, were significantly higher in A549 cells treated with pDNA/polybia-MP1 compared to the group treated with PBS. The transcription levels of the P53 and BAX genes were upregulated in the pDNA/Polybia-MP1 treatment group, showing 1.8- and 2.5-fold increases, respectively.

The findings demonstrated that treatment with pDNA/polybia-MP1 resulted in a 100% increase in the expression of genes linked to programmed cell death (apoptosis) (**P ≤ 0.01). On the other hand, when A549 cells treated with pDNA/polybia-MP1 were compared to the group treated with PBS, there was a substantial decrease in the expression of AKT3 and BCL2 genes, preventing programmed cell death. The pDNA/polybia-MP1 group had a transcribed rate of 0.24 for the BCL2 gene and 0.61 for AKT3 gene. On the other hand, BCL2 and AKT3 gene transcription level were 0.76 and 1.3 in the PBS group. Following treatment with pDNA/polybia-MP1, the results demonstrated a substantial 50% reduction in gene transcription in the BCL2 signaling pathway (p ≤ 0.01) (Fig. 6). The transcription rate of the P53, BAX, AKT3, and BCL2 genes in normal cells was not significantly different (p ≥ 0.05).

Fig. 6.

The mRNA levels of the P53, BAX, AKT3 and BCL2 genes were evaluated in the pDNA/polybia-MP1, polybia-MP1, Free pDNA and PBS treatment groups. The data obtained from the qRT-PCR assay were normalized versus the GAPDH (reference gene). * P < 0.05, ** P < 0.01, ns: non-significant.

Discussion

Due mainly to their advantageous characteristics, such as their tiny size and capacity to penetrate tumors, peptide-based therapies have become increasingly popular in treating cancer throughout the last 20 years^34,35. Among them, venom-derived peptides have been identified as a promising class of anticancer medicines, with numerous synthetic analogs, including IM62, ATN-161, and angiotensin-(1–7) now under clinical research for various cancers^36,37. These peptides can work in numerous ways, including targeted delivery of cytotoxic medicines, hormone antagonism, or immunological regulation. Novel peptide-based approaches, such as those being tested in clinical trials for Stimuvax and Melanotan, have been made possible by the ongoing discovery of new therapeutic targets brought about by improvements in our knowledge of the molecular pathways underlying cancer³⁸. A significant example is BLZ-100 (“Tumor Paint”), a modified chlorotoxin that displays selective lighting of brain tumor cells to facilitate accurate surgical excision and is currently in Phase 1b clinical studies^39,40. Our new findings, which indicate the anticancer capabilities of Polybia-MP1, correlate with this rising body of evidence, supporting the potential of venom-derived peptides.

Advancements in proteomics and genomes have markedly improved our capacity to identify and characterize new anticancer peptides derived from venom^41,42. Techniques like mass spectrometry, capable of detecting peptides at low concentrations and offering extensive mass databases, in conjunction with next-generation RNA sequencing of venom glands, are essential for analyzing venom compositions and identifying novel physiologically active peptides^43,44. This work investigates a novel method for delivering anticancer peptides through using plasmids. Plasmid-mediated gene therapy provides an effective means of introducing therapeutic genes into cancer cells. In cancer gene therapy, plasmids are designed to incorporate expression cassettes that facilitate the synthesis of targeted therapeutic proteins. Following cellular absorption, the DNA must migrate to the nucleus to facilitate gene expression, emulating the cell’s inherent protein synthesis apparatus^45,46. The integration of our advanced comprehension of cancer cell biology, enhanced insights into immune system functionality, and progress in nucleic acid delivery and molecular biology techniques facilitate the formulation of complex anticancer strategies^47,48. Consequently, our research employed a plasmid-based methodology to suppress cancer proliferation. The manufactured pDNA/Polybia-MP1 combination demonstrated a significantly enhanced ability to cause apoptosis relative to free Polybia-MP1, indicating the effectiveness of this gene delivery approach.

Our study concentrated on the effect of pDNA/Polybia-MP1 on the expression of lncRNAs MALAT1, LUCAT1, and BANCR in lung cancer cells due to their recognized involvement in lung cancer genesis and progression. Prior research has identified MALAT1 and LUCAT1 as oncogenic lncRNAs, with their inhibition resulting in substantial reductions in tumor proliferation⁴⁹. In contrast, BANCR generally operates as a tumor suppressor⁵⁰. Our cellular assays and transcriptomic analysis demonstrated substantial changes in the expression levels of these lncRNAs after pDNA/Polybia-MP1 therapy. We specifically noted a decrease in the transcription rate of MALAT1 and LUCAT1 lncRNAs in pDNA/Polybia-MP1-lipofected cells relative to control (PBS-treated) cells. The expression of BANCR lncRNA was significantly elevated in the pDNA/Polybia-MP1-transfected cancer cells. The established role of these lncRNAs in modulating the apoptotic pathway indicates that the alterations in their expression likely signify the initiation of cellular apoptotic mechanisms by pDNA/Polybia-MP1^49,50.

We investigated the activation of signaling pathways related to pDNA/Polybia-MP1 by assessing the expression of apoptosis-related genes. Our results demonstrated that pDNA/Polybia-MP1 augmented the transcription of the P53 and BAX genes. Conversely, the expression of AKT3, an isoform of AKT known for its oncogenic and anti-apoptotic functions⁵¹, was found to be diminished following the treatment of cancer cells with pDNA/Polybia-MP1. This downregulation of AKT3, in conjunction with the elevated transcription of P53 and BAX, strongly correlates with the onset of apoptosis. The increased BAX transcription and a reduction in BCL2 gene expression (which was directly measured in this study) further corroborates the induction of programmed cell death, as BAX is a crucial protein in initiating this process. This outcome robustly supports our hypothesis regarding the induction of apoptosis via pDNA/Polybia-MP1.

This study presents persuasive evidence about the anticancer potential of pDNA/Polybia-MP1, yet numerous limitations merit consideration. Initially, the reduced expression of AKT3 identified in this study following the treatment of cancer cells with pDNA/Polybia-MP1 is a noteworthy discovery, diverging from its usual oncogenic and anti-apoptotic functions. Future research should investigate how pDNA/Polybia-MP1 induces downregulation and its resultant role in apoptosis, emphasizing downstream targets and the phosphorylation states of AKT3. Secondly, although our in vitro findings are encouraging, the systemic toxicity exhibited by free Polybia-MP1 in mice (renal failure, hemolysis, rhabdomyolysis, liver necrosis) presents a considerable obstacle to the in vivo application of the pDNA/Polybia-MP1 complex²⁷. Future research must focus on ways for safe and tailored in vivo delivery, including the use of specialized tumor-targeting ligands or encapsulated delivery systems to reduce off-target effects. The durability and outcome of the recombinant plasmid in vivo must be rigorously assessed to guarantee persistent gene expression and therapeutic effectiveness while avoiding adverse immunological reactions or integration into the host genome⁵². Moreover, comprehensive in vivo efficacy studies in animal models are crucial to corroborate these in vitro results and evaluate long-term therapeutic effects.

Conclusion

This study demonstrates that pDNA/Polybia-MP1 possesses significant anticancer capabilities against lung cancer cells, exhibiting negligible cytotoxicity towards normal cells. The plasmid-mediated delivery of Polybia-MP1 effectively modulates the expression of key lncRNAs, notably decreasing oncogenic MALAT1 and LUCAT1 while increasing the tumor-suppressive BANCR. Furthermore, pDNA/Polybia-MP1 promotes the transcription of pro-apoptotic genes P53 and BAX. Crucially, and contrary to its typical oncogenic and anti-apoptotic role, the amount of AKT was found to be decreased in this study after treating cancer cells with pDNA/Polybia-MP1, collectively indicating the induction of programmed cell death. The overall findings thus substantiate the potential of pDNA/Polybia-MP1 as a novel therapeutic strategy for lung cancer. Future research will focus on overcoming in vivo delivery challenges and elucidating the comprehensive molecular network influenced by pDNA/Polybia-MP1 to pave the way for its clinical application.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Conceptualization, A.D., N.T.; methodology, A.D.; software, N.T. and A.D.; All authors reviewed the manuscript.

Funding

This research received no specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

The datasets analyzed during the current study are available from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent

The study was approved by the Ethics Committee of the Islamic Azad University of Shahrekord Branch in Iran (IR.IAU.SHK.REC.1401).