Development and validation of LAMP and real-time LAMP assays for rapid detection of coccinia mosaic Virudhunagar virus in bitter gourd (Momordica charantia)

Abstract

Mosaic disease, caused by whitefly-transmitted begomoviruses, significantly threatens bitter gourd cultivation in India. This study identified and characterized the complete genome of coccinia mosaic Virudhunagar virus (CoMViV) from symptomatic bitter gourd samples collected in Oddanchatram block of Dindigul district, Tamil Nadu, using rolling circle amplification and sequencing. A loop-mediated isothermal amplification (LAMP) protocol was optimized by targeting regions of the CoMViV AV1 and AV2 genes. The LAMP assay demonstrated exceptional sensitivity, detecting as little as 10 fg of viral DNA, a 100-fold improvement compared to PCR. Specificity tests confirmed that the LAMP assay exclusively detected CoMViV in bitter gourd, with no cross-reactivity with other begomoviruses. Real-time LAMP assay produced a distinct annealing peak at 86.5 ± 0.5 °C. Furthermore, viral quantification revealed a maximum viral titer of 3.2 × 10⁹ copies per µl in infected leaf samples. While both LAMP and PCR assay successfully detected CoMViV in infected tissues, the LAMP assay offers advantages including simplicity, rapid, and sensitivity. This optimized LAMP assay provides a valuable tool for differentiating CoMViV from other begomoviruses infecting bitter gourd crop, offering an improvement over existing PCR assay. To the best of scientific knowledge, we, for the first time, demonstrate the LAMP assay for the detection and quantification of CoMViV in bitter gourd plants.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-025-04484-2.

Introduction

Bitter gourd (Momordica charantia), also known as bitter melon, belonging to the family Cucurbitaceae, is a distinctive cucurbitaceous vegetable cultivated in tropical and subtropical regions. It is widely grown across Asia, Africa, and the Caribbean for both its unique bitter flavor and its numerous health benefits. Traditionally, bitter gourd is used in herbal medicine, which recognized for its anti-helminthic, anti-diabetic, antiviral, anti-malarial, anti-cancer, and nutritional properties (Alam et al. 2015). In India, bitter gourd is cultivated over approximately 1.4 lakh hectares, yielding around 1.73 million metric tons. Tamil Nadu ranks as the third-largest producer, with an estimated cultivation area of 6,000 hectares and a production of 143,000 metric tons annually (National Horticultural Board, MOA&FW, Gurugram, Haryana, Third Advance Estimate, 2024). However, viral infections, particularly the high incidence of whiteflies and viral diseases they transmit, pose a major challenge to bitter gourd cultivation, often leading to significant yield losses, sometimes as high as 100%. Among the most damaging viruses affecting bitter gourd are begomoviruses, including Indian cassava mosaic virus (ICMV) (Rajinimala & Rabindran 2007), pepper leaf curl Bangladesh virus (PepLCBV) (Raj et al. 2010), squash vein yellowing virus (SqVYV), cucurbit leaf crumple virus (CuLCrV) (Adkin et al. 2008), bitter gourd yellow vein virus (BgYVV) (Tahir et al., 2010), tomato leaf curl New Delhi virus (ToLCNDV) (Nagendran et al., 2014), bitter gourd yellow mosaic virus (BgYMV) (Manivannan et al. 2019), and the mixed infection of two distinct begomoviruses, CoMViV and ToLCNDV, along with their satellite molecule, tomato leaf curl Virudhunagar alphasatellite, from Virudhunagar district in Tamil Nadu (Muthupandi et al. 2019).

Begomoviruses, belonging to the Geminiviridae family, are characterized by their twin-quasi-isometric virions, measuring approximately 20 × 30 nm in size, with a genome size of ~ 2.7 kb. The Geminiviridae family is currently classified into fourteen genera based on genome structure, host range, and vector transmission (Roumagnac et al. 2022). Among these, Begomovirus is the largest genus, primarily transmitted by the whitefly Bemisia tabaci (Gennadius) (order: Hemiptera, family: Aleyrodidae) in a circulative, persistent manner. These viruses predominantly infect dicotyledonous plants and are categorized as either monopartite or bipartite. Some begomoviruses, like bitter gourd yellow mosaic virus, can even be transmitted through seeds (Manivannan et al. 2019). Various methods are employed for the detection of begomoviruses, including serological assays, such as enzyme-linked immunosorbent assay (ELISA), dot immunobinding assay (DIBA), western blot, and tissue immunobinding assay (TIBA), along with molecular techniques like southern blotting and PCR (Tokunaga et al., 2018). While serological methods are useful for large-scale screening, they often lack the sensitivity required to detect early-stage or asymptomatic infections. Consequently, PCR is widely regarded as the gold standard due to its high sensitivity and specificity (Ayman et al. 2010). However, PCR is time-consuming and requires specialized equipment, such as a thermal cycler, limiting its practicality for rapid field diagnostics.

In recent years, loop-mediated isothermal amplification (LAMP) has become a prominent nucleic acid amplification technique due to its high sensitivity, efficiency, and lack of requirement for specialized instrumentation. Unlike PCR, which uses two primers, LAMP employs two inner and two outer primers, along with two loop primers to accelerate the reaction (Notomi et al. 2000). LAMP maintains high specificity by targeting multiple sequence regions with four to six primers and conducted at a constant temperature between 60 and 65 °C for 30–60 min (Notomi et al. 2000). Studies have shown that LAMP exhibits greater sensitivity compared to quantitative real-time PCR (Parida et al. 2008). Its simplicity, rapid turnaround time, and high sensitivity have made LAMP a valuable molecular diagnostic tool, particularly for viral detection. This technique significantly improves disease identification and reduces the time needed for pathogen detection in field conditions. In this study, we focus on detecting CoMViV infection in bitter gourd using LAMP and real-time LAMP assays.

Materials and methods

Collection of plant samples

During July to August 2022, bitter gourd plants exhibiting characteristic leaf curl, mosaic, yellow mosaic, and mottling were collected from the Karattupatti and Kannivadi villages of Oddanchatram block in Dindigul district of Tamil Nadu. A total of 5 samples from different fields were collected separately and brought to the laboratory for further analysis.

DNA extraction and PCR amplification

Genomic DNA was extracted from both symptomatic and apparently healthy bitter gourd leaf samples using the CTAB method as described by Doyle and Doyle (1990). PCR amplification was carried out in a 10 µl reaction volume containing 5 µl of 2 × Taq Master Mix RED (Ampliqon III, Odense M, Denmark), 1 µl each of forward and reverse primers (100 µM), 2 µl of nuclease-free water (Himedia, MB grade), and 50 ng (1 µl) of template DNA. To amplify the DNA A component of the begomovirus genome, a universal primer pair, PAL1c1960 (ACNGGNAARACNATGTGGGC) and PAR1v722 (GGNAARAT HTGGATGGA), was employed as previously described by Chatchawankanphanich and Maxwell, (2002). The PCR reactions were performed using a VeritiPro thermal cycler (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA).

Cloning and sequencing of full-length genome

Following the confirmation of begomovirus infection through PCR using universal primers, rolling circle amplification (RCA) was performed to enrich the concentration of circular begomoviral DNA. A total of 80 ng of DNA from PCR-positive samples was subjected to RCA following the manufacturer’s instructions (Thermo Fisher Scientific, USA). The enriched concatamers were then digested individually with six different restriction endonucleases (Bam HI, Sac I, Eco RI, Kpn I, Xba I, and Hind III). After restriction, linearized fragment size of ~ 2.7 kb was gel-purified (Gene JET Gel Extraction Kit, Thermo Scientific, USA) and ligated into the linearized pBlueScript II K + (PKS) vector, with the corresponding restriction endonucleases. Recombinant plasmids were transformed into Escherichia coli strain DH5α. Positive clones were screened through restriction fragment length polymorphism (RFLP) analysis, and the selected clones were sequenced using primer walking from M/s. Eurofins Pvt. Ltd., Bangalore. Resultant sequences were assembled into a circular genome using ORF Finder (NCBI).

Phylogenetic analysis

The complete genome sequences of the DNA A component were submitted to the NCBI GenBank database to obtain accession numbers. The study isolate, along with reference sequences retrieved from the NCBI GenBank database (http://ncbi.nlm.nih.gov) was aligned using the CLUSTALW program. Phylogenetic analysis was performed using MEGA 11.0 software (Tamura et al. 2021) with 1,000 bootstrap replicates. Evolutionary distances in the phylogenetic tree were calculated using the neighbor-joining method (Tamura et al. 2004). Tree was rooted on the outgroup sequences of mung bean yellow mosaic virus (MYMV) (Accession number MW736053.1). Additionally, the Sequence Demarcation Tool (SDT) version 1.2 was used to determine pairwise sequence identity with previously reported isolates in the NCBI database (Muhire et al. 2014).

LAMP primer designing and in silico validation

Specific LAMP primers were designed using the PrimerExplorer V5 software (https://primerexplorer.jp/e.) based on the AV1 and AV2 gene sequences of CoMViV (PP497829). Primer specificity was confirmed through a BLAST search (Standard nucleotide BLAST available at https://blast.ncbi.nlm.nih.gov/blast.cgi). The primers were further evaluated using Oligo Evaluator™ (Sigma Aldrich, powered by PREMIER Biosoft, San Francisco, CA, USA) to ensure the absence of secondary structures, primer–dimer formations, appropriate % GC content, and suitable GC clamps (Zaczek-Moczydłowska et al. 2020) (http://www.premierbiosoft.com/netprimer/). The primers were synthesized by M/s. Sigma Aldrich Chemical Pvt. Ltd., Bangalore, India, and are listed in Table 1. In silico hybridization of the designed primers was visualized using SnapGene Viewer® 6.1.1 software (GSL Biotech LLC, Boston, MA, USA).

Table 1.

List of primers used for LAMP assay

Primer ID	Primer type	Primer Sequence (5’−3’)	Length (nt)	Position	GC %	Target gene
F3	Forward outer	TTCGACAGCCCCTATGCT	18	67–84	56	AV1 & AV2 gene
B3	Backward outer	CCAATATGGGCCACGTCAT	19	242–260	53
FIP (F1C + F2)	Forward inner	CATGGGCCTGTTGGCCCATA CGTGCAGTTGTCCCCATTG	39	88–106 128–147	58
BIP (B1C + B2)	Backward inner	GAAGCCCAGATGTACCACGGG GCCTGGACTCGAAAGACTG	40	223–241 179–199	60
LF	Loop forward	TGCCTTTGTGCCTCGGA	17	107–123	59
LB	Loop backward	GCTGTGAAGGCCCGTGT	17	200–216	65

LAMP assay

The LAMP assay was carried out in a total reaction volume of 25 μl. The reaction mixture contained dNTPs (0.8–1.4 mM), MgSO₄ (2–10 mM), betaine (0.6–1.0 M), Bst (Bacillus stearothermophilus) DNA polymerase (2–8 U), and Hydroxy Naphthol Blue (HNB) dye (80–120 μM). The LAMP reactions were conducted in 0.2 ml tubes, each containing 2.5 μl of template DNA (~ 50 ng), 2.5 μl of 10 × Thermopol reaction buffer, 6 mM MgSO₄ (New England Biolabs, Beverly, MA, USA), 1.4 mM dNTPs (Thermo Fisher Scientific, USA), 0.2 μM of both outer primers (F3 and B3), 0.4 μM of both loop primers (LF and LB), 1.6 μM of both inner primers (FIP and BIP), 0.8 M betaine (Sigma Aldrich, USA), 120 μM HNB dye (Aura Biotechnologies, Chennai, India), and 8U Bst DNA polymerase and nuclease-free water (MB grade, HiMedia) to a final volume of 25 μl. The reaction mixtures were incubated at 65 °C for 60 min, followed by a termination step at 85 °C for 2 min to deactivate the enzyme. DNA from healthy bitter gourd samples and a reaction mixture with no template DNA (nuclease-free water) were included as negative controls.

LAMP products detection

The 25 μl LAMP amplification products were assessed by visually observing the reaction mixture before and after incubation. A color shifted from violet to sky blue indicated a positive reaction. Simultaneously, LAMP amplicons were resolved on 2% agarose gel electrophoresis to visualize under UV transilluminator to observe the ladder-like pattern with the positive reaction in the LAMP mixture.

PCR assay

Conventional PCR was conducted using the outer primers F3 and B3 to confirm the sequence of the LAMP products. The PCR reaction was carried out in 0.2 ml PCR tubes containing 45 ng of DNA template, 5 μl of 2X Taq Master Mix RED, 1 μl each of forward, and reverse primers (10 μM) and nuclease-free water to a final reaction volume of 10 μl. The PCR assay was performed under the following thermal conditions: an initial denaturation at 95 °C for 5 min, followed by 35 cycles of 30 s at 94 °C for denaturation, 30 s at 58 °C for annealing, and 30 s at 72 °C for extension. A final extension step was carried out at 72 °C for 10 min. The amplified PCR products were visualized on a 1% agarose gel.

Specificity and sensitivity of LAMP assay

The specificity of the LAMP assay was evaluated using the positive samples for identified begomoviruses, such as ToLCNDV, ToLCBaV, ToLCPalV, BYVMV and CoMTNV available in our laboratory. To assess the sensitivity of the LAMP assay, genomic DNA samples from begomovirus-infected plants were serially diluted tenfold, ranging from 100 ng/μl to 10 fg/μl, and used in the assay.

Real-time LAMP

The real-time LAMP assay was conducted using the novel EvaGreen® dye (Aura Biotechnologies) to monitor the progression of the LAMP reaction with symptomatic and apparently healthy bitter gourd samples. EvaGreen® is a next-generation dsDNA binding dye that operates in the FAM channel. The assay was performed in a CFX Real-Time PCR machine (CFX Maestro, BIORAD, Hercules, CA, USA) with a reaction volume of 25 μl. The reaction mixture included 10 ng of template DNA, 1.6 μM each of FIP and BIP primers, 0.2 μM each of F3 and B3 primers, 0.4 μM each of LF and LB primers, 1.4 mM dNTPs, 1.0 M betaine, 3.0 mM MgSO₄, 2.5 μl of 10 × Thermo Pol buffer, 8 U of Bst polymerase, 1.5 μl of 20 × EvaGreen (Biotium, Hayward, CA, USA), and 2 μl of DNA template (~ 100 ng). The reaction was performed at 65 °C for 40 min, followed by a melt curve analysis from 65 °C to 95 °C at a rate of 0.05 °C/s.

Virus quantification through qLAMP

The presence of CoMViV in symptomatic plants was confirmed using CP gene-specific primers (F3 and B3) through PCR as described in Sect."Specificity and sensitivity of LAMP assay". Quantitative LAMP (qLAMP) was used to quantify viral components in symptomatic leaves on a CFX Maestro real-time system. The qLAMP reaction mixture had a total volume of 25 µl, replacing HNB dye with 1 × EvaGreen dye as mentioned earlier. The optimized thermal cycling conditions for qLAMP were as follows: incubation at 65 °C for 40 min, followed by melt curve analysis ranging from 65 °C to 95 °C at a rate of 0.05 °C/s. The relative fluorescence unit (RFU) threshold value was utilized, and the threshold time (Tt) was determined as the point when fluorescence reached the threshold value. Fluorescence data were collected in the 6-carboxyfluorescein (FAM) channel, with excitation at 450–495 nm and detection within the 510–527 nm range during amplification. Each treatment was performed with three biological replicates and two technical replicates, using high-quality 96-well qPCR plates (Bio-Rad).

Preparation of standard curve

Genomic DNA was extracted from symptomatic leaves using the CTAB method. The quality of the extracted DNA was assessed using a Nanodrop® Lite Plus spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). For the absolute quantification of CoMViV, a standard curve was generated using a partial CP gene fragment of approximately 204 bp. The amplified PCR product of the CP gene was cloned into the pGEM-T Easy vector system (Cat No. A1360, Promega). Positive clones were screened, and qPCR was performed using tenfold serially diluted plasmid DNA ranging from 100 ng to 1 pg as the reaction template. To create the standard curve for plasmid DNA, a linear regression curve was generated by plotting the log of DNA dilutions (in ng) on the X-axis against the mean Ct values on the Y-axis. The copy numbers were calculated using the following formula as described by Roy et al. (2021).

DNA amount (ng).

Copy number =× 6.022 × 10.²³

Molecular mass of plasmid (g/mol).

This standard curve was used to determine the copy numbers of CoMViV in the plant samples by comparing their Ct values against the standard curve.

Statistical analysis

CoMViV accumulation in bitter gourd field samples was compared using an ANOVA F test to determine if there were significant differences in viral load between symptomatic and healthy plants. Bartlett’s test was applied to assess the homogeneity of variances before comparing the viral titer in symptomatic plants.

Results

Disease incidence and symptomatology

A field survey of bitter gourd crops revealed that plants exhibited characteristic symptoms associated with begomovirus infections, including mosaic, yellow mosaic, and downward curling of leaves. The incidence of these symptoms was over 28% in surveyed fields in the Karattupatti and Kannivadi villages of the Oddanchatram block in Tamil Nadu (Fig. 1).

Fig. 1.

Symptoms associated with begomovirus infection on bitter gourd. A CoMViV-infected field; B leaf curl with yellow mosaic; C yellow mosaic; and D severe curling

PCR amplification of genome begomovirus

The presence of begomovirus in symptomatic plants was confirmed through PCR amplification using begomovirus universal primers. DNA extracted from infected leaf samples yielded amplicon of approximately 1.2 kb, an expected for begomoviruses (Fig. S1). These positive samples were then subjected to rolling circle amplification (RCA) to enrich circular begomoviral genome. RCA generated a single DNA fragment of approximately 2700 nucleotides (nt), upon digestion with restriction enzymes (Bam HI, Sac I, Xba I, and Kpn I), proceeded to cloning for further characterization.

Sequencing and phylogenetic analysis

Sequence analysis of the Oddanchatram bitter gourd isolate (Kpn I, Xba I, and Sac I clone) exhibited 99% nucleotide identity with the DNA A component of CoMViV previously identified in a bitter gourd (KY860899) from Virudhunagar region of Tamil Nadu. The DNA A component of the isolate was determined to be 2756 nt in length and designated as CoMViV. The sequences have been deposited in the NCBI GenBank database under accession number PP497829 (Fig. 2). Phylogenetic analysis further supported these findings, with the CoMViV DNA A sequence from the bitter gourd isolate clustering closely with the previously reported CoMViV isolate (KY860899). Pairwise identity matrices indicated that CoMViV shared nucleotide identities of 75.45% with ToLCNDV, 97.57% with BgYMV and 78.40% with coccinia mosaic Tamil Nadu virus (CoMTNV) (Fig. S2).

Fig. 2.

Phylogenetic tree constructed by neighbor-joining method using MEGA 11 software based on complete nucleotide sequence depicting relationship between study isolate and other known begomoviruses. Bootstrap values > 50% (1000 replications) are given at the nodes. Blue color depicts the study isolate, where red color indicates the out group. Sequences were obtained from NCBI GenBank

LAMP primer design and in silico hybridization

LAMP primers were designed to specifically target the AV1 and AV2 genes of CoMViV. In silico hybridization analysis confirmed that the designed primers annealed precisely to unique sites with the target sequence (PP497829), ensuring specificity for CoMViV detection (Fig. S3).

PCR assay-based detection of begomovirus in bitter gourd sample using LAMP primers

To assess the efficiency of the designed LAMP primers, a PCR assay was conducted using CoMViV-specific F3 and B3 primers. 100 ng of total DNA extracted from begomovirus-infected leaf samples was used as a template. The diseased samples yielded an expected amplicon of approximately 204 bp, confirming the presence of CoMViV. DNA extracted from healthy leaf tissues along with a no-template control served as negative control. No amplification was observed in these negative controls, further validating the specificity of the developed LAMP assay (Fig. S4).

LAMP-based virus detection

LAMP detection was performed using a set of six primers designed to flank eight distinct regions of the AV1 and AV2 gene of CoMViV. The designed primers successfully amplified the target gene, confirming the presence of CoMViV. In the colorimetric LAMP assay, a color change from violet to sky blue was observed in positive samples after incubation at 65 °C for 60 min, whereas healthy samples and negative controls retained the violet color. Additionally, agarose gel electrophoresis (2%) of LAMP-amplified products revealed distinct ladder-like banding patterns in diseased samples, indicative of successful amplification. No such patterns were observed in healthy or no-template control samples. Furthermore, the LAMP assay performed using different primer sets targeting the coat protein gene consistently detected CoMViV in infected bitter gourd samples (Fig. 3).

Fig. 3.

Detection of CoMViV causing mosaic disease in bitter gourd using LAMP assay. A Colorimetric assay using HNB dye. B Visualization on 2% agarose gel electrophoresis displays amplified LAMP products, M- 100 bp DNA ladder; Infected bitter gourd samples (Lane 1 to 5—Infected field samples), (Lane 6 – Healthy control, Lane 7—NTC—no template control)

Specificity and sensitivity of LAMP assay

The specificity of the developed LAMP assay for CoMViV was evaluated using DNA samples infected with other begomovirus including ToLCNDV, ToLCBaV, ToLCPalV, BYVMV and CoMTNV. The results confirmed that the assay was highly specific to CoMViV, with no cross-reactivity observed (Table S1; Fig. 4). Initially, all samples were analyzed using PCR assay with a universal begomovirus primer pair. All the extracted DNAs from the begomovirus-infected samples unanimously yielded amplicons of approximately 1200 bp, confirming the presence of begomovirus, whereas no amplification was observed in healthy samples.

Fig. 4.

Specificity of detecting CoMViV using LAMP assay with other begomovirus samples. A Colorimetric assay using HNB dye. B Visualization on 2% agarose gel electrophoresis displays amplified LAMP products, M-100 bp DNA ladder; Infected bitter gourd samples (Lane 1 – CoMViV (Bitter gourd), L2 – ToLCNDV (Bitter gourd), L3-ToLCBaV (Tomato), L4- ToLCPalV (Tomato), L5 – BYVMV (Okra), L6- CoMTNV (Ivy gourd)

The detection limit of the LAMP assay was assessed using a ten-fold serial dilution of genomic DNA, ranging from 100 ng/μl to 10 fg/μl. In conventional PCR, it showed a detection limit of 100 fg/μl, while the LAMP assay reliably detected DNA dilutions up to 10 fg/μl (Fig. 5).

Fig. 5.

Sensitivity of detecting CoMViV using LAMP assay and comparison with PCR assay. A Colorimetric assay using HNB dye. B Visualization on 2% agarose gel electrophoresis displays amplified LAMP products (C) PCR assay; M- 100 bp DNA ladder; L1–100 ng L2- 10 ng, L3- 1 ng, L4- 100 pg, L5- 10 pg, L6–1 pg, L7- 100 fg, L8–10 fg, L9– Healthy control, L10-NTC)

Real-Time LAMP-based virus detection

LAMP amplification was monitored in a real-time LAMP assay by assessing both the amplification time and the formation of annealing peaks. Positive amplification signals were observed in virus-infected samples after 40 min of incubation, whereas no amplification signals were observed in healthy samples. The annealing peaks corresponding to the infected samples were recorded at 86.5 ± 0.5 °C, whereas no peaks were detected in the healthy control or no-template control. The detection limit of the real-time LAMP assay was found to be comparable to that of the standard LAMP assay (Fig. 6).

Fig. 6.

Real-time LAMP assay for CoMViV-infected samples. A Amplification curve. B Melt curve. C Melt peak. Blue – CoMViV-infected field samples; Red – Healthy samples and No template control

The melting temperature of the CoMViV CP gene product was approximately 86.7 °C. The standard curve for CoMViV demonstrated high amplification efficiency of 102.4%, indicating optimal conditions for absolute quantification. Additionally, the standard curve exhibited a strong correlation coefficient (R² = 0.99) and covered a linear range from 10² to 10⁶ copies of viral DNA (Fig. 7). The viral copy number in symptomatic bitter gourd leaves varied across different field samples. The highest viral load, 3.2 × 10⁹ copies/µl, was recorded in FS 5, followed by 1 × 10⁹ and 7 × 10⁸ copies/µl in FS 1 and FS 2, respectively in Karattupatti field samples. The lowest viral loads were observed in FS 3 (1.4 × 10⁶ copies/µl) and FS 4 (1.4 × 10⁵ copies/µl) in Kannivadi field samples. No viral presence was detected in healthy plants or the no-template control (Fig. 8).

Fig. 7.

Quantification of CoMViV-infected samples through q LAMP. Blue – CoMViV-infected field samples, A Amplification curve B Standard curve C Melt curve D Melt peak

Fig. 8.

CoMViV DNA accumulation in different bitter gourd field samples. Each bar represents the mean of three individual replicates ± standard error and statistical significance (p < 0.001) according to ANOVA F-test (Bartlett’s test)

Discussion

The cultivation of bitter gourd in India has become increasingly challenging due to the widespread occurrence of several virus associated diseases (Nagendran et al. 2017, 2018, 2023; Kumari et al. 2021; Krishnan et al. 2022a). In the present study, bitter gourd samples exhibiting symptoms, such as mosaic, yellow mosaic, and leaf curl, were observed in the Oddanchatram block of Dindigul district, Tamil Nadu. Preliminary PCR screening using universal primers confirmed the presence of begomovirus in symptomatic samples. Subsequent full-length genome sequencing of associated begomovirus and its phylogenetic analysis identified the virus as CoMViV. CoMViV was first documented in the bitter gourd plants from the Varalotti village in Virudhunagar district of Tamil Nadu (Muthupandi et al. 2019). The frequent occurrence of mixed viral infections in natural environments facilitates recombination between strains and/or species, playing a critical role in the emergence of new geminiviruses. Such recombination can lead to the evolution of novel pathogenic strains with increased virulence compared to their parent viruses. Therefore, the development of highly specific and sensitive diagnostic tools is essential to keep pace with these newly evolving viral variants. Several diagnostic methods, including ELISA, PCR, RCA-PCR, and qPCR, are routinely employed for the detection of plant viruses (Rahman et al. 2023). Among these, the LAMP technique has gained prominence for its rapid amplification capability and high sensitivity (Choi et al. 2018). LAMP reactions occur under isothermal conditions, typically between 60 °C and 65 °C for 30–60 min (Mori et al., 2001) and can be performed without sophisticated laboratory equipment. The results can be observed visually, either by the formation of a white precipitate of magnesium pyrophosphate or through a color change induced by the metal ion-binding dye hydroxynaphthol blue (HNB).

In this study, six primer sets targeting the conserved AV1 and AV2 regions of CoMViV successfully amplified the target sequence using Bst DNA polymerase at 65 °C for 60 min. The LAMP assay demonstrated high sensitivity, detecting as little as 10 fg of total DNA in CoMViV-infected samples. Visual detection of CoMViV infection in bitter gourd samples was successfully achieved based on colorimetric detection using HNB dye-based eliminating the requirement for agarose gel electrophoresis. HNB binds to Mg²⁺ ions and undergoes a color change based on the pH and magnesium concentration in the reaction mixture, thereby indicating the presence of CoMViV DNA in the sample. This enables simple, rapid, and visual detection of LAMP products, eliminating the need for gel electrophoresis. These results align with those of Jeevalatha et al. (2018), who optimized a LAMP assay for detecting ToLCNDV-[potato] in potato leaves and tubers with a sensitivity of 0.002 pg. The LAMP assay developed for CoMViV was found to be rapid, simple, and highly sensitive, consistent with findings from earlier studies (Kuan et al. 2010; Arutselvan et al. 2017; Naganur et al. 2019; Iftikhar et al. 2020; Krishnan et al. 2022b). Previous research has reported higher sensitivity of this colorimetric detection method over turbidity-based LAMP detection (Goto et al. 2009). Furthermore, the inclusion of 0.8 M betaine has been shown to enhance both sensitivity and efficiency of the LAMP assay (Njiru 2011). The developed LAMP assay sensitivity is found to be 100-fold higher than that of conventional PCR, highlighting its potential for effective diagnosis of CoMViV in diverse bitter gourd field samples. Previous studies showed the LAMP assay with ten times greater than that of conventional PCR (Zhou et al. 2014). Real-time LAMP (qLAMP) assays utilizing isothermal master mixes are frequently used for on-site detection of plant viruses (Wilisiani et al. 2019). In this study, real-time LAMP assay enabled not only the detection but also the quantification of CoMViV in symptomatic field samples, with a maximum viral titer of 10⁹/µl. Viral accumulation is influenced by the infection stage, with titers typically higher in later systemic infections compared to early localized infections (Yadav et al. 2021). Moreover, begomoviruses are known for their uneven tissue distribution within infected plants, causing sampling-related titer differences depending on leaf age or position (Shankarappa et al. 2022). Vector pressure and environmental factors, including temperature and humidity, can also impact virus replication and transmission dynamics, thereby affecting field-level virus titers (Saeed et al. 2023). Similarly, Caruso et al. (2023) reported the detection of 4.41 × 10² copies of ToLCNDV in tomato plants using the qLAMP assay. Caruso et al. (2024) developed a real-time RT-LAMP assay for tomato spotted wilt virus (TSWV), which demonstrated 100-fold higher sensitivity with respect to end point PCR or RT-PCR and real-time RT-PCR methods. They were able to quantify 9.191 × 10¹ copies of TSWV without cross-reactivity to other viruses within the Tospoviridae and Bromoviridae families.

Conclusion

Accurate detection of virus-infected plant samples is essential for effective disease management and for understanding the disease epidemiology. The LAMP assay developed in this study successfully detects CoMViV infection in bitter gourd plants and presents notable advantages over conventional PCR, including simplicity, safety, quick, lower cost, and user-friendliness. LAMP-positive amplicons can be observed with the naked eye after adding fluorescent or metal dyes to the reaction tubes, overcoming the limitations of conventional PCR and making LAMP ideal for field diagnostics. Both LAMP and real-time LAMP (qLAMP) assays serve as alternative approaches for detecting begomoviruses in bitter gourd. This assay demonstrated sensitivity comparable to that of PCR while maintaining high specificity for CoMViV, confirming its reliability and robustness for routine diagnostic use. We propose that this LAMP assay can be effectively utilized for field surveys and monitoring the phytosanitary status of virus-free seed production, especially in quarantine and seed certification programs. To our knowledge, this study is the first to report the development of both LAMP and qLAMP assays for the detection of CoMViV in bitter gourd.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

BgYMV

Bitter gourd yellow mosaic virus

BYVMV

Bhendi yellow vein mosaic virus

CoMViV

Coccinia mosaic Virudhunagar virus

CoMTNV

Coccinia mosaic Tamil Nadu virus

CP

Coat Protein

CTAB

Cetyltrimethylammonium Bromide

ELISA

Enzyme-Linked Immunosorbent Assay

HNB

Hydroxynaphthol Blue

LAMP

Loop-mediated Isothermal amplification

PCR

Polymerase Chain Reaction

RCA

Rolling Circle Amplification

ToLCBaV

Tomato leaf curl Bangalore virus

ToLCNDV

Tomato leaf curl New Delhi virus

ToLCPalV

Tomato leaf curl Palampur virus

TSWV

Tomato spotted wilt virus

Author contributions

KS, NB, GK, SH, and KN conceived and designed the research. KS performed the laboratory experiments. NB performed the bioinformatic works. KN and TKSL performed the analysis. GK and SH reviewed the data. KS wrote the draft manuscript. GK and KN revised and edited the final manuscript. All authors have read and approved the manuscript.

Funding

The Department of Science and Technology, Government of India, Science and Engineering Recruitment Board, Anusandhan National Research Foundation (ANRF) (CRG/2021/001630 dt.04.01.2022).

Data availability

The data that support the findings of this study are all provided in this manuscript.

Declarations

Conflict of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.