Colorimetric reverse transcription loop-mediated isothermal amplification assay for visual, sensitive, and specific detection of enterovirus G

Abstract

Background

Enterovirus G (EV-G) is widely prevalent in pigs worldwide, and co-infections of EV-G and other diarrhea-causing pathogens have been reported in many countries, threatening the pig farming industry. There are some methods available for EV-G detection; however, the RT-LAMP method for detecting EV-G has not yet been developed. The aim of thisstudy was to establish a highly sensitive and visual RT-LAMP assay for the detection of EV-G.

Results

A colorimetric reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed and evaluated for the visual detection of porcine enterovirus G (EV-G). The assay can be completed in 45 min at 64 °C, and the results can be observed by the unaided eye using the colorimetric LAMP master mix. The limit of detection (LOD) of the RT-LAMP assay was 46.8 copies of EV-G RNA, which is comparable to that of the previously described real-time RT-PCR (qRT-PCR) method and is 100-fold more sensitive than that of conventional RT-PCR. The assay specifically amplified the RNA of EV-Gs, and there was no cross-amplification with other porcine pathogens. In the clinical evaluation, the Kappa coefficient of the established RT-LAMP assay and the previously reported qRT-PCR was was 0.862 (P < 0.01), and the nucleic acid of EV-G could be tested from the fecal samples of porcine at different infection stages.

Conclusions

In this study, we successfully established a visual, sensitive, specific, rapid, and convenient RT-LAMP method for the detection of EV-G, which was successfully applied in the detection of EV-Gs in clinical samples.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-025-04970-y.

Introduction

The species Enterovirus G (EV-G) belongs to the genus Enterovirus of the family Picornaviridae [1]. EV-G is a non-enveloped virus comprising a single-stranded positive RNA genome of approximately 7.5 kb. The genome of EV-G consists of only one open reading frame (ORF) flanked by a 5′ and 3′ untranslated region (UTR) with a poly(A) tail [2], and the large single ORF encodes a polyprotein that proteolytically matures to generate four structural (VP1, VP2, VP3, and VP4) and seven nonstructural (2 A to 2 C and 3 A to 3D) proteins [3]. The structural protein VP1 is located on the surface of the virion and exposed to immune pressure, showing greater variability in comparison to the other proteins. Currently, 20 genotypes (EV-G1 to EV-G20) have been identified based on the divergence of the VP1 gene nucleotide sequence [4], and most of them (EV-G1 to −4, −6, −8 to −15, and − 17 to −19) are isolated or detected in swine (domestic pigs and wild boars), while EV-G5 and − 7 are isolated from sheep, and EV-G20 is isolated from goats [4].

To date, EV-Gs have been reported in pigs in the UK, China, Japan, the USA, Korea, Brazil, Germany, Hungary, Vietnam, Scotland, and Thailand [3, 5–8], and co-infections of numerous EV-G genotypes or EV-Gs and other diarrhea-causing pathogens have been identified in the diarrheic feces of pigs in many countries [9–11]. Generally, EV-G infection is asymptomatic in host animals, but some diseases (neurological disorders, fertility disorders, diarrhea, and dermal lesions) have been reported [2], and co-infections of different genotypes of EV-G or other enteropathogenic viruses (Sapelovirus, Sapovirus, Teschovirus, Astrovirus, Torovirus, Porcine epidemic diarrhea virus, Rotavirus, Transmissible Gastroenteritis Virus) have been observed in some cases [2, 8]. In light of the discovery of the recombination strains between the papain-like cysteine protease (PLCP) gene of Torovirus and EV-G, the potential pathogenicity of EV-G should be re-evaluated [4, 12, 13].

There are some methods for EV-G detection, including virus isolation, antigen detection [14], and molecular methods [15–17]. However, virus isolation and antigen detection are time-consuming and require complex methods and facilities. The molecular methods include reverse transcription–polymerase chain reaction (RT-PCR) [15], quantitative RT-PCR (qRT-PCR) [16], recombinase polymerase amplification (RPA) and polymerase spiral reaction (PSR) [17]. While RT-PCR and qRT-PCR are specific, sensitive, and commonly used for virus detection, they require expensive equipment and trained personnel and involve sophisticated procedures, rendering them unsuitable for on-the-spot, rapid diagnostics in field situations. RPA and PSR methods needed to utilize fluorescence dye “picogreen” to visualize the resluts [17]. Loop-mediated isothermal amplification (LAMP), developed in 2000 [18], has been widely applied for diagnosing various human and animal pathogens, offering high sensitivity, specificity, rapidity, and simplicity [19–21]. However, an RT-LAMP method for detecting EV-G has not been developed. In this study, we established a highly sensitive and visual RT-LAMP assay for the detection of EV-G and evaluated the method using fecal samples collected from EV-G-infected experimental piglets. Additionally, we analyzed field fecal samples randomly collected from pig farms.

Materials and methods

Sources of test samples

One EV-G1 strain (Genbank No. PP801035.1), two EV-G6 strains (Genbank No. PP801037.1, PP681284.1), and two EV-G17 strains (Genbank No. PP801036.1, OQ988093.1) were isolated from pig farms in Yunnan Province in our previous study [12, 22], and the EV-G17 strain (Genbank No. OQ988093.1; Strain No: EV-G/YN23/2022, Virus titer: 2 × 10⁶ PFU/mL) was selected for primer screening and reaction conditions optimizating. Porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine rotavirus (PoRV), porcine pseudorabies virus (PRV), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine parvovirus (PPV), and porcine circovirus 2 (PCV-2) vaccine strains were obtained from Zhongmu Industrial Co., LTD (Beijing, China). The nucleic acid of porcine sapelovirus (PSV), porcine sapovirus (PSaV), porcine teschovirus (PTV), porcine astrovirus (PAstV) and porcine torovirus (PToV) were derived from the clinical samples sent to our laboratory for pathogen diagnosis. A total of 140 fecal samples, consisting of 60 samples collected from EV-G-infected experimental piglets and 80 field samples collected from 4 pig farms (Table S1) in Yunnan Province in October of 2022, were used to evaluate the method’s performance in detecting viral RNA of the clinical samples. 0.5 gram of each fecal sample was taken into a 2 mL centrifuge tube with 1×PBS buffer, and vortexed for 3 min, and then centrifuge at 8,000 r/min for 5 min. Then the supernatant were collected for viral RNA extraction. We used the MagMAX™−96 Viral RNA Isolation Kit on a KingFisher Flex platform (Applied Biosystems, Pittsburgh, PA, USA) to extract the viral RNA from 50 µL of a virus-infected cell culture or homogenized fecal supernatant.

Primer design

To design the RT-LAMP primers, we downloaded 133 5’ untranslated-region (5’-UTR) sequences of EV-G from Genbank and aligned them with the 5’-UTR of five EV-G strains that had been obtained in our previous study. The 5’-UTR sequence from 215 nt to 520 nt of the EV-G/YN23/2022 (GenBank No. OQ988093.1) was selected as a template to design the primers. Five RT-LAMP primer sets were designed using the online software Primer ExplorerV4 (http://primerexplorer.jp/e/). Each primer set comprised two outer primers (F3 and B3), two inner primers (FIP and BIP), and one loop primer (LF or LB). To analyze the matching degree between the primers and the 5’-UTR regions of each genotype, the sequence of each primer was compared with the 5’-UTR sequences of 20 EV-G genotypes (Table 1, Table S2).

Table 1.

The optimal primers used in this study

Primer	Sequence (5’−3’)	Position	Ratio of perfect match
EV-G-F3-5	TGTACCCACGGCCGAAG	237–253	92.75% (128/138)
EV-G-B3-5	CCGGAGGACTACCAACTAGC	469–488	91.30% (126/138)
EV-G-FIP-5 (F1c-F2)	TGAGCGAAACGCCAAGACAGAT-	F1c: 308–329,	86.96% (120/138)
	TATCCGGCCAGCTACTTCG	F2: 268–286	89.13% (123/138)
EV-G-BIP-5 (B1c-B2)	GATGGGTCTCCGCATHCCCCAC-	B1c: 357–378,	91.30% (126/138)
	ATGGCGTCCTATGGCTTTC	B2: 420–438	92.75% (128/138)
EV-G-LB-5	CTTTGATGYTACTAGGCTTC	288–307	81.16% (112/138)

Primer screening

To assess the amplification performance of the designed primer sets, the RT-LAMP reaction was performed in volumes of 25 µL, which contained 1.6 µmol of FIP and BIP, 0.2 µmol of F3 and B3, 0.4 µmol of LF or LB, 1× colorimetric LAMP master mix (New England Biolabs, Ipswich, MA, USA), and 3 µL of EV-G/YN23/2022 RNA. The WarmStart colorimetric master mix contains a low-Tris reaction buffer with all the necessary co-factors at optimized concentrations for the LAMP assay with Bst 2.0 WarmStart DNA polymerase in the presence of 8 mmol of MgSO₄ in addition to phenol red dye, a sensitive pH indicator that changes color from pink to yellow in a low-buffer formulation during amplification. The RT-LAMP assay was performed in a constant-temperature water bath (Tiangen Biotech Co., Ltd., Beijing, China), and the reaction conditions were 64 ℃ for 60 min, with subsequent heating at 80 °C for 5 min to terminate the reaction. Additionally, the amplified products were analyzed through 1.5% agarose gel electrophoresis to observe the LAMP-specific ladder-like DNA bands using an ultraviolet-light transilluminator (Bio-Rad Lab., USA), and the gray-value of the electrophoretic bands were measured using the ImageJ software v1.8.0 [23]. To screen the optimal primer set, the EV-G/YN23/2022 RNA was diluted 10-fold using RNase free dH₂O, and the 10²-, 10⁴-, 10⁶-, and 10⁸-fold-diluted RNA were detected using primer sets 1, 4, and 5 using the same reaction components and conditions.

Optimization of RT-LAMP reaction conditions

To optimize the reaction conditions, EV-G/YN23/2022 RNA was used as template. Firstly, the RT-LAMP assay was performed at 6 different temperatures (58, 60, 62, 64, 66 and 68 ℃) for 60 min, and then the reaction mixtures were heated at 80 °C for 5 min to terminate the reaction. The amplification results were evaluated according the color change of the reaction mixtures and the intensity of the electrophoresis bands of the amplification products. Subsequently, the RT-LAMP assay was carried at 64 ℃ for different reaction times (15, 30, 45, 60, and 75 min) to determine the optimal reaction time. Finally, we performed the RT-LAMP assay using five different primer groups with varying concentrations and ratios (Table 2) at the optimal reaction temperature and time. The gray-value of the electrophoretic bands were measured using the ImageJ software v1.8.0 [23].

Table 2.

Five primer groups with varying concentration and ratios

Primer name	Concentration of the Primer (µmol·L−1)
	Group 1	Group 2	Group 3	Group 4	Group 5
EV-G-F3/B3	0.2	0.2	0.2	0.2	0.2
EV-G-FIP/BIP	0.4	0.6	0.8	1.6	2.0
EV-G-LF	0.2	0.4	0.6	0.8	1.0

Comparison of the sensitivity of RT-LAMP, qRT-PCR, and RT-PCR

To estimate the limit of detection (LOD) of the established RT-LAMP assay, the number of viral copies of the EV-G/YN23/2022 RNA was determined using the EV-G-specific qRT-PCR method developed in our previous study [12]. Serial 10-fold-diluted (4.68 to 4.68 × 10⁵ copies/µL) EV-G/YN23/2022 RNAs were tested using the RT-LAMP assay developed in this study under the optimal reaction conditions, and the same samples were detected using the qRT-PCR method developed in our previous study [12], as well as the conventional RT-PCR method developed by Zell R [24].

Test of the specificity of the RT-LAMP assay

To assess the specificity of the RT-LAMP assay, the RNA of five EV-G strains isolated from Yunnan in 2022 and that of another 13 viruses (PEDV, TGEV, PoRV, PRV, CSFV, PRRSV, PPV, PCV-2, PSV, PSaV, PTV, PAstV and PToV) were tested using our RT-LAMP assay under the optimal reaction conditions, and the nucleic acid of uninfected porcine kidney (PK-15) cells and EV-G-negative porcine fecal sample were tested as negative controls.

Clinical samples test

To verify the reliability of the RT-LAMP assay, 60 feces swabs collected from pigs that were infected with EV-G/YN23/2022 in our previous study were analyzed using the newly developed RT-LAMP assay, the qRT-PCR method developed in our previous study [12], and the conventional RT-PCR developed by Zell R [24]. Additionally, 80 feces samples collected from pig farms were tested using our EV-G RT-LAMP assay, the previously reported qRT-PCR method [12], and conventional RT-PCR [24].

Statistical analysis

Cohen’s kappa coefficient (k) was calculated with SPSS Statistics software version 26 (SPSS Inc., Chicago, IL, USA) to measure the consistency of the different detection methods. k ≧ 0.8 was considered perfect consistency, 0.61 < k < 0.8 was considered substantial consistency, 0.41 < k < 0.6 was considered good consistency, and k ≦ 0.4 was considered low consistency [20].

Results

Primer screening

Five RT-LAMP primer sets targeting the 5’-UTR of the EV-G/YN23/2022 strain were designed (Table S1), and the preliminary screening results were shown in Fig. 1. With the exception of primer set two, other primer sets could amplify the nucleic acids of EV-G/YN23/2022. We measured the intensity of the electrophoretic bands of the reaction products, and the mean intensity of the products of the primer set 3 was minimum (Table S3), so we excluded primer set 3. To screen the optimal primer set, the EV-G/YN23/2022 RNA was diluted 10-fold, and the 10²-, 10⁴-, 10⁶-, and 10⁸-fold-diluted RNA were detected using primer sets 1, 4, and 5 using the same reaction components and conditions. As shown in Fig. 2, the amplification efficiency of primer set 5 was the highest, so it was selected for further analysis.

Fig. 1.

Preliminary screening of the primer sets. Five primer sets were used to amplify the RNA of EV-G/YN23/2022. Tubes 1, 3, 5, 7, and 9 contained EV-G/YN23/2022 RNA as templates, and tubes 2, 4, 6, 8, and 10 contained uninfected PK-15 cell RNA, serving as negative controls. The upper panel (A) shows the image of the agarose gel electrophoresis of the RT-LAMP reaction products (M: molecular weight marker (DL 2000 bp). The lower panel (B) shows the colorimetric visualization of the RT-LAMP reaction mixtures

Fig. 2.

Evaluation of the amplification efficiency of the primer sets. To evaluate the amplification efficiency of the primers, serial 100-fold-diluted EV-G/YN23/2022 RNA was tested using primer sets 1, 4, and 5. The upper panel (A) shows the image of the agarose gel electrophoresis of the RT-LAMP reaction products, M: molecular weight marker (DL 2000 bp). The lower panel (B) shows the colorimetric visualization of the RT-LAMP reaction mixtures

Optimization of the RT-LAMP reaction conditions

To optimize the reaction temperatures, the RT-LAMP assay was performed at six different temperatures. As shown in Fig. 3, slight electrophoretic bands and color changes of the amplification products at 60 ℃ were observed. However, the amplicons obtained at 64 ℃ showed the higher intensity and most prominent color changes than the amplicons subjected to other reaction temperatures; Furtherly, we measured the gray-value of the electrophoretic bands of the reaction products, and the mean gray-value of the products at 64 ℃ were the max (Table S3). All the results indicated the optimum temperature for the RT-LAMP was 64 ℃.

Fig. 3.

Optimization of RT-LAMP reaction temperature. To obtain the optimal reaction temperature, the RT-LAMP reaction was performed at different temperatures; from tube 1 to 5, the reaction temperatures were set at 58 ℃, 60 ℃, 62 ℃, 64 ℃, 66 ℃, and 68 ℃. The upper panel (A) shows the image of agarose gel electrophoresis of the RT-LAMP reaction products, M: molecular weight marker (DL 2000 bp); The lower panel (B) shows the colorimetric visualization of the RT-LAMP reaction mixtures

To determine the optimal reaction time, the RT-LAMP assay was carried out for different reaction times at 64 ℃. The results showed that the reaction mixtures changed color from pink to yellow within 30 min (Fig. 4B), indicating the initiation of amplification; however, the electrophoretic bands of the amplicons were more intense after a 45 min reaction (Fig. 4A). Additionally, the amplification results were not improved after increasing the reaction time to 60–75 min (Fig. 4A and B). Furtherly, the gray-values of the electrophoretic bands of the reaction products were measured, and the mean gray-value of the products of 45 min, 60 min, and 75 min were roughly consistent (Table S3), and they were all higher than the gray-values of the products of 20 min and 30 min. Therefore, the optimal reaction time for the RT-LAMP assay was determined to be 45 min.

Fig. 4.

Optimization of RT-LAMP reaction time. To determine the optimal reaction time, the RT-LAMP reaction was performed for different reaction time. From tube 1 to 5, the reaction time was set at 20 min, 30 min, 45 min, 60 min, and 75 min. The upper panel (A) shows the image of agarose gel electrophoresis of the RT-LAMP reaction products, M: molecular weight marker (DL 2000 bp); The lower panel (B) shows the colorimetric visualization of the RT-LAMP reaction mixtures

To optimize the concentrations of the primers, the RT-LAMP assay was performed using five primer groups with different concentrations (Table 2). As shown in Fig. 5, the electrophoretic band of primer group 3 was more intense than the bands in the other groups, and we measured the intensity of the electrophoretic bands of the reaction products, and the mean intensity of the products of the primer group 3 was max (Table S3). So, we confirmed that the optimal incubation conditions for the RT-LAMP assay were 64 °C for 45 min and that the optimal concentration (µmol·L⁻¹) of the primer F/B: FIP/BIP: LF was 0.2 : 0.8 : 0.6, and all subsequent reactions were performed under these validated conditions.

Fig. 5.

Optimization of the primer concentration. To optimize the primer concentration, the RT-LAMP reaction was performed using five primer groups with different concentration. The upper panel (A) shows the image of agarose gel electrophoresis of the RT-LAMP reaction products, M: molecular weight marker (DL 2000 bp); The lower panel (B) shows the colorimetric visualization of the RT-LAMP reaction mixtures

Sensitivity of the RT-LAMP, qRT-PCR, and RT-PCR methods

The LODs of the RT-LAMP, qRT-PCR, and RT-PCR assays were evaluated using serially 10-fold-diluted (4.68 to 4.68 × 10⁵ copies/µL) EV-G/YN23/2022 RNA. The results showed that the LODs of the RT-LAMP assay, conventional RT-PCR, and the qRT-PCR assay were 46.8 copies/µL (Fig. 6A and B), 4.68 × 10³ copies/µL RNA (Fig. 6C), and 46.8 copies/µL (the Ct value was 36.9) (Fig. 6D), respectively. Thus, the LOD of RT-LAMP was a hundredfold lower than that of the conventional RT-PCR and consistent with that of the qRT-PCR method.

Fig. 6.

Comparison of the sensitivities of RT-LAMP, conventional RT-PCR, and qRT-PCR. Serial ten-fold dilutions of EV-G/YN23/2022 RNA were used to determine the limit of detection (LOD) of the different methods. Tubes 1 to 6 contained from 4.68 × 10⁵ to 4.68 copies/µL of EV-G/YN23/2022 RNA, and tube N contained uninfected PK-15 cells RNA as a negative control. Panel (A) shows the image of agarose gel electrophoresis of the RT-LAMP reaction products; M: molecular weight marker (DL 2000 bp). Panel (B) shows the colorimetric visualization of the RT-LAMP reaction mixtures. Panel (C) shows the image of agarose gel electrophoresis of the RT-PCR reaction products; M: molecular weight marker (DL 2000 bp). Panel (D) shows the amplification curve of the qRT-PCR reaction

Specificity of the RT-LAMP method

The specificity of the RT-LAMP assay was determined by testing EV-G isolates and various porcine pathogens. As expected, changes in color from pink to yellow and a typical ladder-like band pattern were observed in the reaction tube containing EV-G RNA as template (Fig. 7A and B), while the test results for the other viruses’ RNA and cell-culture-derived nucleic acids and EV-G-negative porcine fecal sample nucleic acids were all negative (Fig. 7). The results demonstrated that the RT-LAMP assay was specific for EV-G, with no cross-amplification with the other porcine viruses tested observed.

Fig. 7.

Specificity test of the RT-LAMP reaction. Tubes 1 to 5 used RNA of five EV-G isolates as templates; tubes 6 to 14 contain RNA of PEDV, TGEV, PoRV, PRV, CSFV, PRRSV, PPV, PCV-2, PSV, PSaV, PTV, PAstV and PToV as templates; tube N1 used total RNA extracted from normal PK-15 cells as a negative control; tube N2 used total RNA extracted from EV-G-negative porcine fecal sample as another negative control. Panel (A) shows the image of agarose gel electrophoresis of the RT-LAMP reaction products; M: molecular weight marker (DL 2000 bp). Panel (B) shows the colorimetric visualization of the RT-LAMP reaction mixtures

Clinical samples test

To verify the reliability of the RT-LAMP assay, 60 feces swabs collected from pigs infected with EV-G/YN23/2022 in our previous study [12] were analyzed. All the samples tested using RT-LAMP and the qRT-PCR method were positive; however, some of the samples that were collected in the initial and later phases of infection were negative detected by the conventional RT-PCR (Table 3). The results indicate that the newly developed RT-LAMP method can effectively detect EV-G nucleic acids in pig feces at different infection stages.

Table 3.

Detection results of feces swabs collected from experimentally infected pigs

		Days post EV-G/YN23/2022 infection
		1	2	3	4	5	6	7	8	9	11	13	15	17	19	21
No. of positive samples for	RT-LAPM	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4
	qRT-PCR	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4
	RT-PCR	1	2	3	4	4	4	4	4	4	4	4	3	3	2	2

Subsequently, 80 feces samples collected from pig farms were tested using the newly developed EV-G RT-LAMP assay, the previously reported qRT-PCR method [12], and conventional RT-PCR [24]. As shown in Table 4, the RT-LAMP and qRT-PCR methods detected 61 positive samples, and the Kappa coefficient was 0.862 (P < 0.01), while RT-PCR detected 40 positive samples, and the Kappa coefficient with RT-LAMP was 0.475 (P < 0.01). Generally, the established RT-LAMP assay showed good clinical performance and could be used as an alternative to qRT-PCR for the detection of EV-G in clinical samples.

Table 4.

Results of three different nucleic acids detection methods

Method	Result	Result of RT-LAMP		Kappa coefficient	P Value
		Positive	Negative
qRT-PCR	Positive	59	2	0.862	< 0.01
	Negative	2	17
RT-PCR	Positive	40	0	0.475	< 0.01
	Negative	21	19

Discussion

The size of the EV-G genome is approximately 7.5 kb, and the length of the 5’UTR is about 800 bp [12]. The 5’UTR sequence is more conserved than other regions in the EV-G genome, and the sequence variability of the 5’UTR of different EV-G genotypes is very low, and so it is always selected as the optimal target region for designing the “Group-specific”detection primers [16]. To design RT-LAMP primers for detecting EV-G, a total of 138 sequences of the 5’UTR covering 20 EV-G genotypes were aligned and analyzed, and the most conserved regions were used to design the primers. We used the degenerating base H in the B1c primer and Y in the LF primer, which promoted the matching of the primers. Although only five EV-G strains (one EV-G1 strain, two EV-G6 strains, and two EV-G17 strains) were used to verify the specificity of the RT-LAMP method developed in this study, we believe that the primers we designed should match well with other-genotype EV-G strains because the target sequences of the primers are relatively conserved in different-genotype strains. Furthermore, to evaluate the detection performance of the established RT-LAMP method, 80 clinical samples were tested using three methods (RT-PCR, qRT-PCR, and RT-LAMP). The results showed that the Kappa coefficient of RT-LAMP and qRT-PCR was 0.862, indicating RT-LAMP showed good performance in detecting the clinical samples. Although the genotypes of EV-G in the samples were unknown, we speculated that 59 (RT-LAMP) or 61 (qRT-PCR) of the EV-G-positive samples of the 80 clinical samples may have contained different EV-G genotypes, potentially proving the universality of the RT-LAMP method we developed for different EV-G genotypes. In addition, the RT-LAMP method we developed used a total of five primers and can specifically recognize seven independent target sequence regions in the 5’UTR of the EV-G genome; in comparison, the RT-PCR and qRT-PCR primers can recognize only two or three independent regions, respectively. Therefore, the specificity of our RT-LAMP method is higher than that of RT-PCR and qRT-PCR.

The LOD of the RT-LAMP assay was 46.8 copies/µL, which is consistent with the previously reported qRT-PCR method [12]. The results indicated that RT-LAMP can not only detect EV-G in cell cultures with high virus titers but also in samples with low virus loads. We analyzed clinical samples collected at different times after EV-G infection using three methods (RT-PCR, qRT-PCR, and RT-LAMP). The results showed that the RT-LAMP and qRT-PCR methods effectively detected EV-G nucleic acid in the samples collected at 1 dpi to 21 dpi, indicating that the RT-LAMP method established in this study can detect EV-G at different stages of infection and shows good potential for use in detecting this virus in randomly collected clinical samples.

Adding one or two loop primers into the RT-LAMP reaction systems can increase the starting point of DNA synthesis and accelerate the amplification rate of RT-LAMP; eventually, the reaction time of RT-LAMP will be shortened to 1/2 to 1/3 of the original time without loop primers [25]. When designing the RT-LAMP primers, we attempted to design two loop primers. However, only one loop primer (LF) matched the design parameters after screening, and the LAMP reaction was indeed accelerated by using this loop primer. Although we ultimately determined that the optimal reaction time was 45 min, obvious color changes and typical gradient electrophoresis bands could be observed within 30 min, indicating that positive results can be obtained within 30 min for samples collected in the virus-shedding stages and that this method is faster than conventional RT-PCR or qRT-PCR.

Several methods have been used to detect the amplification results of the LAMP reaction based on different theories. For example, pyrophosphate ions are produced as a byproduct of the LAMP reaction, generating white precipitations of magnesium pyrophosphate, which can be detected using a specialized turbidity machine or by the naked eye [26]. A large amount of magnesium pyrophosphate is required for visual observation; therefore, the reaction requires a long incubation time (at least 1 h). In fact, it was not easy to observe the precipitate directly via the naked eye. Calcein is a fluorescent metal indicator that can be quenched with manganous ions before amplification reaction. As the LAMP reaction progresses, manganous ions combine with the newly generated pyrophosphate ions, and calcein is released; it then combines with the residual magnesium ions, producing greater fluorescence [27]. However, manganous ions can inhibit polymerase reactions, and a change in the magnesium ion concentration may affect the activity of polymerase [28]. Additionally, a handheld UV lamp (wavelength: 365 nm) was needed to observe the fluorescence because it was difficult to discern the subtle changes by eye in the reaction solution with little template [28]. Hydroxynaphthol blue (HNB) is a metal indicator. It emits violet when bonded to magnesium ions in the initial stage of the LAMP reaction, and this color changes to sky blue when the magnesium ions are replaced by the pyrophosphate ions as the LAMP reaction proceeds [29]. However, the change in color from violet to sky blue is not obvious. SYBR green is an intercalating nucleic acid dye that can be added to reaction solutions for real-time and visual detection, but special UV illumination is needed to detect the signals [30]. Moreover, any amplified double-stranded DNA will be dyed by SYBR green, leading to false-positive results. Recent years, several pH-dependent colour indicators (phenol red, Xylenol Orange, Neutral Red) have been utilized to develop the visual LAMP detection method [21, 28, 31].

In this study, we used a WarmStart LAMP Kit (NEB, E1700L) as a reaction reagent. This kit contained a low-concentration reaction buffer in alkaline pH conditions, and phenol red was initially red in this reaction mix. As the LAMP reaction progressed, a pyrophosphate moiety and a hydrogen ion were produced as byproducts, and the pH of the reaction buffer changed from alkaline to acidic; correspondingly, the color of phenol red changed from pink to yellow. This color change was easily observed by the naked eye without any accessories [28]. LAMP is more convenient than other methods, making it more suitable for point-of-care and field applications. Moreover, the phenol red did not affect the activity of the polymerase, so it was added into the reaction buffer beforehand. It also avoided the risk of contamination by the high concentrations LAMP reaction products because it did not require the opening of the tubes.

The RT-LAMP assay established in this study could be completed in a constant-temperature water bath within 45 min, and the results could be observed by the unaided eye directly with the use of colorimetric LAMP master mix. Additionally, this method avoided the risk of contamination by the massively amplified LAMP products. Furthermore, this method showed high sensitivity and reliability in detecting EV-G in the clinical samples, suggesting it can be used as a point-of-care test tool for the diagnosis and epidemiological surveillance of EV-G.

Conclusions

In this study, a visual, sensitive, specific, and convenient RT-LAMP method was developed. This method showed high sensitivity and reliability in relation to detecting EV-G in clinical samples and can be used as a point-of-care test tool for the diagnosis and epidemiological surveillance of EV-G.

Abbreviations

EV-G

Enterovirus G

RT-LAMP

Reverse transcription loop-mediated isothermal amplification

LOD

Limit of detection

RT-PCR

Reverse transcription polymerase chain reaction

qRT-PCR

Quantitative reverse transcription polymerase chain reaction

ORF

Open reading frame

UTR

Untranslated region

PLCP

Papain-like cysteine protease

HNB

Hydroxynaphthol blue

Authors’ contributions

Zhan-hong Li: Conceptualization, Methodology, Formal analysis, Validation, Writing–original draft. Zhen-xing Zhang: Methodology, Data curation, Validation. Pei Zhu and Zhuo-ran Li: Methodology, Data curation. Peng Liu, Qi Yang, Qiu-yan Yang, and Zhen Yang: Resources, sample collection. Jian-ling Song: Project administration, Funding acquisition, Resources, Supervision. Zhan-hong Li and Zhen-xing Zhang have contributed equally to the work.

Funding

This study was funded by the Project of Innovation Guide and S&T Enterprise Cultivation of Yunnan Province (202304BI090001); the Major Science and Technology Project of Yunnan Province (202102AE090039).

Data availability

Data is provided within the manuscript or supplementary information files.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.