Skip to main content
PLOS Pathogens logoLink to PLOS Pathogens
. 2025 Aug 18;21(8):e1013029. doi: 10.1371/journal.ppat.1013029

LANA-dependent transcription-replication conflicts and R-loops at the terminal repeats (TR) correlate with KSHV episome maintenance

Asim Asghar 1, Olga Vladimirova 1, Asher Sobotka 1, James Hayden 1, Jayamanna Wickramasinghe 1, Jayaraju Dheekollu 1, Moeko Minakuchi 1, Leena Yoon 1, Maureen E Murphy 1, Kazuko Nishikura 1, Paul M Lieberman 1,*
Editor: Blossom Damania2
PMCID: PMC12396754  PMID: 40825050

Abstract

Transcription-replication conflicts frequently occur at repetitive DNA elements involved in genome maintenance functions. The KSHV terminal repeats (TR) function as the viral episome maintenance element when bound by the viral encoded nuclear antigen LANA. Here, we show that transcription-replication conflicts occur at or near LANA binding sites in the TR. We show by proximity ligation assay (PLA) that PCNA and RNAPII colocalize with LANA-nuclear bodies (LANA-NBs). Using DNA-RNA-IP (DRIP) assays with S9.6 antibody, we demonstrate that R-loops form at the TR. We find that these R-loops are also associated with histone H3pS10 a marker for R-loops associated with transcription-replication conflicts. Inhibitors of RNAPII eliminated R-loop formation at TR and reduced active histone modifications H3K4me3 and H3K27ac, with a corresponding increase in heterochromatic H3K9me3. RNAPII inhibitors also disrupted LANA binding to the TR, but did not eliminate LANA-NBs. We show that LANA can induce R-loops on a plasmid containing 8, but not 2 copies of the TR, and that the N-terminal histone binding function of LANA is required for this activity. RNaseH treatment eliminated R-loops and reduced LANA binding to the TR. Taken together, our study indicates that LANA induces histone modifications associated with RNA and DNA polymerase activity and the formation of R-loops that correlate with episome maintenance function. These findings provide new insights into mechanisms of KSHV episome maintenance during latency and more generally for genome maintenance of repetitive DNA.

Author summary

KSHV latent infection is responsible for Kaposi’s Sarcoma (KS) and Pleural Effusion Lymphoma (PEL). KSHV latency and persistence depends on LANA binding to the terminal repeats (TR). We show that LANA binding promotes the formation of R-loops associated with transcription-replication conflicts and histone H3pS10 at the KSHV terminal repeats. These epigenetic features depend on active RNA polymerase at the TR and correlate strongly with KSHV episome maintenance function. The findings suggest a novel mechanism of chromatin structural maintenance dependent on LANA binding at the TR during KSHV latency.

Introduction

Genome maintenance elements, such as telomeres and centromeres, typically consist of arrays of repetitive genetic elements recognized by sequence-specific factors that assemble into a higher-order structure and confer functions essential for genome protection, replication and segregation during cellular division [1,2]. The terminal repeats (TRs) of the Kaposi Sarcoma-Associated Herpesvirus (KSHV), also known as HHV8, consists of a highly GC-rich ~800 bp repeat element that serves as a selective binding site for the viral protein LANA and function as both origin of DNA replication and episome maintenance element in latently infected host cells [3–5]. Like human telomeres and centromeres, the KSHV TR provides genome protection and higher-order structure that can influence transcription both locally and at distal genetic sites [6].

KSHV is an oncogenic human gammaherpesvirus that is responsible for Kaposi’s sarcoma (KS) and pleural effusion lymphomas associated with HIV AIDS. KSHV is also a causative agent of multicentric Castleman’s Disease (MCD) [7,8]. KSHV establishes a long-term latent infection in B-lymphocytes where it persists as a multi-copy covalently closed minichromosome of ~170,000 kb, referred to as the viral episome [9,10]. Cellular chromatin assembles on the KSHV episomes to repress most of the viral genes and maintain a stable latent state [11,12]. Maintenance of the latent state requires the expression of the viral-encoded Latency Associated Nuclear Antigen (LANA). LANA regulates the latency program of the virus by binding to three sites within the 800 bp TR unit that are repeated up to 30 copies per genome [13–15]. Episome maintenance function requires at least 8 copies of the TR, while DNA replication requires only the 2 LANA binding sites within each single TR unit [9]. LANA also forms large foci at the TR of each viral episome suggesting that a higher-order structure is an important regulatory feature of the KSHV episome maintenance function [9,16,17].

LANA consists of two major subdomains important for its functional activity in viral episome maintenance. The C-terminal domain of LANA comprises the sequence-specific DNA binding domain (DBD) which can form higher order oligomeric structures on DNA [14,18]. The N-terminal domain enables tethering to the metaphase chromosome [19,20] and can interact directly with an acidic patch in histones H2A/B which correlates strongly with viral replication and episome maintenance activity [21,22]. The N-terminal domain can also interact with components of the transcriptional co-activator complex MLL1, which can modify both histones and RNA polymerase II to promote active transcription [23]. Cellular replication factors, including origin binding proteins (ORCs) and minichromosome maintenance (MCMs) responsible for the initiation of DNA replication are found to be enriched at LBS sites in the TR [11] and LANA can co-immunoprecipitate with proliferating cell nuclear antigen (PCNA) [24]. Nucleosomes are also found to assemble around the LBS in the TR, and these are marked by specific modifications that vary across the cell cycle [11,25,26]. Whilst the bulk of the KSHV genome is marked by repressive H3K27me3 and H3K9me3, the TR is subject to cell cycle enrichment of H3K4me3 and H3K27ac, characteristic of an open chromatin structure [11]. The TR can have bivalent chromatin since it can also associate with H3K27me3 [25], and function as a transcriptional enhancer for viral lytic cycle genes [6,25]. LANA can also interact with other chromatin regulatory factors, including BRD4, ADNP, and CHD4 [6,25]. The histone H3.3 chaperone DAXX has also been found to bind LANA and colocalize with LANA-nuclear bodies on KSHV episomes [17,27]. Although not directly interacting with LANA, the chromatin organizing factors CTCF and cohesin are enriched near the LANA binding sites (LBS) within the TR [28,29]. Precisely how these factors work together to orchestrate the LANA-dependent episome maintenance function at the KSHV TR remains only partly understood.

Replication and transcription machinery may translocate along the same DNA template, often in opposing directions and at different rates leading to transcription-replication conflicts (TRCs) [30,31]. High GC content and repetitive DNA can further lead to challenges for both transcription and DNA replication that further promote TRCs. Tightly bound proteins, such as arrays of LANA binding sites in the TR may also promote replication fork pausing that can also lead to TRCs. Unresolved TRCs can lead to catastrophic genome instability and cell cycle arrest. On the other hand, some TRCs may provide specialized features such as formation of higher-ordered chromatin structures that facilitate the maintenance of repetitive genetic elements. Here, we show that LANA binding to the KSHV TR leads to the colocalization of transcription and replication machinery. This leads to the formation of an RNA-DNA hybrid, or R-loop, that is associated with histone H3pS10, a signal typically observed at transcription-replication conflicts and also on condensed mitotic chromosomes. We propose that LANA induces these epigenetic features at the KSHV TR to facilitate both dynamic activity and protective condensation necessary for stable maintenance of the viral episome during latency.

Results

Colocalization of transcription and replication factors at the KSHV TR

Previous studies have identified histone modifications and epigenetic factors that localize with LANA at the KSHV TRs. We used ChIP-qPCR to confirm that H3K27ac, H3K4me3, CTCF, and RAD21 are enriched at the LBS region of the TR in latently infected BCBL1 and iSLK cell lines (S1 Fig). We next asked whether DNA replication factors associated with active replication forks, including MCMs and PCNA colocalize with RNA polymerase phospho-isoforms associated with either elongating (pS2) or promoter proximal pausing (pS5) are also colocalized at the TR (Fig 1). ChIP-qPCR demonstrated that PCNA, MCM2, along with RNA Pol II pS2 and pS5 are all selectively enriched at TR relative to control IgG and relative to other regions of the KSHV genome, such as ORF45 and ORF75 (Fig 1A-1C). To determine if replication and transcription factors were spatially and temporally colocalized with LANA at the TR, we performed proximity ligation assays (PLA) combined with immuno-fluorescence imaging in KSHV infected iSLK cells (Fig 1D and 1E). We performed PLA with antibodies to PCNA as a marker for DNA replication forks and with either RNAPII pS2 or pS5. Colocalizations detected by PLA were visualized by green fluorescence and were only observed when both pairs of antibodies were present, but not in control samples lacking primary antibodies (Fig 1C). Numerous colocalizations were observed for PCNA with both pS2 and pS5, and are likely to represent many expected sites of co-incident transcription and replication throughout the cellular genome. PLA signals were then assayed for their colocalization with RFP-LANA nuclear bodies in iSLK cells latently infected with KSHV genomes expressing RFP-LANA. We found that ~30% of LANA-NBs colocalized with RNAPII pS5 and ~15% colocalized with RNAPII pS2. This suggests that nearly one third of LANA-NBs have coincidence of replication forks (PCNA) with RNA polymerase II pS5 and to a lesser extent pS2.

Fig 1. Colocalization of transcription and replication machinery with LANA at KSHV TR.

Fig 1

A. Schematic of the KSHV genome showing the terminal repeats (TR) relative to the unique region open reading frames (blue) and primer positions for TR, ORF45, and ORF75. B and C. ChIP-qPCR for RNAPII pS5, RNAPII pS2, MCM2, PCNA or control IgG assayed at the TR, ORF45 or ORF75 loci in BCBL1 (B) or iSLK (C) cell lines. ** p < .01, *** p < .001, student 2-tailed t-test, n = 3 biological replicates. D. Representative IF microscopy image showing PLA (green) for PCNA+RNAPII-pS2 or PCNA+RNAPII-pS5, RFP-LANA (red), Dapi (blue) and merge. 60X. E. Quantification of IF images showing % colocalization of PLA signal with LANA-NBs. ** p < .01, pairwise Anova.

R-Loops form at TR and colocalize with LANA-NBs

Transcription-replication conflicts frequently coincide with R-loops formed by unresolved RNA-DNA hybrids [32,33]. R-loops have been previously identified in the KSHV TR as well as the ORF16 locus [34]. We confirmed these findings using the S9.6 monoclonal antibody for DNA-RNA IP (DRIP) assay. DRIP revealed that R-loops were detectable at the KSHV TR, but not at other viral loci for ORF45 and ORF75 for BCBL1 (Fig 2A) and BC-1 (S2 Fig). To verify that S9.6 was recognizing RNA-DNA hybrids, we treated the immunopurified material with RNase H, which eliminated the signal from the TR region, as well as from the positive control ORF16 region (Fig 2B). To determine if R-loops colocalize with LANA at LANA-NBs, we performed PLA with antibodies to LANA and S9.6 (Fig 2C). Nuclear dots were detected only when both antibodies were present, indicating that LANA is in close proximity to S9.6 detected R-loop structures.

Fig 2. R-loop formation at the KSHV TR.

Fig 2

A. DRIP assay with BCBL1 cells using S9.6 (blue) or control IgG (black) assayed with primers for cellular actin, KSHV TR, ORF45 or ORF75. B. Same as in panel A, except for KSHV TR or ORF16 and with specificity control RNase H treatment (pink). *** P < .001, student two-tailed t-test. C. PLA analysis of LANA+S9.6 (red signal) in BCBL1 cells. Dapi (Blue). No antibody control is shown in top panel. D. IGV screen shot of RNA transcripts mapped to KSHV TR region using public data sets for GROseq in BCBL1 in latent or lytic conditions (GSM4414007, GSM4414008). The reference map consists of a small region of the unique region with K15 and 2 copies of the TR. TR transcripts Tr(1) and Tr(2) are indicated above. Unique region (UR) is provided for the left end of KSHV including K15 sequence.

To determine if R-loop RNA mapping to the TR could be identified, we analyzed a public Gro-Seq [35] and total RNA-seq [36] datasets for BCBL1. The SRR data set for GRO-Seq (Fig 2D) and total RNA-seq (S2B Fig) both detect a series of transcripts that mapped to the KSHV TR. We identified two transcripts, referred to Tr(1) and Tr(2) that mapped to regions within the TR. The more prominent transcript Tr(1) appears to initiate near LANA binding sites and terminate near the adjacent CTCF binding site. These findings indicate that small RNA fragments are generated within the TR.

H3pS10 localizes to TR and a subset of LANA-NBs

R-loops linked to transcription-replication conflict have been reported to generate phosphorylated histone H3 (H3pS10) during interphase [37]. To determine whether the R-loops at TR were associated with histone H3pS10, we assayed the localization of H3pS10 with TR by ChIP-qPCR (Fig 3A). We found that H3pS10 was highly enriched at TR, but not detectable at ORF45 or ORF75. To assess the cell cycle dependence of these colocalizations we fractionated cells according to their stage of the cell cycle using centrifugal elutriation and then assayed these by ChIP-qPCR (Fig 3B). We found that H3pS10, along with MCM and RNAPII pS2 were highly enriched at the TR in G1 and G1/S. MCM and H3pS10 were observed also in G2 and G2/M. At the control region for ORF16, which also forms an R-loop, we found only RNAPII enrichment in G1 and G1/S phase of the cell cycle (Fig 3C). This suggests that H3pS10 associates with the R-loop at the TR during G1 and G2/M, but does not associate with the ORF16 R-loop at any stage of the cell cycle.

Fig 3. Cell cycle dependent accumulation of H3pS10 at the TR.

Fig 3

A. ChIP-qPCR for LANA, H3pS10 and IgG at the TR, ORF45, ORF50, and ORF75 loci of KSHV in BCBL1 cells. B-C. ChIP-qPCR for RNAPII pS2, MCM, H3pS10 during different stages of the cell cycle using centrifugal elutriation for G1, G1/S, S, Late S, G2, and G2/M. ChIP-qPCR was analyzed at the TR (panel B) or at the ORF16 locus (panel C). D. PLA for H3pS10 + LANA (green), with RFP-LANA (red), Dapi (blue) and merge in RFP-LANA iSLK cells. No-antibody control shown in top panels. Enlarged image of single cells is shown in the right panels. E. Quantification of data for representative IF images shown in panel D. **** p < .00001, **p < 0.01 using two-tailed t test with Mann-Whitney test and Welch’s correction.

To further validate the association of H3pS10 with TR, we performed PLA with H3pS10 and LANA (Fig 3D). These PLA signals were found to colocalize with a significant fraction (~74.5%) of LANA-NBs and were strictly dependent on primary antibody (Fig 3E). Colocalization of H3pS10 with LANA-NBs and replication centers were further analyzed by IF with H3pS10 and PCNA (Figs 4 and S3-S5). We found that PCNA colocalized with ~29.7% of LANA-NBs, H3pS10 colocalized with 26.9% of LANA-NBs, and H3pS10 colocalized with 52.9% of PCNA foci. All three components are colocalized at ~21.7% of LANA-NBs in iSLK cells (Fig 4G, 4H, S3 and S5). Higher resolution confocal microscopy was used to further characterize features of LANA-NBs that contain both H3pS10 and PCNA (S4 and S5 Figs and S1 Movie). LANA-NBs with coincident H3pS10 tended to be larger substructures compared to LANA-NBs lacking these colocalizations. These images indicate that a large subnuclear domain encompassing LANA is frequently colocalized with both PCNA and H3pS10.

Fig 4. IF colocalization of PCNA-H3pS10-LANA in iSLK cells.

Fig 4

A. PCNA (green), LANA (red), Dapi (blue). B. Quantification of the percent of LANA-NBs colocalized with PCNA. C. H3pS10 (green), LANA (red), Dapi (blue). D. Quantification of the percentage of LANA-NBs colocalized with H3pS10. E. PCNA (green), H3pS10 (red), Dapi (blue). F. Quantification of the percentage of PCNA foci colocalized with H3pS10. G. Combined IF with PCNA (green), LANA (red), H3pS10 (blue). H. Quantification of the percentage of LANA-NBs colocalized with H3pS10 and PCNA. N = 4, total of 35 cells, **p < 0.01, student two-tailed t-test.

RNAPII inhibitors disrupt active histones, R-loops, CTCF-cohesin and LANA binding to TR, but not LANA-NBs

The CDK9 inhibitor flavopiridol (FVP) rapidly inhibits RNA polymerase activity by blocking phosphorylation at S2 and preventing elongating RNA synthesis. Treatment of BCBL1 cells with FVP for 15’ or 2 hrs reduced RNAPII pS2, and to a lesser extent pS5 and H3pS10 as measured by Western blot (Fig 5A and S6 Fig). FVP did not affect LANA, CTCF, Rad21, total histone H3, or β-actin levels at these time points (Fig 5A). As expected, RNAP II pS2 binding was significantly reduced at the TR after 15’ and 2 hr treatment with FVP. We also found a significant loss in RNAPII pS5 (Fig 5B). Somewhat surprisingly, we found that FVP treatment eliminated LANA binding to near undetectable levels as early as 15’ post treatment (Fig 5B). To better understand the effects of FVP, we assayed R-loop formation at the TR using DRIP assay with S9.6 antibody (Fig 5C). We found that 15 min of FVP resulted in a ~ 6-fold reduction in DRIP signal. Thus, R-loops are also dependent on RNAPII phosphorylation and continued activity in the TR. We next assayed histone modifications associated with the TR. We found that FVP reduced active histone marks for H3K27ac and H3K4me3, but increased the signal for the heterochromatic mark H3K9me3 (Fig 5D). Total histone H3 also increased after FVP treatment (Fig 5E). To verify the effects of FVP were due to inhibition of RNA polymerase, we tested a second inhibitor of RNA polymerase, triptolide, that works through a different mechanism involving the degradation of RNA polymerase protein (S6 Fig) [38]. Similar to FVP, triptolide treatment led to a drastic reduction in LANA binding to the TR within 15’ treatment (Fig 5F). This correlated with a reduction in RNAPII binding (S6C Fig) and a corresponding increase in histone H3K9m3 (S6D Fig), similar to what was observed with FVP. Both triptolide and FVP led to a loss of CTCF and Rad21 (Fig 5G) suggesting that overall epigenetic structure is disrupted at the TR after RNAPII inhibition. The effects of FVP on LANA-NBs was assessed by IF (S7 Fig). LANA-NBs were significantly reduced, and the appearance of LANA-free nuclei increased after FVP treatment for 24 hrs, but not significantly at 2h, suggesting that other factors may stabilize LANA-NBs. Taken together, these findings indicate that inhibitors of RNA polymerase disrupt LANA binding, R-loops and epigenetic features associated with the TR.

Fig 5. RNA polymerase inhibitors block LANA binding, R-loop formation, and epigenetic programming at the TR.

Fig 5

A. Western blot of LANA, Pol2-pS2, Pol2-pS5, H3pS10, total RNA Pol II, CTCF, Rad21, histone H3, and β-Actin in BCBL1 cells treated with flavopiridol (FVP) for 0, 15 min or 2 hrs. B. ChIP-qPCR for IgG, LANA, RNAPII pS2 or pS5 at the TR in BCBL1 cells treated with DMSO or FVP for 15’ or 2h. C. DRIP assay with S9.6 or IgG for BCLB1 cells treated with DMSO or FVP for 15’ or 2h. D. ChIP-qPCR for H3K4me3, H3K9me3, H3K27ac or IgG in BCBL1 cells treated with DMSO or FVP for 15’ or 2h. E. ChIP-qPCR for LANA or total histone H3 in BCBL1 cells treated with DMSO or FVP for 15’ or 2h. F. ChIP-qPCR for LANA or IgG at TR in BCLB1 cells treated with DMSO, FVP or Triptolide for 15’. G. ChIP-qPCR for CTCF, RAD21 or IgG at TR in BCLB1 cells treated with DMSO, FVP, or Triptolide for 15’. ** p < .01, ***p < .001, two tailed student t-test.

Epigenetic dependencies on LANA and TR repeat number

The functional episome maintenance activity of the TR depends on the number of terminal repeats such that 8xTR is functional but 2xTR is compromised for episome maintenance with ~3 fold less episomes after 12 days (S8 Fig) [39]. We therefore tested whether any of these epigenetic features depend on LANA binding and correlate with 8 but not 2 TR repeats (Fig 6A). We first noted that the 8xTR was enriched for the heterochromatic H3K9me3 in the absence of LANA (Fig 6B, F-Vector). Cotransfection of Flag-LANA resulted in LANA binding, along with enrichment of H3K4me3 and H3K27ac, and decrease in H3K9me3 (Fig 6C, F-LANA). LANA expression also stimulated the assembly of RNAPII pS2 and pS5 (Fig 6D). In contrast to the 8xTR template, the 2xTR template failed to assemble H3K27ac or H3K4me3 despite substantial binding of LANA (Fig 6E). Similarly, RNAPII pS2 and pS5 failed to assemble on 2xTR while they efficiently assemble on 8xTR in the presence of LANA (Fig 6F). R-loops detected by DRIP assay depended on both LANA and 8xTR, as they did not form on 2xTR with LANA or 8xTR lacking LANA (Fig 6G). TR-associated RNA assayed by RT-qPCR was detected from the 8xTR, but not the 2xTR plasmid (Fig 6H). RNAseq confirmed the formation of RNA transcripts at the TR nearly identical to Tr(1) and Tr(2) observed in BCBL1 RNAseq data sets (S9). These findings indicate that TR-RNA, R-loops, RNAPII, active histone modifications required both LANA and 8xTR, while 2xTR was not sufficient.

Fig 6. LANA and TR repeat number dependence of RNA polymerase II activation, epigenetic programming and R-loop formation at the KSHV TR.

Fig 6

A. Schematic of the experimental design for co-transfection of either 2xTR or 8xTR episome templates in combination with either empty FLAG-vector (F-Vector) or vector expressing FLAG-LANA (F-LANA) into 293T cells. Image generated using Biorender icon with license. B. Western blot showing biological triplicates of F-Vector or F-LANA transfected 293T cells probed for FLAG-LANA or β-actin. C. ChIP-qPCR of 8xTR episome template with F-Vector or F-LANA assayed for LANA, H3K4me3, H3K9me3, H3K29ac or IgG. D. ChIP-qPCR for 8xTR episome template with F-Vector of F-LANA assayed for LANA, RNAPII pS2, pS5, or IgG. E. ChIP-qPCR with 2xTR or 8xTR template in the presence of F-LANA assayed for LANA, H3K4me3, H3K27ac, or IgG. F. ChIP-qPCR for 2xTR or 8xTR in presence of F-LANA assayed for RNAPII pS2, pS5 or IgG. G. DRIP with S9.6 or IgG assayed at the TR for BCBL1, 8xTR with F-Vector, 2xTR with F-LANA or 8xTR with F-LANA. H. RT-qPCR analysis of TR RNA using primers TR pr1 or TR pr2 from cells transfected with 2xTR or 8xTR and either F-Vector or F-LANA, and normalized to GAPDH. * < .05, ** p < .01, p < .001, two tailed student t-test.

The presence and function of R-loops at the TR were further assessed using RNase H wild-type (WT) and catalytically dead mutant (MT) tagged with mCherry (S10 Fig). RNAse H WT and MT were co-transfected with p8xTR+FLAG-LANA in 293T cells and assayed for binding to the TR by ChIP assay using anti-mCherry antibody. Both RNAse H WT and MT bound similarly to the TR (S10A Fig). DRIP assay revealed that only RNAse H WT, but not RNAse H MT reduced S9.6 binding at the TR, indicating that R-loops were removed by WT RNAase H (S10B Fig). ChIP assay with LANA indicated that RNAase H WT reduced LANA binding by ~ 4-fold, while RNAse H MT had less than 1.7-fold reduction in LANA binding (S10C Fig). LANA and mCherry expression did not change significantly among the various transfection conditions (S10D and S10E Fig). These findings further support the model that R-loops form at the TR and stabilize LANA binding.

To better correlate LANA functional activity with the epigenetic features at the TR, we utilized a LANA N-terminal mutant (LANA-LRSm) with alanine substitutions at amino acids 8-LRS-10, that have been previously shown to eliminate LANA episome maintenance function by disrupting interaction with histones H2A/H2B [22] (Fig 7A). LANA-WT and LANA-LRSm were expressed at similar levels as shown by Western blot (Fig 7B). ChIP-assays indicated that LANA-WT and LANA-LRSm bound indistinguishably to p8xTR (Fig 7C and 7D). In the presence of LANA-LRSm, histones H3K4me3 and H3K27ac were reduced (~4–5 fold), while H3K9me3 was increased relative to LANA-WT (Fig 7C). RNAPII pS5 and pS2 were reduced (~6–4 fold) (Fig 7D), and R-loops as measured by S9.6 DRIP assay were undetectable in LRSm relative to LANA-WT (Fig 7E). These findings indicate that R-loops, RNAPII and active histone modifications at TR depend on the ability of LANA to interact with H2A/H2B and correlate with functional episome maintenance activity of LANA.

Fig 7. LANA N-terminal histone-binding domain required for epigenetic programming at the TR.

Fig 7

A. Schematic of FLAG tagged LANA-WT and LANA-LRSm with mutation 8-LRS-10 to 8-AAA-10. B. Western blot of 293T cells transfected with LANA-WT or LANA-LRSm probed for FLAG or β-Actin. C. ChIP-qPCR for IgG, LANA, H3K4me3, H3K9me3, or H3K27ac in 293T cells transfected with LANA-WT or LANA-LRSm assayed at the TR. D. Same as in panel C except ChIP-qPCR for IgG, LANA, RNAPII pS2 and pS5. E. DRIP assay in 293T cells transfected with LANA-WT or LANA-LRSm using IgG or S9.6 antibody assayed at the TR. F. Model of LANA-dependent R-loops formed by collisions between elongating RNA polymerase II and DNA replication machinery at the TR. Inhibition of RNA polymerase leads to a loss of LANA binding, R-loops and the formation of heterochromatic H3K9me3. Image generated with BioRender with license.

Discussion

The episome maintenance of the latent KSHV genome requires coordination of DNA replication, RNA polymerase II transcription and epigenetic programming that are essential for viral genome stability and persistence. How these potentially conflicting activities are choreographed remains poorly understood. Here, we provide new evidence that during latent infection RNA polymerase and DNA replication machinery colocalize within the TR in association with RNA-DNA hybrid (R-loop) and histone modifications associated with transcription-replication conflicts (TRCs). We show that active RNA polymerase is required for many of these epigenetic features to form at the TR, including LANA and CTCF chromatin binding. Finally, we show that R-loops and active histone modifications correlate with the functional episome maintenance activity of LANA binding and multiple copies of the TR, and the prevention of default H3K9me3 heterochromatinization (Fig 7F model).

TRCs at the KSHV TR

Transcription-replication conflicts are known to be a source of R-loops that can lead to replication fork collapse and genetic instability [30]. LANA is known to recruit components of the replication machinery, including ORC, MCMs, and PCNA to the viral replication origin within the TR [11,24]. Genetic analysis of the minimal viral replication origin identified two central pairs of LANA binding sites in the TR [15], while structural studies indicate that an additional LANA binding site is also present [14]. LANA is also known to regulate transcription across the viral and host genome [40–42], although the precise mechanism is not fully established. LANA can interact with components of the MLL1 complex that can regulate histone H3K4me3 methylation and RNA polymerase initiation through interactions with P-TEFb complex [43,44]. We found that both replication (PCNA and MCM2) and transcription factors (RNA polymerase II) associate simultaneously with LANA at the TR using PLA and cell-cycle dependent ChIP-qPCR. These findings strongly suggest that transcription and replication coincide at the TR.

R-Loops at the KSHV TR

R-loops may form at different genetic elements with different functional or pathological consequences. R-loops can form as a result of RNA polymerase promoter proximal pausing [45] or stalling due to steric interference, such as at CTCF binding sites [46,47]. Promoter proximal pausing can generate small R-loops due to the inhibition of CDK9-pTEFB conversion of RNAPII from pS5 to pS2. R-loops can also form when RNAPII pauses due to collisions with DNA polymerase or due to complex DNA structures, such as repetitive DNA and G-quadruplexes, that hinder polymerase processivity [48,49]. At the KSHV TR, we found that R-loops depended on active RNA polymerase as they were inhibited by FVP and triptolide (Fig 5). R-loops were also dependent on LANA binding to the 8xTR template (Fig 6) and LANA binding to histones H2A/H2B (Fig 7), correlating strongly with episome maintenance function. RNAseq analyses suggests that transcripts mapping to the TR may start and end near CTCF and LANA binding sites. Both CTCF and LANA have been implicated in interactions with either RNA polymerase II directly, or with associated initiating cofactors, such as LANA interaction with MLL1 complex [23]. ADNP, a factor that has been shown to bind LANA and associate with TR [50], is also implicated in the localization and regulation of R-loops [51]. These findings suggest that both CTCF and LANA regulate the generation of short TR-associated RNAs that remain associated with the TR as R-loops.

H3pS10 colocalization with LANA and R-loops at the TR

H3pS10 has been found to localize to R-loops in multiple organisms, including yeast and human [37,52]. The association of H3pS10 with R-loops was linked to replication fork stalling and chromosome condensation [37]. H3pS10 is typically associated with condensed mitotic chromosomes, but those observed with LANA-NBs and TR were found in G1 and G2 phases of the cell cycle, and also colocalized with active chromatin marks for H3K27ac and H3K4me3. H3S10 phosphorylation can also serve as a phospho-switch to activate transcription and prevent heterochromatinization at some regulatory regions, including HSV during latent infection [53,54]. Others have found that mitotic kinases associated with centromeres and chromosome segregation associate with LANA [24,55–58]. Interestingly, we found that H3pS10 associated with the R-loop at the TR, but did not associate with the R-loop at ORF16, suggesting that these R-loops are not structurally and functionally equivalent [34,59]. Thus, these H3pS10 associated R-loops at the TR may provide a unique chromatin environment at the KSHV TR that is both transcriptionally active yet protective for the viral episome during latency. Interestingly, DAXX, which has also been shown to colocalize with LANA-NBs, has been implicated in preventing double strand breaks at centromeric R-loops [60]. DAXX may provide both histone chaperone and chromosome protective function along with LANA at the KSHV TRs. DAXX has been shown to suppress R-loop associated DNA-damage at centromeres [60]. LANA is also known to interact with BRD2/4 that functions in LANA chromosome tethering [61,62] and transcriptional enhancer activities [63]. BRD4 has been shown to suppress R-loop formation at TRCs and double strand breaks [64]. Thus, multiple LANA associated factors may regulate TR-associated R-loops to provide stable maintenance to the KSHV TR and viral genome during latent cycle replication.

LANA forms substructures with many of these components

High-resolution microscopic imaging and PLA demonstrate that LANA is in close proximity to many of these epigenetic components, including RNA polymerase, R-loops (S9.6 antibody) and H3pS10 (Figs 4, 5, and S3 Fig and S1 Movie). The structures formed between LANA and H3pS10 were visualized by high-resolution confocal imaging and 3D reconstructions indicate that these complexes are both large and interwoven, suggesting that they occur over an expansive higher-ordered DNA/chromatin structure. We found that 8xTR was more efficient than 2xTR in episome maintenance, although a single TR can support replication and maintenance upon selection [39]. Multiple TRs have been found to be important for the transcriptional enhancer function of the TR in the context of the complete viral genome [63]. LANA-NBs can also form liquid-phase separated condensates [17]. These additional stabilizing factors may explain why RNAPII inhibitors eliminate LANA binding to TR by ChIP, but not as measured by IF of LANA-NBs. These higher-order structures of the viral genomes are likely the result of a confluence of multiple LANA interaction partners, and the formation of protective structures important for viral genome transcription, replication and segregation.

Conclusion

TRC associate R-loops are known to promote DNA recombination and genetic instability, but it is not clear that the R-loops that form at the KSHV TR promote such instability as they appear to occur frequently and viral genetic stability remains intact. While unscheduled R-loops are likely to be threats to genetic integrity, we propose that the R-loops that form at the KSVH TR are part of a programmed mechanism required to maintain the GC-rich repeat structure and promote viral genome integrity. The viral repeat copy number is essential for both viral episome maintenance and tethering to the host metaphase chromosome, as well as for viral lytic cycle DNA cleavage by terminase and virion packaging [65]. We suggest that the R-loops provide a level of complexity to the TR that includes open chromatin with enhancer-like capability as well as protective shell-like properties associated with large nuclear bodies, formed by multiple oligomers of LANA and associated factors, such as DAXX and BRD2/4.

Materials and methods

Cells and drug treatments

iSLK stable cell lines carrying KSHV Bac16 expressing RFP-LANA or KSHV BAC16-GFP were described previously [27] and cultured in DMEM supplemented with 10% FBS (heat inactivated), 50µg/ml penicillin/streptomycin, 1µg/ml Puromycin, 0.25mg/ml G418, and 1mg/ml Hygromycin B. BCBL1 cells, a stable cell line derived from KSHV+ pleural effusion lymphoma (gift from Yan Yuan, UPENN), and BC1 cells (EBV and KSHV positive) were cultured in RPMI-1640 medium supplemented with 10% FBS (heat inactivated) and 50µg/ml penicillin/streptomycin. 293T cells were cultured in DMEM with 10% FBS (heat inactivated) and 50µg/ml penicillin/streptomycin. Cells were treated with 0.4µM/DMSO Flavopiridol (Sigma, F3055) or 2µM/DMSO Triptolide (TOCRIS, 3253) dissolved in DMSO for 15 min or 2 hrs as indicated.

Plasmids and oligonucleotides

The plasmids containing 2 × TR and 8 × TR were generous gifts of Dr. Ken Kaye [39]. pCMV3x-FLAG-LANA (LANA-WT) has been described previously [66]. pCMV-FLAG-LANA-8AAA10 (LANA-MTm) was synthesized by Genscript and validated by NGS sequencing. Plasmids expressing RNAseHI are pICE-RNaseHI-WT-NLS-mCherry (Plasmid #60365) referred to here as RNAseH WT and the catalytically dead pICE-RNaseHI-D10R-E48R-NLS-mCherry- (Plasmid #60367) referred to here as RNaseH-MT. Oligonucleotides were synthesized by IDT and a complete list is provided in S1 Table.

ChIP assay

ChIP assays were performed essentially as previously described [27]. Briefly, cells were collected 1x106 per IP, crosslinked (1% Formaldehyde) with rotation for 15 mins and then quenched by 0.125M glycine for 5 mins. Samples were then lysed in 1 ml SDS lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris-HCl, pH 8.0) plus proteinase inhibitor cocktail. Samples were sonicated with a (Diagenode Bioruptor) and diluted 10-fold in IP Dilution Buffer (0.01% SDS, 1.1% Triton X-100, 1.2mM EDTA, 16.7mM Tris pH 8.1, 167mM NaCl, and protease inhibitors cocktail). Appropriate antibody was then added for each sample and rotated overnight at 4°C. Dynabeads (50µl) were added for 2 hours, washed and eluted at 65°C with shaking for 30 mins. Dynabeads were then separated from eluted material by magnet, eluate was de-crosslinked at 65 overnight. DNA was purified using PureLink PCR Purification Kit (Invitrogen) according to manufacturer’s instructions. ChIP DNA was assayed by qPCR using primers specific for indicated KSHV regions and quantified as % input.

DRIP assay

DRIP assay was performed essentially as described previously [67,68]. Essentially, 10µg of DNA was incubated with 10ug of S9.6 antibody (Kerafast) and isotype IgG control. Samples were washed with wash buffers, DRIP Buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA,1.0% NP-40), DRIP H wash buffer (50 mM Tris-HCl, 500 mM NaCl, 5 mM EDTA,1.0% NP-40, 0.1% Sodium deoxycholate), DRIP Li wash buffer (50 mM Tris-HCl, pH 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% NP-40, 0.5% Na-Deoxycholate) and TE Buffer (100 mM Tris-HCl, 10 mM EDTA 50 mM NaCl) and eluted in elution buffer (50 mM Tris-HCl (pH8.0) 10 mM EDTA 1.0% SDS). DNA was purified using PureLink PCR Purification Kit (Invitrogen) according to manufacturer’s instructions. DRIP DNA was assayed by qPCR using primers specific for indicated KSHV regions and quantified as % input. RNaseH (New England Biolabs, NEB #M0297) treatment was used as per manufacturer’s instructions to validate, as were known cellular positive and negative control primers in 293T cells.

Indirect immunofluorescence (IF) assay

IF was performed essentially as described previously [17]. Briefly, 1 × 105 cells seeded at 70% confluence were plated on glass coverslips (treated with Poly-L-Lysine, Corning, 354085) in 24-well plate and incubated overnight in cell culture CO2 incubator. Cells were fixed with cold (-20oC) 100% methanol for 10 minutes, washed three times (5 min each wash) with 1xPBS. Fixed cells were incubated 10 min with 0.1M Glycine/PBS and then washed three times with 1xPBS. The cells were permeabilized with 0.3% TritonX-100 (Sigma) in 1xPBS, 10 min. All procedures were performed at room temperature. After washing with PBS, cells were incubated in blocking solution (0.2% fish gelatin, 0.5% BSA in 1xPBS) for 1h. Primary antibodies were diluted in blocking solution and applied on cells for 1h followed with 1xPBS washing. Cells were further incubated with fluorescence-conjugated secondary antibodies AlexaFluor 488 or 594,or 647 (Invitrogen) in blocking solution for 1h, counterstained with 0.5µg/ml DAPI (Sigma) for 5 min, and mounted in ProLong Gold antifade mounting solution (Life Technologies, # P36930). Images were acquired with a Nikon 80i Upright Microscope (Nikon Instruments) using Nikon NIS Elements, AR Advanced Research software, version 6.10.01 (Nikon).

PLA (Proximity Ligation Assay)

For Proximity ligation assay we followed by the manufactured protocol provided by Sigma: Duolink in Situ Starter Kit mouse/rabbit with reagents (Sigma, Cat. No. DUO92101). The PLA probes from different species, one PLUS (Sigma, DUO9200) and one MINUS (Sigma, DUO92004), matching the host species of primary antibodies. Depended on the conjugated color we used two different kits of detection reagents: the Detection reagent Green (495) (Sigma, DUO92014); or Detection reagents Red (594) (Sigma, DUO92008). Briefly, 1 × 105 cells, 70% confluence, were plated on glass coverslips (treated with Poly-L-Lysine, Corning, 354085) in 24-well plate, for overnight. Cells were fixed with cold (-20oC) 100% methanol for 10 minutes, washed three times (5 min each wash) with 1xPBS. Fixed cells were incubated 10 min with 0.1M Glycine/PBS and then washed three times with 1xPBS. The cells were permeabilized with 0.3% TritonX-100 (Sigma) in 1xPBS, 10 min. All procedures were performed at room temperature. After 3 times washing with 1xPBS, cells were incubated in Duolink blocking solution (Sigma, DUO82007) for 1h, at 37oC, followed by Incubation with a pair of primary antibodies (rabbit and mouse), diluted in Duolink Antibody Diluent (Sigma, DUO8208), during 1h at room temperature. After incubation the cells were washed two times, 5 min each, with Duolink Washing buffer-A (Sigma, DUO82046), followed by incubation with PLA probe PLUS and MINUS for 1h, 37oC. Next, the cells were washed 2 times with Buffer-A, followed by Ligation (30 min, 37oC) and Amplification (100min, 37oC), then, the cells were washed with Buffer-B (Sigma, DUO82048), 2 times, 10min each, at room temperature. In the end the cells were mounted in PLA Mounting medium with DAPI (Sigma, DUO2040).

For combination of PLA with IF, after ligation and washing, a secondary AlexaFluor (488) antibodies against the primary anti-LANA antibody was applied. Secondary antibodies were diluted in Antibody diluent, incubated 1h, room temperature, followed by washing with Buffer-A and Amplification step after. Images were acquired with a Nikon 80i Upright Microscope (Nikon Instruments) using Nikon NIS Elements AR Advanced Research software, version 6.10.01 (Nikon).

Confocal microscopy and image processing

High resolution, confocal images of fixed cells were captured using a Leica TCS SP8 WLL scanning laser confocal microscope and Leica LAS-X software (Leica Microsystems, Inc., Buffalo Grove, IL). Image post-processing included importing into Huygens software for deconvolution (Scientific Volume Imaging, Laapersveld, Hilversum, The Netherlands) followed by 2D maximum projection or 3D reconstruction, iso-surface application and video rendition in LAS-X.Fixed cell preparations were acquired using a 63X/1.40 oil objective, 6X zoom and a pinhole of 1 AU, with 11–15 z-steps through 3–3.5 µm stacks, resulting in a voxel size of 60 x 60 x 299 nm. For 3D reconstructions, original confocal files were captured using a Leica TCS SP8 WLL scanning laser confocal microscope (Leica Microsystems, Inc., Buffalo Grove, Ill.). Extended focus Z-stacks of each cell were acquired according to optimized settings based on Nyquist criteria and the resulting files were processed using Huygens deconvolution software (Scientific Volume Imaging, B.V., Hilversum, Netherlands). 3D reconstructions and video animations were then created using the Leica LAS-X 3D software module.

Centrifugal elutriation

Centrifugal elutriation using Beckman Coulter AVANTI J-26 XP was used to separate BCBL1 cells into different phases of the cell cycle, with flow rates of 15, 18, 21, 24, 27, 30, 34, 38, 42, and 46 ml/min, as described previously [69].

Western blot

Briefly, cells (~1 x 106) were lysed in RIPA buffer (150 mM NaCl, 25 mM Tris, pH 8.0, 1% Na-Deoxycholate, 0.5% SDS, 1% NP-40, 10mM Glycero-phosphate, 1mM Sodium fluoride, 2mM Sodium orthovanadate, 1mM EDTA, and Protease Inhibitors freshly added). An equal amount of protein was resolved using Novex 8–16% Tris-Glycine Gels (Invitrogen) and then transferred onto Nitrocellulose membrane (Millipore) followed with specific antibodies application. Antibody signal was detected using Immobilon Forte Western HRP Substrate (Millipore) and Luminescent Imager 680 (Amersham Bioscience). Primary antibodies were used: anti-HRP-b-Actin (Sigma, A23852), rat anti-LANA HHV8 (Abcam, ab4103), mouse Phospho-RNA Pol II Ser2 (Active Motif, 61083), mouse Phospho-RNA Pol II Ser5 (Invitrogen MA1–460093), rabbit Phospho-HisH3, Ser10 (Invitrogen, 701258).

Antibodies

The following antibodies were used for immunofluorescence, Co-IP, and Western blotting studies: rat polyclonal anti-HHV8 or anti-LANA [LN53] (Abcam, ab4103), mouse anti- ORF45 (provided by Yan Yuan, UPENN), Rabbit anti-LANA (Novus, NBP3–07279), rabbit Phospho-His H3-Ser10 (Invitrogen, 701258), mouse Phospho-Histone H3 (Ser10) (Invitrogen, MA5–15220), mouse DNA-RNA Hybrid S9.6 (Kerafast, ENH001), mouse Phospho-RNA Pol II Ser2 (Active Motif, 61083), rabbit Phospho-RNA Pol II Ser2 (Abcam, 5095), mouse Phospho-RNA Pol II Ser5 (Invitrogen MA1–460093), rabbit Phospho-RNA Pol II Ser5, (Abcam, 39233), rabbit PCNA (Invitrogen, PA5–27214), Rabbit CTCF (Active Motif, AB-3216313), RAD21 (Abcam ab217678), Anti-HRP- Flag (Sigma, A8592). The following secondary antibodies were used: AlexaFluor594, or AlexaFluor488, or AlexaFluor647 (Invitrogen), rabbit IgG (Santa Cruz, sc-2027) and mouse anti-Actin-HRP (Sigma, A23852).

RNA seq and analysis

Public data sets from [36] GEO: GSE179727 and from [35] GEO GSE147063 were mapped to the KSVH terminal repeats 2x with a portion of unique region K15 using bowtie 2 [70]with option “--very-sensitive-local” mode so that soft-clipped reads also can be aligned and remain strand-specific. Sequencing of p8xTR + F-LANA in 293T cells was performed by total RNAseq using Illumina library preparation using NextSeq2000. RNA-seq reads were aligned to either the KSHV reference genome (NCBI RefSeq NC_009333.1) or to custom fasta file for 2xTR with 2kb unique KSHV regions at both ends, using Minimap2 (v2.24) [71] with splice-aware settings (-ax splice) to account for viral transcripts. Alignments were sorted and indexed using SAMtools (v1.21) [72]. A custom GTF file, derived from the NCBI GFF annotation, was used for gene-level quantification.

RT-qPCR

Total RNA was extracted using TRIzol (Ambion) and then further treated with DNase I (New England Biolabs). Two micrograms of total RNA were reverse transcribed using random decamers (Ambion) and Superscript IV RNase H− reverse transcriptase (Invitrogen). Primer sets for pTR1 and pTR2 were used in real-time quantitative PCR (qPCR) assays to measure transcript levels. The values for the relative levels were calculated by ΔΔCT method using GAPDH as a standard. Primers for pTR1 were GACCCCGGGCAGCGAGGGAA and AGGGCTCCACGTAGCAAGCACTG; for pTR2 were CCTGCCGGGGACGCCGCCGGGGCCT and CTGAGGCGGCGCGCGGCCCCAT.

Supporting information

S1 Fig. Colocalization of epigenetic marks with LANA at KSHV TR.

A. Schematic of the KSHV genome showing the terminal repeats (TR) relative to the unique region open reading frames (blue) and primer positions for TR, ORF45, and ORF75. B. ChIP-qPCR for histone H3K4me3, H3K27ac, H3K9me3, LANA or control IgG assayed at the TR, ORF45 or ORF75 loci in BCBL1 or iSLK cells. C. Same as in panel B, except ChIP antibodies with RAD21, CTCF, or IgG control. ** p < .01, *** p < .001, student 2-tailed t-test, n = 3 biological replicates.

(PDF)

ppat.1013029.s001.pdf (200.6KB, pdf)
S2 Fig. R-loop formation at the KSHV TR.

A. DRIP assay with BC1 cells using S9.6 (blue) or control IgG (black) assayed with primers for cellular actin or KSHV TR ORF45 and ORF75. *** p < .001, student two-tailed t-test. B. IGV screen shot of RNA transcripts mapped to KSHV TR region using public data sets for total RNAseq in BCBL1 cells during latent conditions (SRR15069589, SRR15069590, SRR15069591). The reference map consists of a small region of the unique region with K15 and 2 copies of the TR. TR transcripts Tr(1) and Tr(2) are indicated above.

(S2_Fig.PDF)

ppat.1013029.s002.pdf (220.8KB, pdf)
S3 Fig. Colocalizations of LANA, H3pS10 and PCNA.

A. Representative images of iSLK cells showing the percentage of cells with LANA and colocalizations with H3pS10 and PCNA. 60x magnification, N = 4, total of 126 cells, B. Quantification of percentage of cells with LANA-NB or LANA-NBs colocalized with both PCNA and H3pS10. ****p < .0001, student two-tailed t-test.

(S3_Fig.PDF)

ppat.1013029.s003.pdf (558.3KB, pdf)
S4 Fig. Confocal microscopy IF analysis of H3pS10 and LANA colocalization in iSLK cells.

H3pS10 (blue), LANA (red), Dapi (blue). Arrows indicate examples of colocalization.

(S4_Fig.PDF)

ppat.1013029.s004.pdf (154.3KB, pdf)
S5 Fig. Confocal microscopy IF analysis of PCNA-H3pS10-LANA colocalization in iSLK cells.

PCNA (green), H3pS10 (blue), LANA (red). Arrow indicates example of colocalization.

(S5_Fig.PDF)

ppat.1013029.s005.pdf (182.9KB, pdf)
S6 Fig. Western blot of BCBL1 cells treated with FVP or triptolide.

A-B. Western blots of BCBL1 cells treated with 0.4 μM FVP (pane A) or with 2 μM triptolide (panel B) for 0, 2, 4 or 24 hrs and probed for LANA, RNAPII pS2, pS5, H3pS10, or β-actin. C. ChIP-qPCR for IgG, LANA, RNAPII pS5 or pS2 in BCBL1 cells treated with either FVP or triptolide (TRP) for 2 h. D. Same as in panel C, except for ChIP-qPCR with IgG and H3K9me3. **p < .01, ****p < .0001, student two-tailed t-test.

(S6_Fig.PDF)

ppat.1013029.s006.pdf (591.9KB, pdf)
S7 Fig. Loss of LANA-NBs after flavopiridol (FVP) treatment. (A-C).

iSLK cells were treated with DMSO, 0.4 μM FVP for 2h or 24 hr and assayed by IF using LANA antibody (red) and counterstained with Dapi (blue) imaged at 20x (panel A), 60x (panel B), or enlarged single nuclei imaged by phase contrast (panel C). D. Quantification of LANA signal intensity. E. Quantification of cells lacking LANA signals (LANA-free cells). **p < .01, ***p < .001, student two-tailed t-test.

(S7_Fig.PDF)

ppat.1013029.s007.pdf (699.7KB, pdf)
S8 Fig

A. TR DNA was quantified by qPCR in 293T cells transfected with F-LANA and either p8xTR or p2xTR plasmids at days 3, 6, 9, and 12. *p < .05, **p < .01, student two-tailed t-test. B. Native ChIP for IgG, LANA, H3K4me3, H3K27ac in BCBL1 cells using conditions identical to standard ChIP assay but lacking initial formaldehyde cross-linking.

(S8_Fig.PDF)

ppat.1013029.s008.pdf (313.7KB, pdf)
S9 Fig. RNAseq analysis of p8xTR.

29T cells transfected with p8xTR and pFLAG-LANA were assayed 72 hrs post-transfection for total RNAseq using Illumina paired-end method. FASTQ files were mapped to the KSHV subgenomic fragment containing K15-2xTR-K1 sequence and visualized using IGV genome browser. LANA and CTCF binding sites are indicated above. Blue peaks represent read counts and presumptive splice junctions are indicated by blue and red loops. Sequence of transcripts Tr (1) and T2 (2) are indicated below.

(S9_Fig.PDF)

ppat.1013029.s009.pdf (375KB, pdf)
S10 Fig. R-loops at TR facilitate LANA binding.

A-C. mCherry-tagged RNase H WT or MT or empty vector were co-transfected with p8xTR + FLAG-LANA and assayed for binding to the TR region by ChIP assay using antibody mCherry (panel A) and TR- DRIP assay (panel B), or LANA ChIP assay (panel C) and assayed with primers specific for KSHV TR. *p < .05, **p < .01, ***p < .001, or not significant (ns) using student two-tailed t-test. D. Western blot of 3 biological replicates used for experiments shown in panels A-C. E. Fluorescence microscopy of RFP for RNAse H WT and RNAse H MT expression in transfected 292T cells.

(S10_Fig.PDF)

ppat.1013029.s010.pdf (216.9KB, pdf)
S1 Movie. Confocal microscopy IF analysis of PCNA-H3pS10-LANA colocalization in iSLK cells.

PCNA (green), H3pS10 (blue), LANA (red).

(S1_Movie.MP4)

Download video file (3.1MB, mp4)
S1 Table. List of oligonucleotides used in this study.

(S1_Table.PDF)

ppat.1013029.s012.pdf (26.9KB, pdf)
S1 File. PRISM files.

(ZIP)

ppat.1013029.s013.zip (404KB, zip)
S1 File. Legends.

(DOCX)

ppat.1013029.s014.docx (15.8KB, docx)

Acknowledgments

We thank the Wistar Institute Cancer Center core facilities of Genomics, Bioinformatics, and Imaging. We thank members of the Lieberman lab for their generous assistance, particularly L. MacMullen, S. Soldan, and C. Albitz. We thank Drs. Ken Kaye for generous gift of p8TR and p2TR, Yan Yuan for KSHV+ cell lines, and Sebastien Britton and Patrick Calsoufor for providing mCherry-RNase H plasmids through Addgene.

Data Availability

All relevant data are in the manuscript and its supporting information files.

Funding Statement

This study was funded by the National Cancer Institute grant RO1 CA117830 to PML. National Cancer Institute Cancer Center Support Grant P30 CA010815. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Deng Z, Wang Z, Lieberman PM. Telomeres and viruses: common themes of genome maintenance. Front Oncol. 2012;2:201. doi: 10.3389/fonc.2012.00201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Gambelli A, Ferrando A, Boncristiani C, Schoeftner S. Regulation and function of R-loops at repetitive elements. Biochimie. 2023;214(Pt A):141–55. doi: 10.1016/j.biochi.2023.08.013 [DOI] [PubMed] [Google Scholar]
  • 3.Juillard F, Tan M, Li S, Kaye KM. Kaposi’s sarcoma herpesvirus genome persistence. Front Microbiol. 2016;7:1149. doi: 10.3389/fmicb.2016.01149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Uppal T, Banerjee S, Sun Z, Verma SC, Robertson ES. KSHV LANA--the master regulator of KSHV latency. Viruses. 2014;6(12):4961–98. doi: 10.3390/v6124961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Schulz TF, Freise A, Stein SC. Kaposi sarcoma-associated herpesvirus latency-associated nuclear antigen: more than a key mediator of viral persistence. Curr Opin Virol. 2023;61:101336. doi: 10.1016/j.coviro.2023.101336 [DOI] [PubMed] [Google Scholar]
  • 6.Inagaki T, Kumar A, Komaki S, Nakajima K-I, Izumiya Y. An atlas of chromatin landscape in KSHV-infected cells during de novo infection and reactivation. Virology. 2024;597:110146. doi: 10.1016/j.virol.2024.110146 [DOI] [PubMed] [Google Scholar]
  • 7.Cesarman E, Damania B, Krown SE, Martin J, Bower M, Whitby D. Kaposi sarcoma. Nat Rev Dis Primers. 2019;5(1):9. doi: 10.1038/s41572-019-0060-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chang Y, Moore P. Twenty years of KSHV. Viruses. 2014;6(11):4258–64. doi: 10.3390/v6114258 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ballestas ME, Chatis PA, Kaye KM. Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science. 1999;284(5414):641–4. doi: 10.1126/science.284.5414.641 [DOI] [PubMed] [Google Scholar]
  • 10.Renne R, Lagunoff M, Zhong W, Ganem D. The size and conformation of Kaposi’s sarcoma-associated herpesvirus (human herpesvirus 8) DNA in infected cells and virions. J Virol. 1996;70(11):8151–4. doi: 10.1128/JVI.70.11.8151-8154.1996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Stedman W, Deng Z, Lu F, Lieberman PM. ORC, MCM, and histone hyperacetylation at the Kaposi’s sarcoma-associated herpesvirus latent replication origin. J Virol. 2004;78(22):12566–75. doi: 10.1128/JVI.78.22.12566-12575.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lu F, Zhou J, Wiedmer A, Madden K, Yuan Y, Lieberman PM. Chromatin remodeling of the Kaposi’s sarcoma-associated herpesvirus ORF50 promoter correlates with reactivation from latency. J Virol. 2003;77(21):11425–35. doi: 10.1128/jvi.77.21.11425-11435.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Komatsu T, Ballestas ME, Barbera AJ, Kelley-Clarke B, Kaye KM. KSHV LANA1 binds DNA as an oligomer and residues N-terminal to the oligomerization domain are essential for DNA binding, replication, and episome persistence. Virology. 2004;319(2):225–36. doi: 10.1016/j.virol.2003.11.002 [DOI] [PubMed] [Google Scholar]
  • 14.Hellert J, Weidner-Glunde M, Krausze J, Lünsdorf H, Ritter C, Schulz TF, et al. The 3D structure of Kaposi sarcoma herpesvirus LANA C-terminal domain bound to DNA. Proc Natl Acad Sci U S A. 2015;112(21):6694–9. doi: 10.1073/pnas.1421804112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hu J, Renne R. Characterization of the minimal replicator of Kaposi’s sarcoma-associated herpesvirus latent origin. J Virol. 2005;79(4):2637–42. doi: 10.1128/JVI.79.4.2637-2642.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Rainbow L, Platt GM, Simpson GR, Sarid R, Gao SJ, Stoiber H, et al. The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi’s sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen. J Virol. 1997;71(8):5915–21. doi: 10.1128/JVI.71.8.5915-5921.1997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Vladimirova O, De Leo A, Deng Z, Wiedmer A, Hayden J, Lieberman PM. Phase separation and DAXX redistribution contribute to LANA nuclear body and KSHV genome dynamics during latency and reactivation. PLoS Pathog. 2021;17(1):e1009231. doi: 10.1371/journal.ppat.1009231 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Domsic JF, Chen H-S, Lu F, Marmorstein R, Lieberman PM. Molecular basis for oligomeric-DNA binding and episome maintenance by KSHV LANA. PLoS Pathog. 2013;9(10):e1003672. doi: 10.1371/journal.ppat.1003672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Piolot T, Tramier M, Coppey M, Nicolas JC, Marechal V. Close but distinct regions of human herpesvirus 8 latency-associated nuclear antigen 1 are responsible for nuclear targeting and binding to human mitotic chromosomes. J Virol. 2001;75(8):3948–59. doi: 10.1128/JVI.75.8.3948-3959.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cotter MA 2nd, Robertson ES. The latency-associated nuclear antigen tethers the Kaposi’s sarcoma-associated herpesvirus genome to host chromosomes in body cavity-based lymphoma cells. Virology. 1999;264(2):254–64. doi: 10.1006/viro.1999.9999 [DOI] [PubMed] [Google Scholar]
  • 21.Vázquez EDL, Carey VJ, Kaye KM. Identification of Kaposi’s sarcoma-associated herpesvirus LANA regions important for episome segregation, replication, and persistence. J Virol. 2013;87(22):12270–83. doi: 10.1128/JVI.01243-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Barbera AJ, Chodaparambil JV, Kelley-Clarke B, Joukov V, Walter JC, Luger K, et al. The nucleosomal surface as a docking station for Kaposi’s sarcoma herpesvirus LANA. Science. 2006;311(5762):856–61. doi: 10.1126/science.1120541 [DOI] [PubMed] [Google Scholar]
  • 23.Tan M, Li S, Juillard F, Chitas R, Custódio TF, Xue H, et al. MLL1 is regulated by KSHV LANA and is important for virus latency. Nucleic Acids Res. 2021;49(22):12895–911. doi: 10.1093/nar/gkab1094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sun Z, Jha HC, Robertson ES. Bub1 in complex with LANA recruits PCNA to regulate Kaposi’s sarcoma-associated herpesvirus latent replication and DNA translesion synthesis. J Virol. 2015;89(20):10206–18. doi: 10.1128/JVI.01524-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Izumiya Y, Algalil A, Espera JM, Miura H, Izumiya C, Inagaki T, et al. Kaposi’s sarcoma-associated herpesvirus terminal repeat regulates inducible lytic gene promoters. J Virol. 2024;98(2):e0138623. doi: 10.1128/jvi.01386-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gupta N, Thakker S, Verma SC. KSHV encoded LANA recruits nucleosome assembly protein NAP1L1 for regulating viral DNA replication and transcription. Sci Rep. 2016;6:32633. doi: 10.1038/srep32633 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.De Leo A, Deng Z, Vladimirova O, Chen H-S, Dheekollu J, Calderon A, et al. LANA oligomeric architecture is essential for KSHV nuclear body formation and viral genome maintenance during latency. PLoS Pathog. 2019;15(1):e1007489. doi: 10.1371/journal.ppat.1007489 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Chen H-S, De Leo A, Wang Z, Kerekovic A, Hills R, Lieberman PM. BET-inhibitors disrupt Rad21-dependent conformational control of KSHV latency. PLoS Pathog. 2017;13(1):e1006100. doi: 10.1371/journal.ppat.1006100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Campbell M, Chantarasrivong C, Yanagihashi Y, Inagaki T, Davis RR, Nakano K, et al. KSHV topologically associating domains in latent and reactivated viral chromatin. J Virol. 2022;96(14):e0056522. doi: 10.1128/jvi.00565-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bayona-Feliu A, Aguilera A. The role of chromatin at transcription-replication conflicts as a genome safeguard. Biochem Soc Trans. 2021;49(6):2727–36. doi: 10.1042/BST20210691 [DOI] [PubMed] [Google Scholar]
  • 31.Goehring L, Huang TT, Smith DJ. Transcription-replication conflicts as a source of genome instability. Annu Rev Genet. 2023;57:157–79. doi: 10.1146/annurev-genet-080320-031523 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Gaillard H, Aguilera A. Transcription as a threat to genome integrity. Annu Rev Biochem. 2016;85:291–317. doi: 10.1146/annurev-biochem-060815-014908 [DOI] [PubMed] [Google Scholar]
  • 33.Hamperl S, Cimprich KA. The contribution of co-transcriptional RNA:DNA hybrid structures to DNA damage and genome instability. DNA Repair (Amst). 2014;19:84–94. doi: 10.1016/j.dnarep.2014.03.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wongsurawat T, Gupta A, Jenjaroenpun P, Owens S, Forrest JC, Nookaew I. R-loop-forming sequences analysis in thousands of viral genomes identify a new common element in herpesviruses. Sci Rep. 2020;10(1):6389. doi: 10.1038/s41598-020-63101-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Park A, Oh S, Jung KL, Choi UY, Lee H-R, Rosenfeld MG, et al. Global epigenomic analysis of KSHV-infected primary effusion lymphoma identifies functional MYC superenhancers and enhancer RNAs. Proc Natl Acad Sci U S A. 2020;117(35):21618–27. doi: 10.1073/pnas.1922216117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Majerciak V, Alvarado-Hernandez B, Ma Y, Duduskar S, Lobanov A, Cam M, et al. A KSHV RNA-binding protein promotes FOS to inhibit nuclease AEN and transactivate RGS2 for AKT phosphorylation. mBio. 2025;16(1):e0317224. doi: 10.1128/mbio.03172-24 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Castellano-Pozo M, Santos-Pereira JM, Rondón AG, Barroso S, Andújar E, Pérez-Alegre M, et al. R loops are linked to histone H3 S10 phosphorylation and chromatin condensation. Mol Cell. 2013;52(4):583–90. doi: 10.1016/j.molcel.2013.10.006 [DOI] [PubMed] [Google Scholar]
  • 38.Wang Y, Lu J, He L, Yu Q. Triptolide (TPL) inhibits global transcription by inducing proteasome-dependent degradation of RNA polymerase II (Pol II). PLoS One. 2011;6(9):e23993. doi: 10.1371/journal.pone.0023993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ballestas ME, Kaye KM. Kaposi’s sarcoma-associated herpesvirus latency-associated nuclear antigen 1 mediates episome persistence through cis-acting terminal repeat (TR) sequence and specifically binds TR DNA. J Virol. 2001;75(7):3250–8. doi: 10.1128/JVI.75.7.3250-3258.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Bose D, Singh RK, Robertson ES. KSHV-encoded LANA bypasses transcriptional block through the stabilization of RNA Pol II in hypoxia. mBio. 2024;15(1):e0277423. doi: 10.1128/mbio.02774-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chen CP, Lyu Y, Chuang F, Nakano K, Izumiya C, Jin D, et al. Kaposi’s sarcoma-associated herpesvirus hijacks RNA polymerase II to create a viral transcriptional factory. J Virol. 2017;91(11):e02491-16. doi: 10.1128/JVI.02491-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Roupelieva M, Griffiths SJ, Kremmer E, Meisterernst M, Viejo-Borbolla A, Schulz T, et al. Kaposi’s sarcoma-associated herpesvirus Lana-1 is a major activator of the serum response element and mitogen-activated protein kinase pathways via interactions with the Mediator complex. J Gen Virol. 2010;91(Pt 5):1138–49. doi: 10.1099/vir.0.017715-0 [DOI] [PubMed] [Google Scholar]
  • 43.Fujinaga K, Huang F, Peterlin BM. P-TEFb: the master regulator of transcription elongation. Mol Cell. 2023;83(3):393–403. doi: 10.1016/j.molcel.2022.12.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Smith E, Lin C, Shilatifard A. The super elongation complex (SEC) and MLL in development and disease. Genes Dev. 2011;25(7):661–72. doi: 10.1101/gad.2015411 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Castillo-Guzman D, Chédin F. Defining R-loop classes and their contributions to genome instability. DNA Repair (Amst). 2021;106:103182. doi: 10.1016/j.dnarep.2021.103182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Valton A-L, Venev SV, Mair B, Khokhar ES, Tong AHY, Usaj M, et al. A cohesin traffic pattern genetically linked to gene regulation. Nat Struct Mol Biol. 2022;29(12):1239–51. doi: 10.1038/s41594-022-00890-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Luan J, Xiang G, Gómez-García PA, Tome JM, Zhang Z, Vermunt MW, et al. Distinct properties and functions of CTCF revealed by a rapidly inducible degron system. Cell Rep. 2021;34(8):108783. doi: 10.1016/j.celrep.2021.108783 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hamperl S, Bocek MJ, Saldivar JC, Swigut T, Cimprich KA. Transcription-replication conflict orientation modulates R-loop levels and activates distinct DNA damage responses. Cell. 2017;170(4):774-786.e19. doi: 10.1016/j.cell.2017.07.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Belotserkovskii BP, Tornaletti S, D’Souza AD, Hanawalt PC. R-loop generation during transcription: Formation, processing and cellular outcomes. DNA Repair (Amst). 2018;71:69–81. doi: 10.1016/j.dnarep.2018.08.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kumar A, Lyu Y, Yanagihashi Y, Chantarasrivong C, Majerciak V, Salemi M, et al. KSHV episome tethering sites on host chromosomes and regulation of latency-lytic switch by CHD4. Cell Rep. 2022;39(6):110788. doi: 10.1016/j.celrep.2022.110788 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yan Q, Wulfridge P, Doherty J, Fernandez-Luna JL, Real PJ, Tang H-Y, et al. Proximity labeling identifies a repertoire of site-specific R-loop modulators. Nat Commun. 2022;13(1):53. doi: 10.1038/s41467-021-27722-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Skourti-Stathaki K, Proudfoot NJ. Histone 3 s10 phosphorylation: “caught in the R loop!”. Mol Cell. 2013;52(4):470–2. doi: 10.1016/j.molcel.2013.11.006 [DOI] [PubMed] [Google Scholar]
  • 53.Komar D, Juszczynski P. Rebelled epigenome: histone H3S10 phosphorylation and H3S10 kinases in cancer biology and therapy. Clin Epigenetics. 2020;12(1):147. doi: 10.1186/s13148-020-00941-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Cliffe AR, Arbuckle JH, Vogel JL, Geden MJ, Rothbart SB, Cusack CL, et al. Neuronal stress pathway mediating a histone methyl/phospho switch is required for herpes simplex virus reactivation. Cell Host Microbe. 2015;18(6):649–58. doi: 10.1016/j.chom.2015.11.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Lang F, Sun Z, Pei Y, Singh RK, Jha HC, Robertson ES. Shugoshin 1 is dislocated by KSHV-encoded LANA inducing aneuploidy. PLoS Pathog. 2018;14(9):e1007253. doi: 10.1371/journal.ppat.1007253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Sun Z, Xiao B, Jha HC, Lu J, Banerjee S, Robertson ES. Kaposi’s sarcoma-associated herpesvirus-encoded LANA can induce chromosomal instability through targeted degradation of the mitotic checkpoint kinase Bub1. J Virol. 2014;88(13):7367–78. doi: 10.1128/JVI.00554-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Verma SC, Cai Q, Kreider E, Lu J, Robertson ES. Comprehensive analysis of LANA interacting proteins essential for viral genome tethering and persistence. PLoS One. 2013;8(9):e74662. doi: 10.1371/journal.pone.0074662 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Xiao B, Verma SC, Cai Q, Kaul R, Lu J, Saha A, et al. Bub1 and CENP-F can contribute to Kaposi’s sarcoma-associated herpesvirus genome persistence by targeting LANA to kinetochores. J Virol. 2010;84(19):9718–32. doi: 10.1128/JVI.00713-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Jackson BR, Noerenberg M, Whitehouse A. A novel mechanism inducing genome instability in Kaposi’s sarcoma-associated herpesvirus infected cells. PLoS Pathog. 2014;10(5):e1004098. doi: 10.1371/journal.ppat.1004098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Pinto LM, Pailas A, Bondarchenko M, Sharma AB, Neumann K, Rizzo AJ, et al. DAXX promotes centromeric stability independently of ATRX by preventing the accumulation of R-loop-induced DNA double-stranded breaks. Nucleic Acids Res. 2024;52(3):1136–55. doi: 10.1093/nar/gkad1141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Hellert J, Weidner-Glunde M, Krausze J, Richter U, Adler H, Fedorov R, et al. A structural basis for BRD2/4-mediated host chromatin interaction and oligomer assembly of Kaposi sarcoma-associated herpesvirus and murine gammaherpesvirus LANA proteins. PLoS Pathog. 2013;9(10):e1003640. doi: 10.1371/journal.ppat.1003640 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Viejo-Borbolla A, Ottinger M, Brüning E, Bürger A, König R, Kati E, et al. Brd2/RING3 interacts with a chromatin-binding domain in the Kaposi’s Sarcoma-associated herpesvirus latency-associated nuclear antigen 1 (LANA-1) that is required for multiple functions of LANA-1. J Virol. 2005;79(21):13618–29. doi: 10.1128/JVI.79.21.13618-13629.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Inagaki T, Kumar A, Wang K-H, Komaki S, Espera JM, Bautista CSA, et al. Studies on gene enhancer with KSHV mini-chromatin. bioRxiv. 2025. doi: 10.1101/2025.03.24.644916 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Edwards DS, Maganti R, Tanksley JP, Luo J, Park JJH, Balkanska-Sinclair E, et al. BRD4 prevents R-loop formation and transcription-replication conflicts by ensuring efficient transcription elongation. Cell Rep. 2020;32(12):108166. doi: 10.1016/j.celrep.2020.108166 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Iwaisako Y, Watanabe T, Futo M, Okabe R, Sekine Y, Suzuki Y, et al. The contribution of Kaposi’s sarcoma-associated herpesvirus ORF7 and its zinc-finger motif to viral genome cleavage and capsid formation. J Virol. 2022;96(18):e0068422. doi: 10.1128/jvi.00684-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Lu F, Day L, Gao S-J, Lieberman PM. Acetylation of the latency-associated nuclear antigen regulates repression of Kaposi’s sarcoma-associated herpesvirus lytic transcription. J Virol. 2006;80(11):5273–82. doi: 10.1128/JVI.02541-05 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Rennekamp AJ, Wang P, Lieberman PM. Evidence for DNA hairpin recognition by Zta at the Epstein-Barr virus origin of lytic replication. J Virol. 2010;84(14):7073–82. doi: 10.1128/JVI.02666-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Shiromoto Y, Sakurai M, Minakuchi M, Ariyoshi K, Nishikura K. ADAR1 RNA editing enzyme regulates R-loop formation and genome stability at telomeres in cancer cells. Nat Commun. 2021;12(1):1654. doi: 10.1038/s41467-021-21921-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Kang H, Lieberman PM. Cell cycle control of Kaposi’s sarcoma-associated herpesvirus latency transcription by CTCF-cohesin interactions. J Virol. 2009;83(12):6199–210. doi: 10.1128/JVI.00052-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357–9. doi: 10.1038/nmeth.1923 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Li H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics. 2018;34(18):3094–100. doi: 10.1093/bioinformatics/bty191 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, et al. Twelve years of SAMtools and BCFtools. Gigascience. 2021;10(2):giab008. doi: 10.1093/gigascience/giab008 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Colocalization of epigenetic marks with LANA at KSHV TR.

A. Schematic of the KSHV genome showing the terminal repeats (TR) relative to the unique region open reading frames (blue) and primer positions for TR, ORF45, and ORF75. B. ChIP-qPCR for histone H3K4me3, H3K27ac, H3K9me3, LANA or control IgG assayed at the TR, ORF45 or ORF75 loci in BCBL1 or iSLK cells. C. Same as in panel B, except ChIP antibodies with RAD21, CTCF, or IgG control. ** p < .01, *** p < .001, student 2-tailed t-test, n = 3 biological replicates.

(PDF)

ppat.1013029.s001.pdf (200.6KB, pdf)
S2 Fig. R-loop formation at the KSHV TR.

A. DRIP assay with BC1 cells using S9.6 (blue) or control IgG (black) assayed with primers for cellular actin or KSHV TR ORF45 and ORF75. *** p < .001, student two-tailed t-test. B. IGV screen shot of RNA transcripts mapped to KSHV TR region using public data sets for total RNAseq in BCBL1 cells during latent conditions (SRR15069589, SRR15069590, SRR15069591). The reference map consists of a small region of the unique region with K15 and 2 copies of the TR. TR transcripts Tr(1) and Tr(2) are indicated above.

(S2_Fig.PDF)

ppat.1013029.s002.pdf (220.8KB, pdf)
S3 Fig. Colocalizations of LANA, H3pS10 and PCNA.

A. Representative images of iSLK cells showing the percentage of cells with LANA and colocalizations with H3pS10 and PCNA. 60x magnification, N = 4, total of 126 cells, B. Quantification of percentage of cells with LANA-NB or LANA-NBs colocalized with both PCNA and H3pS10. ****p < .0001, student two-tailed t-test.

(S3_Fig.PDF)

ppat.1013029.s003.pdf (558.3KB, pdf)
S4 Fig. Confocal microscopy IF analysis of H3pS10 and LANA colocalization in iSLK cells.

H3pS10 (blue), LANA (red), Dapi (blue). Arrows indicate examples of colocalization.

(S4_Fig.PDF)

ppat.1013029.s004.pdf (154.3KB, pdf)
S5 Fig. Confocal microscopy IF analysis of PCNA-H3pS10-LANA colocalization in iSLK cells.

PCNA (green), H3pS10 (blue), LANA (red). Arrow indicates example of colocalization.

(S5_Fig.PDF)

ppat.1013029.s005.pdf (182.9KB, pdf)
S6 Fig. Western blot of BCBL1 cells treated with FVP or triptolide.

A-B. Western blots of BCBL1 cells treated with 0.4 μM FVP (pane A) or with 2 μM triptolide (panel B) for 0, 2, 4 or 24 hrs and probed for LANA, RNAPII pS2, pS5, H3pS10, or β-actin. C. ChIP-qPCR for IgG, LANA, RNAPII pS5 or pS2 in BCBL1 cells treated with either FVP or triptolide (TRP) for 2 h. D. Same as in panel C, except for ChIP-qPCR with IgG and H3K9me3. **p < .01, ****p < .0001, student two-tailed t-test.

(S6_Fig.PDF)

ppat.1013029.s006.pdf (591.9KB, pdf)
S7 Fig. Loss of LANA-NBs after flavopiridol (FVP) treatment. (A-C).

iSLK cells were treated with DMSO, 0.4 μM FVP for 2h or 24 hr and assayed by IF using LANA antibody (red) and counterstained with Dapi (blue) imaged at 20x (panel A), 60x (panel B), or enlarged single nuclei imaged by phase contrast (panel C). D. Quantification of LANA signal intensity. E. Quantification of cells lacking LANA signals (LANA-free cells). **p < .01, ***p < .001, student two-tailed t-test.

(S7_Fig.PDF)

ppat.1013029.s007.pdf (699.7KB, pdf)
S8 Fig

A. TR DNA was quantified by qPCR in 293T cells transfected with F-LANA and either p8xTR or p2xTR plasmids at days 3, 6, 9, and 12. *p < .05, **p < .01, student two-tailed t-test. B. Native ChIP for IgG, LANA, H3K4me3, H3K27ac in BCBL1 cells using conditions identical to standard ChIP assay but lacking initial formaldehyde cross-linking.

(S8_Fig.PDF)

ppat.1013029.s008.pdf (313.7KB, pdf)
S9 Fig. RNAseq analysis of p8xTR.

29T cells transfected with p8xTR and pFLAG-LANA were assayed 72 hrs post-transfection for total RNAseq using Illumina paired-end method. FASTQ files were mapped to the KSHV subgenomic fragment containing K15-2xTR-K1 sequence and visualized using IGV genome browser. LANA and CTCF binding sites are indicated above. Blue peaks represent read counts and presumptive splice junctions are indicated by blue and red loops. Sequence of transcripts Tr (1) and T2 (2) are indicated below.

(S9_Fig.PDF)

ppat.1013029.s009.pdf (375KB, pdf)
S10 Fig. R-loops at TR facilitate LANA binding.

A-C. mCherry-tagged RNase H WT or MT or empty vector were co-transfected with p8xTR + FLAG-LANA and assayed for binding to the TR region by ChIP assay using antibody mCherry (panel A) and TR- DRIP assay (panel B), or LANA ChIP assay (panel C) and assayed with primers specific for KSHV TR. *p < .05, **p < .01, ***p < .001, or not significant (ns) using student two-tailed t-test. D. Western blot of 3 biological replicates used for experiments shown in panels A-C. E. Fluorescence microscopy of RFP for RNAse H WT and RNAse H MT expression in transfected 292T cells.

(S10_Fig.PDF)

ppat.1013029.s010.pdf (216.9KB, pdf)
S1 Movie. Confocal microscopy IF analysis of PCNA-H3pS10-LANA colocalization in iSLK cells.

PCNA (green), H3pS10 (blue), LANA (red).

(S1_Movie.MP4)

Download video file (3.1MB, mp4)
S1 Table. List of oligonucleotides used in this study.

(S1_Table.PDF)

ppat.1013029.s012.pdf (26.9KB, pdf)
S1 File. PRISM files.

(ZIP)

ppat.1013029.s013.zip (404KB, zip)
S1 File. Legends.

(DOCX)

ppat.1013029.s014.docx (15.8KB, docx)

Data Availability Statement

All relevant data are in the manuscript and its supporting information files.


Articles from PLOS Pathogens are provided here courtesy of PLOS

RESOURCES