Skip to main content
NCBI home page
Journal of Traditional and Complementary Medicine logoLink to Journal of Traditional and Complementary Medicine
. 2024 Jul 2;15(5):495–508. doi: 10.1016/j.jtcme.2024.07.002

Xinbao pill attenuated water retention by regulating the CaSR/AQP2 pathway in LAD-induced chronic heart failure rats

Shiqi Li a,1, Yuanping Wang a,e,1, Xulan Cui b, Xiaoyu Tian c, Ziwei Huang c, Rong Zhang c, Yuanyuan Cheng c,⁎, Zhongqiu Liu c,⁎⁎, Dawei Wang a,d,⁎⁎⁎
PMCID: PMC12447149  PMID: 40979484

Abstract

Background

Water retention is one of the important factors in the development and exacerbation of chronic heart failure (CHF). Xinbao Pill (XBP) is widely used as an adjuvant therapy for CHF. However, the therapeutic effect of XBP on water retention in CHF remains unclear.

Purpose

Our research was aimed to investigate the effect and mechanism of XBP on water retention in CHF.

Methods

Male Sprague-Dawley (SD) rats underwent left anterior descending (LAD) artery ligation to establish the CHF model and were subsequently administrated with different doses of XBP or Qili Qiangxin (QLQX). Cardiac functions were assessed using M-mode echocardiography. Cardiac remodeling and myocardial fibrosis were observed using HE and Masson staining. Additionally, the expression of the CaSR/AQP2 signaling pathway in the renal was detected using western blotting analysis, quantitative PCR analysis, immunofluorescence staining, immunohistochemistry, and co-immunoprecipitation assays. Furthermore, CaSR inhibitor NPS2143 was used to confirm the role of CaSR on the effect of XBP for water retention.

Results

In the LAD-induced CHF rat model, XBP improved EF (ejection fraction) and LVFS (fractional shortening), and alleviated cardiac fibrosis. Importantly, XBP significantly increased the 24-h urine volume and decreased urinary protein level after CHF. Further mechanism studies showed that XBP treatment could decrease the expression of renal AQP2 at the protein and mRNA levels. Moreover, XBP promoted renal AQP2 ubiquitination by upregulating CaSR and p-p38-MAPK expression. Meanwhile, XBP suppressed the expression of p-CREB to inhibit the mRNA expression of AQP2 in the renal tissue. However, NPS2143 blocked the beneficial effects of XBP on cardiac function and water retention, even stopped the inhibitory effect on AQP2 expression by XBP.

Conclusion

Our study revealed that XBP improved water retention against CHF via promoting CaSR/p38-MAPK-mediated AQP2 ubiquitination and regulating CaSR/CREB-mediated AQP2 transcription.

Keywords: Xinbao pill, Chronic heart failure, Water retention, Calcium-sensing receptor, Aquaporin2

Graphical abstract

Image 1

Open in a new tab

1. Introduction

Chronic heart failure (CHF), an advanced heart disease syndrome, poses a grave threat to human health. According to reports, there are 64.3 million people who suffer from heart failure.1 It is predicted that the prevalence of heart failure is still on the rise, with estimates of 1–20 cases per 1000 population per year.2 The pathology of CHF probably involves myocardial ischemia, water retention, inflammation, and abnormal ventricular pressure.3 Water retention, one of the most important pathophysiological changes associated with CHF, is also regarded as the leading contributor to cardiogenic edema.4 In CHF, water retention exacerbates cardiac remodeling by activating the neuro-endocrine system, reducing the effective circulating blood volume, and increasing plasma catecholamines, angiotensin II, and other substances.5 Thus, improving water retention is a key strategy for CHF therapy. Currently, diuretics are the primary treatment for water retention. However, long-term or inappropriate large-dose use of diuretics is prone to diuretic resistance, and the incidence rate is reportedly about 20 %–30 % and the study indicated that the risk of cardiovascular adverse events increased with the severity of the diuretic impact.6,7 Therefore, it is urgent to explore effective drugs and therapeutic targets to treat water retention in CHF.

Aquaporin2 (AQP2) is mainly distributed in the principal cell of renal collecting ducts, which is crucial for controlling the permeability to water.8,9 In CHF, arginine vasopressin (AVP) stimulation causes elevated renal AQP2 expression, leading to water retention.10,11 AVP influences AQP2 expression through both short- and long-term regulation.12 The short-term regulation mechanism is that the AVP stimulates protein kinase A, causing AQP2 phosphorylation in the cytoplasmic vesicle and subsequently inserting into the apical membrane. The long-term mechanism is that as AVP levels grow, more intracellular cAMP accumulates. Subsequently, the cAMP-response element binding protein (CREB) stimulates the transcription of AQP2, raising the total amount of AQP2 in the collecting duct.13,14

The calcium-sensing receptor (CaSR), a member of the C family of G protein-coupled receptors, would be activated at high urinary calcium concentrations to offset the effects of AVP.15 CaSR is expressed in the apical membrane of the collecting duct, which would hinder the transport and expression of AQP2.16 It has been proven that the activation of CaSR can drastically lower the level of AQP2 phosphorylation.17 In comparison to wild-type rats, Pendrin/NaCI cotransporter double-knockout rats exhibited a decrease in renal reabsorption capability which was related to their lower expression of AQP2, and higher levels of phosphorylation of AQP2 at S261, p38-MAPK, and the ubiquitination of AQP2.18 Additionally, it has been observed increasing CaSR would activate p38-MAPK pathway, while inhibiting CaSR would have the opposite result, which indicated that influencing CaSR would regulate the expression of p38-MAPK and its downstream proteins.19,20Taken together, these findings point out that targeting CaSR/AQP2 may turn into a promising therapeutic strategy for the treatment of water retention in CHF.

Traditional Chinese medicine (TCM) has a specific role in treating heart failure.21 Xinbao pill (XBP), a kind of proprietary traditional Chinese medicine, is used to treat CHF in clinic. A meta-analysis including a total of 882 patients demonstrated that XBP as an adjunctive medication for treating CHF was superior to conventional therapy in improving cardiac function.22 Our previous study revealed that XBP relieved myocardial ischemia-reperfusion and CHF in animal experiments.23,24 However, it is still unclear whether XBP regulates water retention in CHF. Thus, clarifying the underlying mechanism of XBP for water retention in CHF is necessary and meaningful.

In this study, we investigated whether XBP would improve water retention by modulating the CasR/AQP2 pathway in the LAD-induced CHF rats.

2. Materials and methods

2.1. Drugs and reagents

XBP was obtained from Guangdong XINBAO PHARM-TECH Co., Ltd. (Guangzhou, China), and the chemoprofile and identified chemicals were reported in our previous study.23 Qili Qiangxin (QLQX) was purchased from YILING PHARMACEUTICAL Co., Ltd. (Shijiazhuang, China). Antibodies against phospho-p38MAPK (#sc-166182), AQP2 (#sc-515770), CREB-1 (#sc-377154c), phospho-CREB-1 (#sc-81486c), CaSR (#sc-47741c) were purchased from Santa Cruz Biotechnology, Inc (California, USA). Phospho-AQP2 (Ser261) antibody was obtained from PhosphoSolutions, Inc. (Colorado, USA). Antibody against p38MAPK (#14064-1-AP) were bought from Proteintech Group, Inc (Chicago, USA). Ubiquitin (#3936) was obtained from Cell Signaling Technology, Inc (Boston, MA). NPS2143 (#HY-10007) was obtained from MedChemExpress, Inc (New Jersey, USA).

2.2. Animal model of LAD-induced CHF

The animal experimental procedures and animal welfare conditions were reviewed, approved, and monitored by the Committee on Ethical USE of Animals of Guangzhou University of Chinese Medicine (Ethical number: IITCM-20220207). The male Sprague-Dawley (SD) rats (250 ± 10 g) were purchased from the Animal Laboratory Center of Southern Medical University. All Rats were raised in a specific pathogen-free (SPF) environment and randomly assigned to 6 groups after 7 days of adaptive feeding: Sham, Model, XBP-L, XBP-M, XBP-H, and QLQX groups.

The LAD-induced CHF rat model was established by ligating the left anterior descending (LAD) artery in all groups except for the sham group. The sham group only received left thoracotomy without ligation. Following are the details of the specific operation: 2 % pentobarbital sodium (40 mg/kg) was administered intraperitoneally to anesthetize SD rats. Then the rats were subjected to a small animal ventilator with the following parameters: a respiratory ratio of 2:1, tidal volume ranging from 6 to 8 mL/kg, and a frequency of 70 breaths per minute. After performing a left thoracotomy, a 6–0 nylon suture was used to block the LAD artery.25 Then Routine feeding for 4 weeks, the small animal color Doppler ultrasound indicated that LAD-induced CHF was successfully established when the LVEF was less than 45 %. After successful modeling, the XBP-L, XBP-M, and XBP-H groups were given 0.04, 0.08, and 0.12 g/kg/d of XBP by gavage, respectively. Additionally, the QLQX group was given 1 g/kg/d of QLQX as a positive control, and equal volumes of saline were given to the Sham and Model groups. The rats in each group received intragastric administration for 4 weeks (Fig. 1 A).

Fig. 1.

Fig. 1

Open in a new tab

XBP administration ameliorated the cardiac function in LAD-induced CHF rats. (A) The schematic diagram of animal experimental design. (B) Representative M-mode echocardiography from sham, model, XBP-L, XBP-M, XBP-H, and QLQX groups. (C) The effects of XBP on the cardiac function parameters, including ejection fraction (EF%), Fractional shortening (FS%), end-diastolic volume (EDV), Left ventricular end-diastolic diameter (LVEDD), end-systolic volume (ESV), left ventricular end-systolic diameter (LVESD). The data are presented as Mean ± SEM (n = 6), one-way nested ANOVA followed Dunnett's test was used for multiple groups comparisons, sham vs. model group, #p < 0.05, ##p < 0.01, ###p < 0.001; XBP(L/M/H) or QLQX vs. model group, *p < 0.05, **p < 0.01, ***p < 0.001.

2.3. Inhibition of CaSR with NPS2143 in LAD-induced CHF model

To further define the mechanisms of the connection of XBP and CaSR activation, we used NPS2143 to inactive CaSR in LAD-induced CHF rat experiment (Ethical number: ZYD-2024-011). The rats were divided into the sham, model, XBP-H, and combination treatment of XBP and NPS2143 group. The administration methods for the sham, model, and XBP-H groups were the same as described above. XBP plus NPS2143 group was administered orally at doses of XBP 0.12 g/kg/day and NPS-2134 0.07 mg/ml/day. Each group of rats was administered by gavage for 4 weeks.

2.4. Echocardiographic analysis

After 4 weeks of therapy, rats were anesthetized with 1.5 % isoflurane, and the cardiac function indicators, including ejection fraction (EF), end-diastolic volume (EDV), end-systolic volume (ESV), fractional shortening (FS), end-diastolic dimension (LVEDD) and left ventricular end-systolic dimension (LVESD) were analyzed using a Vevo 2100 Imaging System (VisualSonics Inc., Toronto, Canada).

2.5. HE and masson trichrome staining

The heart tissues were fixed with 4 % paraformaldehyde for 24 h. The heart tissues were then dehydrated and embedded in paraffin, cut into 5 μM sections, and then stained with Hematoxylin-eosin or Masson's trichrome. Subsequently, they were examined with a high-magnification microscope (Olympus, Japan). HE staining was applied to evaluate basic pathological changes and Masson's trichrome staining was used to explore cardiac fibrosis.

2.6. Measurement of 24-h urine volume and determination of urinary protein levels

Before and 4 weeks after administration, rats were placed in metabolic cages. The 24-h urine volume of each rat was recorded and collected. After urine collection, the samples were centrifuged at 3000 rpm for 15 min, and the supernatant was collected and stored at −80 °C. Urinary protein levels were determined at 595 nm using a urinary protein quantitative test kit (Nanjing Jiancheng, C035-2-1).

2.7. Western blot analysis

The protein was extracted from heart tissues and renal tissues using RIPA lysis buffer (containing 1 % phosphatase and proteinase inhibitors). The protein concentrations were calculated using Pierce™ BCA protein assay kit. Following the standard procedures, equivalent volumes of protein samples were separated on the SDS-polyacrylamide gel and then transferred onto polyvinylidene fluoride (PVDF) membranes. After being blocked with 5 % BSA for 1 h, the membranes were incubated with primary antibodies at 4 °C overnight. Subsequently, the membranes were incubated with secondary mouse or rabbit antibodies coupled to horseradish peroxidase (HRP) at room temperature. The bands were detected with enhanced chemiluminescence (ECL) detection reagents, and the results were analyzed using Image J software.

2.8. Quantitative PCR analysis

The relative levels of the AQP2 and CaSR mRNA transcripts to those of β-tubulin were determined by Quantitative PCR (qPCR) Analysis. The primer sequences were as follows: forward, 5′-CTGGGGGACTGTGCTTAGTG-3′ and reverse, 5′-CCGGCTCTGTATCACCACAG-3′ for AQP2 (135 bp); forward, 5′- AAGGCTTTGCCATTGAAGCAG-3′ and reverse, 5′- GATGGCCTTTGGGTCTCCAT-3′ for CaSR (128 bp); forward, 5′-CAACTATGTGGGGGACTCGG-3′ and reverse, 5′- TGGCTCTGGGCACATACTTG -3′ for β-tubulin (89 bp). Total RNA was extracted from renal tissues using TRIzol reagent. The RNA concentrations were measured using NANO DROP 2000 (Thermo Fisher, USA). In accordance with the recommended procedures, reverse transcription of RNA into cDNA was performed using a cDNA Reverse transcriptase kit, and then quantitative PCR amplification was performed using the SYBR Green Premix Pro Taq HS qPCR Kit on Real-Time PCR System (BioRad, CA).

2.9. Immunofluorescence staining

After deparaffinization, rehydration, and antigen retrieval, slices were fixed and permeabilized with 4 % paraformaldehyde containing 0.1 % Triton X-100 for 20 min at 4 °C. The slices were incubated with 5 % BSA buffer for 1 h, followed by incubation with the primary antibody against AQP2 and CasR at 4 °C overnight. The slices were probed with the particular secondary antibodies for 30 min at room temperature. DAPI was used to stain nucleus. Results were captured with fluorescence microscopy.

2.10. Immunohistochemistry

Paraffin-embedded rats’ renal sections were used for Immunohistochemical staining. The experiment involved baking slices, dewaxing, rehydrating, and retrieving antigens. After that, endogenous peroxidase activity in renal tissues was blocked using the H2O2 solution. Slides were blocked with 5 % BSA for 30 min at room temperature prior to getting incubated with primary antibodies against AQP2 (1:100) and CasR (1:200) overnight at 4 °C. The second antibody was then incubated for 1 h at room temperature. Diaminobenzidine (DAB) staining solution was used for color-rendering and then stained with hematoxylin to counterstain the nucleic acids. Dehydrated and covered the slides before being evaluated with an Olympus microscope.

2.11. Coimmunoprecipitation

Coimmunoprecipitation was employed to detect the ubiquitinated AQP2. The primary antibody against AQP2 was added to 300 μg of renal homogenate to an equal volume and incubated on a shaker for 6 h at 4 °C, and an IgG antibody was selected as the negative control. The protein mixture was combined with 50 μl of suspended protein A/GPLUS agarose, which was then incubated at 4 °C overnight. Subsequently, the mixture was centrifuged to remove the supernatant and gather pellets, which were then washed 4 times. The immunoprecipitates were eluted with 2X SDS loading buffer for further immunoblotting analysis.

2.12. Statistical analysis

The results are presented as means ± SEM and the statistical analysis was performed by one-way analysis of variance (ANOVA) with SPSS 22 (SPSS Inc., USA). Statistical significance was defined as a p-value <0.05.(*P < 0.05, **P < 0.01, and ***P < 0.001). Figures were mapped using GraphPad Prism 8.0 (GraphPad Prism Software, Inc, CA). At least three independent repeats of each experiment were conducted.

3. Results

3.1. XBP promoted cardiac function in LAD-induced CHF rat model

To clarify the cardioprotective effects of XBP, a LAD-induced CHF rat model was adopted and echocardiography was used to assess the heart function. As shown in Fig. 1B and C, as evidenced by a drop in EF and FS, as well as an increase in EVD, EVS, LVEDD and LVESD, the cardiac function of the model group severely deteriorated when compared to the sham group. Remarkably, in comparison to the model group, XBP (XBP-M and XBP-H) or QLQX administration reversed the impaired cardiac function which considerably improved EF and FS, and significantly decreased EVD, EVS, LVEDD, and LVESD.

3.2. XBP attenuated cardiac remodeling in LAD-induced CHF rats

To further assess the cardioprotective effect of XBP on LAD-induced CHF, HE staining was performed to examine the myocardium's pathological change, and Masson trichrome staining was used to observe the severity of myocardial fibrosis. HE staining (Fig. 2 A) showed that the cardiomyocytes in the model group were swollen, disorganized, and exhibited a widening of the intercellular space with inflammatory cell infiltration. As compared to the model group, the administration of XBP or QLQX attenuated pathological changes, restoring normal cardiomyocyte morphology, improving organization, and reducing inflammatory cell infiltration. Meanwhile, there were evident differences between the model group and the sham group in terms of cardiac fibrosis, and there was a significant increase in heart fibrosis in the rats of the model group. When compared to the model group, XBP treatment reduced the area where collagen was deposited. Additionally, XBP and QLQX exhibited an equal effect on alleviating cardiac fibrosis (Fig. 2 B). These findings indicate that XBP alleviated cardiac fibrosis caused by MI.

Fig. 2.

Fig. 2

Open in a new tab

XBP administration attenuated cardiac remodeling in LAD-induced CHF rats. (A) Representative micrographs of HE staining from each group. (B) Representative micrographs of Masson's trichrome staining from each group.

3.3. XBP suppressed water retention and AQP2 expression in renal tissue of LAD-induced CHF rats

In CHF, insufficient cardiac output and the redistributed circulating blood volume easily cause water retention.26,27 As shown in Fig. 3 A, the 24-h urine volume results showed that CHF rats had significantly less urine volume than the sham group, and the urine volume increased after treatment with XBP or QLQX. In heart failure, the increase in urinary protein content may be related to fluid balance disruption.28,29 Therefore, we measured the urinary protein level in each group. The results showed that compared to the sham group, the model group exhibited a significant increase in urinary protein content, while XBP at middle and high dose group and QLQX group showed a significant decrease in urinary protein level (Fig. 3 B). Those results suggested that XBP improved water retention in CHF rats.

Fig. 3.

Fig. 3

Open in a new tab

XBP reduced water retention and renal AQP2 expression in LAD-induced CHF rats. (A)The 24-h urine volume of rats both in 4 weeks after LAD operation (pre-therapeutic) and 4 weeks after administration (post-therapeutic) (n = 6). (B) The content of urinary protein in each group (n = 5). (C and D) The protein expression of AQP2 in renal tissue from CHF rats(n = 6). (E) The mRNA expression of AQP2 in renal tissue from CHF rats (n = 6). (F) Immunofluorescence assays presenting total and apical AQP2 expression (green fluorescence) and nucleus (blue fluorescence) in renal tissue from CHF rats. (G) Immunohistochemistry assays showing the collecting duct AQP2 expression in renal tissue from CHF rats. One-way nested ANOVA followed Bonferroni test was used for multiple groups comparisons, the data are presented as Mean ± SEM (n = 6), sham vs. model group, #p < 0.05, ##p < 0.01, ###p < 0.001; XBP(L/M/H) or QLQX vs. model group, *p < 0.05, **p < 0.01, ***p < 0.001.

AQP2 plays a crucial role for water absorption by controlling the renal collecting duct's permeability to water.30,31 It has been previously discovered that an increase in renal AQP2 expression was linked to a worsening CHF.32,33 Thus, we adopted a variety of experimental methods to analyze the expression level of AQP2. The western blot results in Fig. 3B and C demonstrated a significant rise in renal AQP2 protein levels in the model group. Conversely, the administration of XBP downregulated the levels of renal AQP2 in a dose-dependent manner. Moreover, XBP also depressed the mRNA levels of Aqp2 (Fig. 3 D), which was consistent with the western blot results. To further confirm this finding, we conducted the immunohistochemical and immunofluorescence assays. The outcomes of those analyses similarly revealed that XBP treatment markedly decreased AQP2 protein abundance and that collecting duct AQP2 expression was dramatically decreased in renal tissue from CHF rats (Fig. 3E and F). Thus, these findings demonstrated that XBP had the effect of suppressing renal AQP2 expression, which was essential for maintaining water balance in CHF.

3.4. XBP increased CaSR expression in renal tissue of LAD-induced CHF rats

To further investigate the underlying mechanism by which XBP ameliorates water retention to counteract CHF progression, we used a range of experimental methods to assess the relative pathways for regulating the AQP2. CaSR suppressed AQP2 production and transport when it was activated in collecting duct cells, and subsequently weakened the ability of the renal collecting duct to reabsorb water.34 However, the CaSR in heart tissue plays a pernicious role.35,36 Thus, western blot analysis of the CaSR expression was performed both in the renal and heart tissue of rats with LAD-induced CHF. We discovered that although CasR was expressed more in the model group compared to the control group in cardiac tissue, there was no obvious difference after the administration of XBP (Fig. 4A and B). The q-PCR analysis performed consistent results showing that there was no discernible difference in the levels of mRNA following administration of XBP (Fig. 4C). Contrarily, the renal CaSR protein and mRNA expression both elevated after XBP treatment in comparison to the model group (Fig. 4D–F). It indicated that XBP treatment probably increased the renal CasR expression to regulate the AQP2 expression. Then, immunohistochemical and immunofluorescence analyses were performed to further assess the expression of CaSR in renal tissues. We observed that the XBP group's renal CaSR expression was considerably higher than that of the model group, which was in line with the results from the western blot analysis mentioned above (Fig. 4G and H). Consequently, the renal expression of CasR was enhanced by XBP administration, and a high dose of XBP had more noticeable effects.

Fig. 4.

Fig. 4

Open in a new tab

XBP significantly increased renal CaSR expression in LAD-induced CHF rats. (A and B) The protein expression of CaSR in heart tissue from CHF rats. (C) The mRNA expression of CaSR in heart tissue from CHF rats. (D and E) The protein expression of CaSR in renal tissue from CHF rats. (F) The mRNA expression of CaSR in renal tissue from CHF rats. (G) Immunofluorescence assays presenting CaSR expression (green fluorescence) and nucleus (blue fluorescence) in renal tissue from CHF rats. (H) Immunohistochemistry assays showing CaSR expression in renal tissue from CHF rats. One-way nested ANOVA followed Bonferroni test was used for multiple groups comparisons (B, C), and One-way nested ANOVA followed LSD test was used for multiple groups comparisons (E, F), the data are presented as Mean ± SEM (n = 6), sham vs. model group, #p < 0.05, ##p < 0.01, ###p < 0.001; XBP(L/M/H) or QLQX vs. model group, *p < 0.05, **p < 0.01, ***p < 0.001.

3.5. XBP suppressed renal AQP2 expression via CaSR/p38MAPK and CaSR/CREB pathways in LAD-induced CHF rats

Studies have shown that CaSR activation significantly increased p-p38-MAPK expression and AQP2 phosphorylation, leading to a decrease in total AQP2 expression.17 Additionally, it is reported that p-p38-MAPK was crucial in regulating the AQP2 ubiquitination and abundance.37,38 Here, we demonstrated that XBP might decrease renal AQP2 expression via increasing renal CasR expression in LAD-induced CHF rats. Hence, we further explored whether XBP would suppress AQP2 via the CaSR/p38-MAPK pathway.

First, we examined the protein expression of p38MAPK and p-p38MAPK, and we found that the ratio of p-p38MAPK and p38MAPK was markedly lower in the model group, whereas was functionally enhanced by XBP administration, especially in the high-dose XBP group (Fig. 5A and B). Next, we measured the renal expression of p-S261 AQP2, and the p-S261 AQP2 in the model group was found to be dropped, while XBP administration led to an increase (Fig. 5C and D). The elevated AQP2 phosphorylation probably leads to increased ubiquitination, which is a relevant aspect of the decline in protein expression.39,40 As a result, we also detected whether XBP would regulate the ubiquitination of AQP2 in renal tissues. The results demonstrated that the AQP2 ubiquitination level was lower in the model group than the sham group. Conversely, the AQP2 ubiquitination level in the XBP group dramatically increased as compared to the model group (Fig. 5E and F).

Fig. 5.

Fig. 5

Open in a new tab

XBP suppressed renal AQP2 expression via promoting CaSR/p38-MAPK-mediated AQP2 ubiquitination and regulating CaSR/CREB-mediated AQP2 translation. (A and B) The protein expression of p-p38MAPK/p38MAPK in renal tissue from CHF rats (n = 6). (C and D) The protein expression of p-S261 AQP2 in renal tissue from CHF rats (n = 6). (E and F) The ubiquitination of AQP2 in renal tissue from CHF rats (n = 3). (G and H) The protein expression of p-CREB/CREB in renal tissue from CHF rats (n = 6). One-way nested ANOVA followed Dunnett's T3 test was used for multiple groups comparisons (B), and One-way nested ANOVA followed LSD test was used for multiple groups comparisons (D, F, H), the data are presented as Mean ± SEM, sham vs. model group, #p < 0.05, ##p < 0.01, ###p < 0.001; XBP(L/M/H) or QLQX vs. model group, *p < 0.05, **p < 0.01, ***p < 0.001.

Additionally, CaSR activation has been shown to reduce cAMP, which in turn would affect CREB phosphorylation and then suppress AQP2 transcription.41 Our findings (Fig. 3C) also demonstrated that XBP administration reduced the mRNA expression of AQP2 in the renal of rats with CHF. Consequently, we also examined whether XBP would regulate the AQP2 transcription via the CasR/CREB pathway. The results confirmed that in the model group, there was a substantial rise in the ratio of p-CREB/CREB, while the ratio was reversed in the XBP group (Fig. 5G and H).

3.6. NPS2143 reversed the cardiac function improvement mediated by XBP

NPS2143, an oral active calcimimetic, is known asa selective calcium-sensing receptor (CaSR) antagonist. To illustrate the connection between XBP and CaSR activation, we conducted a combination treatment of XBP and NPS2143 in LAD-induced CHF rats and evaluated cardiac function and myocardial pathological changes. As depicted in Fig. 6 A-C, compared to the model group, XBP-H administration significantly improved the cardiac function with a considerable improvement in EF and FS. However, NPS2143 blocked the cardioprotective effect of XBP, resulting in a decrease in EF and FS. Additionally, HE staining (Fig. 6 D) showed that the XBP-H group alleviated swelling, disorganization, widened intercellular spaces, and inflammatory cell infiltration, while NPS2143 aggravated these pathological changes as compared to the XBP-H group. Meanwhile, XBP treatment led to a reduction in collagen deposition area compared to the model group. Conversely, the co-administration of XBP and NPS2143 resulted in an increased collagen deposition (Fig. 6 E). These findings suggested that NPS2143 counteracted the favorable effects of XBP on cardiac function.

Fig. 6.

Fig. 6

Open in a new tab

NPS2143 blocked the cardioprotective effect of XBP in CHF rats model. (A) Representative M-mode echocardiography images from sham, model, XBP-H, and XBP plus NPS2143 groups. (B and C) The effect of NPS2143 on the cardiac function parameters (EF% and FS%) improved by XBP in CHF rats. (D) Representative images of HE staining from each group. (E) Representative images of Masson's trichrome staining from each group. One-way nested ANOVA followed Bonferroni test was used for multiple groups comparisons, the data are presented as Mean ± SEM (n = 5), sham vs. model group, #p < 0.05, ##p < 0.01, ###p < 0.001; XBP-H vs. model group, *p < 0.05, **p < 0.01, ***p < 0.001; XBP plus NPS2143 vs. XBP-H group, ^p < 0.05, ^^p < 0.01, ^^^p < 0.001.

3.7. NPS2143 blocked the inhibitory effect of XBP on AQP2 expression in renal tissue of LAD-induced CHF rats

We observed the 24-h urine volume of each group and concurrently assessed urinary protein levels in the urine. As shown in Fig. 7 A, following treatment with XBP, a noticeable increase of 24-h urine volume was observed, whereas co-administration of XBP with NPS2143 led to a significant decrease. Meanwhile, XBP treatment effectively mitigated the increase of urinary protein, whereas co-administration of NPS2143 with XBP reversed this effect (Fig. 7 B). Additionally, we examined the expression of CaSR in renal tissues, and the results showed a decrease in CaSR expression in the group co-administered with NPS2143 and XBP compared to the XBP group (Fig. 7C and D). Finally, we assessed the protein and mRNA levels of Aqp2 in renal tissues. The results revealed that the combination treatment of NPS2143 and XBP led to elevated levels of AQP2 protein and mRNA in renal tissues, compared to the XBP group (Fig. 7E–G). Those data suggested that NPS2143 blocked the inhibitory effect of XBP on AQP2 expression.

Fig. 7.

Fig. 7

Open in a new tab

NPS2143 stopped the inhibitory effect of XBP on AQP2 expression in renal tissue of CHF Rats. (A) The effect of NPS2143 on the 24-h urine volume of rats after 4 weeks administration of XBP (n = 5). (B) The effect of NPS2143 on the content of urinary protein in XBP-treated CHF rats (n = 5). (C and D) The effect of NPS2143 on CaSR expression in renal tissue from XBP-treated CHF rats (n = 4). (E and F) The effect of NPS2143 on AQP2 protein expression in renal tissue from XBP-treated CHF rats (n = 4). (G) The effect of NPS2143 on AQP2 mRNA level in renal tissue from XBP-treated CHF rats (n = 4). One-way nested ANOVA followed Bonferroni test was used for multiple groups comparisons, the data are presented as Mean ± SEM, sham vs. model group, #p < 0.05, ##p < 0.01, ###p < 0.001; XBP-H vs. model group, *p < 0.05, **p < 0.01, ***p < 0.001; XBP plus NPS2143 vs. XBP-H group, ^p < 0.05, ^^p < 0.01, ^^^p < 0.001.

4. Discussion

In CHF, the heart and renal jointly regulate water metabolism through complex mechanisms.42 The heart primarily influences systemic water metabolism via its pumping function and neurohormonal regulation. When cardiac output decreases, reduced renal perfusion leads to decreased glomerular filtration, activation of the renin-angiotensin-aldosterone system increases sodium and water reabsorption, and changes in plasma osmolality and baroreceptor signaling stimulate the secretion of AVP, which promotes water reabsorption in the renal tubules, thereby reducing urine output.43 Concurrently, the renal regulates water balance through glomerular filtration, selective reabsorption of sodium, potassium, calcium, phosphorus, and water in the renal tubules, and the regulation of AQP2 expression.44 Furthermore, from the perspective of TCM, the heart, renal, and water metabolism are closely interconnected. TCM emphasizes the importance of the coordinated function of these organs in maintaining the normal physiological functions.45 Thus, understanding the interplay between cardiac and renal regulation of water metabolism is crucial for comprehensive treatment strategies for CHF.

This study proved that the Chinese patent medicine XBP could relieve water retention in CHF. Importantly, we elucidated the mechanism of XBP on improving water retention, which was related with reducing the transport and expression of AQP2 protein via regulating the CaSR-mediated signaling pathway.

Water retention is a significant pathological alteration in CHF, which indicates deteriorating cardiac function.46 Our findings showed that LAD-induced CHF rats experienced water retention and that XBP treatment could improve cardiac function and reverse water retention. XBW has a proven therapeutic effect in clinical practice, and it is commonly used as a supplementary therapy for various cardiovascular diseases, such as coronary heart disease and CHF,46, 47 but no pertinent evidence was conducted on water retention associated with CHF following XBP treatment. Therefore, we mainly concentrated on the underlying mechanism by which XBP reduced CHF-induced water retention.

The neuroendocrine system, especially AVP system, becomes active in CHF due to decreased cardiac output and inadequate tissue perfusion.48 AVP is released by nerve cells in the paraventricular and supraoptic nuclei of the hypothalamus. By binding to the V1a, V1b, and V2 receptors, AVP can exert a variety of biological effects, such as increasing platelet aggregation, antidiuresis, and smooth muscle contraction. When AVP binds to the V2 receptor located in the distal convoluted tubule and collecting duct of the renal, it causes the transfer of AQP2 from the cytoplasmic vesicles to the apical membrane, increasing water absorption and fluid retention.49 AQP2, consisting of 271 amino acids, one of the membrane proteins mediating the rapid transmembrane transport of water molecules, is important in maintaining water homeostasis.50 Regulation of AQP2 is a significant contributor to water retention in CHF. It has been reported that there was a substantial increase in AQP2 protein and mRNA in the renal of CHF rats as compared to the sham group.51 Our research revealed that, the renal AQP2 mRNA and protein levels in CHF rats were elevated, while XBP administration could decrease those in CHF rats. Immunohistochemistry and immunofluorescence results corroborated the above findings, demonstrating that XBP treatment lessened the density of AQP2 on the apical membrane in CHF rats. These results raised the possibility that XBP might affect CHF water retention by suppressing AQP2 expression and localization.

CaSR, known as a dimeric family C G-protein-coupled receptor, is extensively expressed in many tissues and exerts a wide range of physiological effects by triggering different intracellular signaling pathways. CaSR activation is crucial for the progression of many diseases, including cardiovascular and renal diseases.35, 52,35, 52 It is reported that activating the expression of cardiac CaSR would stimulate the Ca2+/calmodulin-dependent protein kinase II (CaMKII) pathway, which would lead to cardiomyocyte hypertrophy and death in a variety of cardiovascular diseases.53 Previous studies have shown that the number of apoptotic cardiomyocytes and CaSR expression in cardiac tissue were considerably increased in I/R rats.54 Our study found that rats with CHF had considerably higher CaSR expression in the hearts compared to the sham group. Interestingly, XBP administration had no discernible effect on the heart CaSR expression, but it greatly raised the level of CaSR in the renal, suggesting that XBP may affect the activation of the CaSR-related pathway in the renal as opposed to the heart. Moreover, decreased alterations in CaSR expression in the kidneys are associated with the degree of renal dysfunction.55 However, our findings showed that there was no significant decrease in renal CaSR expression between the sham and model group, which indicated that the degree of renal damage caused by heart failure may be relatively mild in the CHF model established 8 weeks after LAD surgery. It is reported that it might generally take more than 10 weeks to construct an animal model of cardio-renal syndrome using methods such as LAD surgery in the heart.56,57 However, under this situation, XBP treatment elevated CaSR expression in renal tissue. It has proved that affecting the expression of CaSR in the renal would affect water absorption. The renal CaSR is mainly expressed in the renal collecting duct's apical membrane, which would hinder the expression and transport of AQP2, and weaken the ability of the renal collecting duct to reabsorb water.58 Therefore, we speculated that CaSR played an important role in XBP-regulated water absorption. Previous studies have further revealed that CaSR would activate the p38-MAPK pathway, which would inhibit AQP2-Ser261 phosphorylation and increase AQP2 ubiquitination level, resulting in a reduction in AQP2 abundance to regulate the water metabolism.59 According to our research, XBP administration would enhance p38-MAPK phosphorylation, increase phosphorylation of AQP2 at Ser261, increase AQP2 ubiquitination, and consequently lower the amount of AQP2 protein in the renal. Additionally, we discovered that CREB phosphorylation was suppressed and AQP2 mRNA levels were reduced following administration of XBP in CHF rats. It was consistent with previous reports that noticed CaSR activation would down-regulate cAMP, which would affect the phosphorylation level of CREB, and lead to a reduction in the transcription of AQP2.60 To further validate the association between the effects of XBP and CaSR activation, we used the CaSR inhibitor NPS2143 and observed that NPS2143 reversed the cardioprotective effects of XBP and the inhibitory effect of XBP on AQP2 expression at the protein and mRNA level. These results confirmed that XBP might activate CaSR to regulate water balance in CHF.

In conclusion, our research suggests that XBP may facilitate AQP2 ubiquitination in renal tissue by stimulating the CaSR/p38-MAPK pathway and also reduce AQP2 mRNA expression via CaSR/CREB pathway to alleviate CHF-induced water retention (Fig. 8), which provides a scientific basis for the clinical use of XBP in treating CHF-related water retention.

Fig. 8.

Fig. 8

Open in a new tab

The underlying mechanism of XBP to improve water retention in CHF. XBP proved therapeutic effects against water retention in CHF through regulating CaSR/p38-MAPK-mediated AQP2 ubiquitination and CaSR/cAMP/CREB to inhibit AQP2 mRNA level.

Author contributions

SQL and YPW performed the experiments, collected the data and wrote the draft. XLC, XYT and ZWH performed the animal experiments. Rong Zang edited the manuscript. YYC, ZQL and DWW designed the study, interpreted the data and revised the manuscript.

Data availability

Raw data are available upon request from the corresponding author.

Funding statements

The present study was supported by grants from the National Natural Science Foundation of China (82174156), Key-Area Research and Development Program of Guangdong Province (No. 2020B1111100004), Guangdong Basic and Applied Basic Research Foundation (No. 2022A1515011701), University Research Program of Guangdong Provincial Department Education (2021ZDZX1010).

List of abbreviations

ANOVA one-way analysis of variance
AQP2 Aquaporin2
AVP arginine vasopressin
cAMP cyclic adenosine monophosphate
CaSR calcium-sensing receptor
CHF Chronic Heart Failure
CREB cAMP Responsive Element Binding protein
DAB Diaminobenzidine
ECL enhanced chemiluminescence
EDV end-diastolic volume
ESD left ventricular end-systolic diameter
HRP horseradish peroxidase
LAD left anterior descending
LVEDD left ventricular end-diastolic diameter
EF ejection fraction
LVESV left ventricular End-systolic volume
FS Fractional shortening
p38MAPK p38-mitogen-activated protein kinase
p-CREB phospho-cAMP Responsive Element Binding protein
p-p38MAPK Phospho-p38-mitogen-activated protein kinase
p-S261 AQP2 phospho-Aquaporin2(Ser261)
PVDF polyvinylidene fluoride
QLQX Qili Qiangxin
qPCR Quantitative PCR
TCM Traditional Chinese medicine
XBP Xinbao Pill
Open in a new tab

Declaration of competing interest

All authors declared that there are no competing financial interests in the paper.

Footnotes

Peer review under responsibility of The Center for Food and Biomolecules, National Taiwan University.

Contributor Information

Yuanyuan Cheng, Email: chengyuanyuan@gzucm.edu.cn.

Zhongqiu Liu, Email: liuzq@gzucm.edu.cn.

Dawei Wang, Email: david@gzucm.edu.cn.

References

  • 1.Bragazzi N.L., Zhong W., Shu J., et al. Burden of heart failure and underlying causes in 195 countries and territories from 1990 to 2017. Eur J Prev Cardiol. 2021;28(15):1682–1690. doi: 10.1093/eurjpc/zwaa147. [DOI] [PubMed] [Google Scholar]
  • 2.Savarese G., Becher P.M., Lund L.H., Seferovic P., Rosano G., Coats A. Global burden of heart failure: a comprehensive and updated review of epidemiology. Cardiovasc Res. 2023;118(17):3272–3287. doi: 10.1093/cvr/cvac013. [DOI] [PubMed] [Google Scholar]
  • 3.Schwinger R. Pathophysiology of heart failure. Cardiovasc Diagn Ther. 2021;11(1):263–276. doi: 10.21037/cdt-20-302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.McDonagh T.A., Metra M., Adamo M., et al. ESC Guidelines for the diagnosis and treatment of acute and chronic heart failure: developed by the Task Force for the diagnosis and treatment of acute and chronic heart failure of the European Society of Cardiology (ESC) with the special contribution of the Heart Failure Association (HFA) of the ESC. Rev Esp Cardiol. 2021;75(6):523. doi: 10.1016/j.rec.2022.05.005. 2022. [DOI] [PubMed] [Google Scholar]
  • 5.Pellicori P., Kaur K., Clark A.L., Department Of Cardiology C.H.H.H. Fluid management in patients with chronic heart failure. Card Fail Rev. 2015;1(2):90–95. doi: 10.15420/cfr.2015.1.2.90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Shams E., Bonnice S., Mayrovitz H.N. Diuretic resistance associated with heart failure. Curēus (Palo Alto, CA) 2022;14(1) doi: 10.7759/cureus.21369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Neuberg G.W., Miller A.B., O'Connor C.M., et al. Diuretic resistance predicts mortality in patients with advanced heart failure. Am Heart J. 2002;144(1):31–38. doi: 10.1067/mhj.2002.123144. [DOI] [PubMed] [Google Scholar]
  • 8.Noda Y., Sohara E., Ohta E., Sasaki S. Aquaporins in kidney pathophysiology. Nat Rev Nephrol. 2010;6(3):168–178. doi: 10.1038/nrneph.2009.231. [DOI] [PubMed] [Google Scholar]
  • 9.Su W., Cao R., Zhang X., Guan Y. Aquaporins in the kidney: physiology and pathophysiology. Am J Physiol Ren Physiol. 2020;318(1):F193–F203. doi: 10.1152/ajprenal.00304.2019. [DOI] [PubMed] [Google Scholar]
  • 10.Starklint J., Bech J.N., Nyvad O., Jensen P., Pedersen E.B. Increased urinary aquaporin-2 excretion in response to furosemide in patients with chronic heart failure. Scand J Clin Lab Invest. 2006;66(1):55–66. doi: 10.1080/00365510500452955. [DOI] [PubMed] [Google Scholar]
  • 11.Lutken S.C., Frokiaer J., Nielsen S. AVP-induced increase in AQP2 and p-AQP2 is blunted in heart failure during cardiac remodeling and is associated with decreased AT1R abundance in rat kidney. PLoS One. 2015;10(2) doi: 10.1371/journal.pone.0116501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pedersen R.S., Bentzen H., Bech J.N., Nyvad O., Pedersen E.B. Urinary aquaporin-2 in healthy humans and patients with liver cirrhosis and chronic heart failure during baseline conditions and after acute water load. Kidney Int. 2003;63(4):1417–1425. doi: 10.1046/j.1523-1755.2003.00858.x. [DOI] [PubMed] [Google Scholar]
  • 13.Knepper M.A., Kwon T.H., Nielsen S. Molecular physiology of water balance. N Engl J Med. 2015;372(14):1349–1358. doi: 10.1056/NEJMra1404726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Schrier R.W.M. Vasopressin and aquaporin 2 in clinical disorders of water homeostasis. Semin Nephrol. 2008;28(3):289–296. doi: 10.1016/j.semnephrol.2008.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ranieri M. Renal Ca(2+) and water handling in response to calcium sensing receptor signaling: physiopathological aspects and role of CaSR-regulated microRNAs. Int J Mol Sci. 2019;20(21) doi: 10.3390/ijms20215341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Riccardi D., Brown E.M. Physiology and pathophysiology of the calcium-sensing receptor in the kidney. Am J Physiol Ren Physiol. 2010;298(3):F485–F499. doi: 10.1152/ajprenal.00608.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ranieri M., Tamma G., Di Mise A., et al. Negative feedback from CaSR signaling to aquaporin-2 sensitizes vasopressin to extracellular Ca2. J Cell Sci. 2015;128(13):2350–2360. doi: 10.1242/jcs.168096. [DOI] [PubMed] [Google Scholar]
  • 18.Ranieri M., Zahedi K., Tamma G., et al. CaSR signaling down‐regulates AQP2 expression via a novel microRNA pathway in pendrin and NaCl cotransporter knockout mice. Faseb J. 2018;32(4):2148–2159. doi: 10.1096/fj.201700412RR. [DOI] [PubMed] [Google Scholar]
  • 19.Li L., Chen F., Cao Y.G., et al. Role of calcium-sensing receptor in cardiac injury of hereditary epileptic rats. Pharmacology (Basel) 2015;95(1-2):10–21. doi: 10.1159/000369627. [DOI] [PubMed] [Google Scholar]
  • 20.Sun J., Wei T., Bai S., et al. Calcium-sensing receptor-mediated mitogen-activated protein kinase pathway improves the status of transplanted mouse embryonic stem cells in rats with acute myocardial infarction. Mol Cell Biochem. 2017;431(1-2):151–160. doi: 10.1007/s11010-017-2987-z. [DOI] [PubMed] [Google Scholar]
  • 21.Chen J., Wei X., Zhang Q., et al. The traditional Chinese medicines treat chronic heart failure and their main bioactive constituents and mechanisms. Acta Pharm Sin B. 2023;13(5):1919–1955. doi: 10.1016/j.apsb.2023.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang Y., Liu Y., Liu Z., Cheng Y., Wang D. A systematic review and meta-analysis of the efficacy and safety of xinbao pill in chronic heart failure. Front Pharmacol. 2022;13 doi: 10.3389/fphar.2022.846867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yang Y., Chen T., Liu J., et al. Integrated chemical profiling, network pharmacology and pharmacological evaluation to explore the potential mechanism of Xinbao pill against myocardial ischaemia-reperfusion injury. Pharm Biol. 2022;60(1):255–273. doi: 10.1080/13880209.2022.2025859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Tian X., Huang Z., Wang Y., et al. Xinbao Pill attenuated chronic heart failure by suppressing the ubiquitination of beta-adrenergic receptors. Phytomedicine. 2023;115 doi: 10.1016/j.phymed.2023.154830. [DOI] [PubMed] [Google Scholar]
  • 25.De Villiers C., Riley P.R. Mouse models of myocardial infarction: comparing permanent ligation and ischaemia-reperfusion. Dis Model Mech. 2020;13(11) doi: 10.1242/dmm.046565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Merrill A.J. Mechanisms of salt and water retention in heart failure. Am J Med. 1949;6(3):357. doi: 10.1016/0002-9343(49)90173-4. [DOI] [PubMed] [Google Scholar]
  • 27.Abassi Z., Khoury E.E., Karram T., Aronson D. Edema formation in congestive heart failure and the underlying mechanisms. Front Cardiovasc Med. 2022;9 doi: 10.3389/fcvm.2022.933215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Khan M.S., Shahid I., Anker S.D., et al. Albuminuria and heart failure: JACC state-of-the-art review. J Am Coll Cardiol. 2023;81(3):270–282. doi: 10.1016/j.jacc.2022.10.028. [DOI] [PubMed] [Google Scholar]
  • 29.Drexler Y., Tremblay J., Mesa R.A., et al. Associations between albuminuria and mortality among US adults by demographic and comorbidity factors. J Am Heart Assoc. 2023;12(21) doi: 10.1161/JAHA.123.030773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Noda Y., Sohara E., Ohta E., Sasaki S. Aquaporins in kidney pathophysiology. Nat Rev Nephrol. 2010;6(3):168–178. doi: 10.1038/nrneph.2009.231. [DOI] [PubMed] [Google Scholar]
  • 31.Knepper M.A., Inoue T. Regulation of aquaporin-2 water channel trafficking by vasopressin. Curr Opin Cell Biol. 1997;9(4):560–564. doi: 10.1016/s0955-0674(97)80034-8. [DOI] [PubMed] [Google Scholar]
  • 32.Shangzu Z., Dingxiong X., ChengJun M., et al. Aquaporins: important players in the cardiovascular pathophysiology. Pharmacol Res. 2022;183 doi: 10.1016/j.phrs.2022.106363. [DOI] [PubMed] [Google Scholar]
  • 33.Nielsen S., Terris J., Andersen D., et al. Congestive heart failure in rats is associated with increased expression and targeting of aquaporin-2 water channel in collecting duct. Proc Natl Acad Sci U S A. 1997;94(10):5450–5455. doi: 10.1073/pnas.94.10.5450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Bustamante M., Hasler U., Leroy V., et al. Calcium-sensing receptor attenuates AVP-induced aquaporin-2 expression via a calmodulin-dependent mechanism. J Am Soc Nephrol. 2008;19(1):109–116. doi: 10.1681/ASN.2007010092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sundararaman S.S., van der Vorst E. Calcium-sensing receptor (CaSR), its impact on inflammation and the consequences on cardiovascular health. Int J Mol Sci. 2021;22(5) doi: 10.3390/ijms22052478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ren Z., Yang K., Zhao M., et al. Calcium-sensing receptor on neutrophil promotes myocardial apoptosis and fibrosis after acute myocardial infarction via NLRP3 inflammasome activation. Can J Cardiol. 2020;36(6):893–905. doi: 10.1016/j.cjca.2019.09.026. [DOI] [PubMed] [Google Scholar]
  • 37.Nedvetsky P.I., Tabor V., Tamma G., et al. Reciprocal regulation of aquaporin-2 abundance and degradation by protein kinase A and p38-MAP kinase. J Am Soc Nephrol. 2010;21(10):1645–1656. doi: 10.1681/ASN.2009111190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Moeller H.B., Olesen E.T., Fenton R.A. Regulation of the water channel aquaporin-2 by posttranslational modification. Am J Physiol Ren Physiol. 2011;300(5):F1062–F1073. doi: 10.1152/ajprenal.00721.2010. [DOI] [PubMed] [Google Scholar]
  • 39.Tamma G., Robben J.H., Trimpert C., Boone M., Deen P.M. Regulation of AQP2 localization by S256 and S261 phosphorylation and ubiquitination. Am J Physiol Cell Physiol. 2011;300(3):C636–C646. doi: 10.1152/ajpcell.00433.2009. [DOI] [PubMed] [Google Scholar]
  • 40.Hoffert J.D., Pisitkun T., Wang G., Shen R.F., Knepper M.A. Quantitative phosphoproteomics of vasopressin-sensitive renal cells: regulation of aquaporin-2 phosphorylation at two sites. Proc Natl Acad Sci U S A. 2006;103(18):7159–7164. doi: 10.1073/pnas.0600895103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kim S., Jo C.H., Kim G.H. Psychotropic drugs upregulate aquaporin-2 via vasopressin-2 receptor/cAMP/protein kinase A signaling in inner medullary collecting duct cells. Am J Physiol Ren Physiol. 2021;320(5):F963–F971. doi: 10.1152/ajprenal.00576.2020. [DOI] [PubMed] [Google Scholar]
  • 42.Ritz E., Fliser D. The kidney in congestive heart failure. Eur Heart J. 1991;12(Suppl C):14–20. doi: 10.1093/eurheartj/12.suppl_c.14. [DOI] [PubMed] [Google Scholar]
  • 43.Hartupee J., Mann D.L. Neurohormonal activation in heart failure with reduced ejection fraction. Nat Rev Cardiol. 2017;14(1):30–38. doi: 10.1038/nrcardio.2016.163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Feraille E., Sassi A., Olivier V., Arnoux G., Martin P. Renal water transport in health and disease. Pflügers Archiv. 2022;474(8):841–852. doi: 10.1007/s00424-022-02712-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Dong J., Wang T., Zhao L., Chen X. Pattern of disharmony between the heart and kidney: theoretical basis, identification and treatment. J Trad Chin Med Sci. 2017;4(4):317–321. [Google Scholar]
  • 46.Martin P.Y., Schrier R.W. Sodium and water retention in heart failure: pathogenesis and treatment. Kidney Int. SUPPL 1997;59:S57–S61. [PubMed] [Google Scholar]
  • 47.He H., Han G., Li X., et al. Efficacy and safety of Chinese medicine in treating arrhythmia: meta-analysis of randomized controlled trials. Evid Based Compl. 2021;2021:9960412–9960471. doi: 10.1155/2021/9960471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Cadnapaphornchai M.A., Gurevich A.K., Weinberger H.D., Schrier R.W. Pathophysiology of sodium and water retention in heart failure. Cardiology. 2001;96(3-4):122–131. doi: 10.1159/000047396. [DOI] [PubMed] [Google Scholar]
  • 49.Knepper M.A., Kwon T.H., Nielsen S. Molecular physiology of water balance. N Engl J Med. 2015;372(14):1349–1358. doi: 10.1056/NEJMra1404726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Sasaki S. Aquaporin 2: from its discovery to molecular structure and medical implications. Mol Aspect Med. 2012;33(5-6):535–546. doi: 10.1016/j.mam.2012.03.004. [DOI] [PubMed] [Google Scholar]
  • 51.Xu D.L., Martin P.Y., Ohara M., et al. Upregulation of aquaporin-2 water channel expression in chronic heart failure rat. J Clin Invest. 1997;99(7):1500–1505. doi: 10.1172/JCI119312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Thakker R.V. Calcium-sensing receptor: role in health and disease. Indian J Endocrinol Metab. 2012;16(Suppl 2):S213–S216. doi: 10.4103/2230-8210.104041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Lu M., Leng B., He X., Zhang Z., Wang H., Tang F. Calcium sensing receptor-related pathway contributes to cardiac injury and the mechanism of astragaloside IV on cardioprotection. Front Pharmacol. 2018;9:1163. doi: 10.3389/fphar.2018.01163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Zheng H., Liu J., Liu C., et al. Calcium-sensing receptor activating phosphorylation of PKCdelta translocation on mitochondria to induce cardiomyocyte apoptosis during ischemia/reperfusion. Mol Cell Biochem. 2011;358(1-2):335–343. doi: 10.1007/s11010-011-0984-1. [DOI] [PubMed] [Google Scholar]
  • 55.Gu J., Dai S., Liu Y., et al. Activation of Ca(2+)-sensing receptor as a protective pathway to reduce Cadmium-induced cytotoxicity in renal proximal tubular cells. Sci Rep. 2018;8(1):1092. doi: 10.1038/s41598-018-19327-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Liu S., Kompa A.R., Kumfu S., et al. Subtotal nephrectomy accelerates pathological cardiac remodeling post-myocardial infarction: implications for cardiorenal syndrome. Int J Cardiol. 2013;168(3):1866–1880. doi: 10.1016/j.ijcard.2012.12.065. [DOI] [PubMed] [Google Scholar]
  • 57.Harrison J.C., Smart S., Besley E., et al. A clinically relevant functional model of type-2 cardio-renal syndrome with paraventricular changes consequent to chronic ischaemic heart failure. Sci Rep. 2020;10(1):1261. doi: 10.1038/s41598-020-58071-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Ranieri M. Renal Ca(2+) and water handling in response to calcium sensing receptor signaling: physiopathological aspects and role of CaSR-regulated microRNAs. Int J Mol Sci. 2019;20(21) doi: 10.3390/ijms20215341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Ranieri M., Zahedi K., Tamma G., et al. CaSR signaling down‐regulates AQP2 expression via a novel microRNA pathway in pendrin and NaCl cotransporter knockout mice. Faseb J. 2018;32(4):2148–2159. doi: 10.1096/fj.201700412RR. [DOI] [PubMed] [Google Scholar]
  • 60.Ranieri M., Di Mise A., Tamma G., Valenti G. Calcium sensing receptor exerts a negative regulatory action toward vasopressin-induced aquaporin-2 expression and trafficking in renal collecting duct. Vitam Horm. 2020;112:289–310. doi: 10.1016/bs.vh.2019.08.008. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Raw data are available upon request from the corresponding author.

Articles from Journal of Traditional and Complementary Medicine are provided here courtesy of Elsevier

RESOURCES