Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2002 May 7;99(10):7172–7177. doi: 10.1073/pnas.092152999

Carbocyclic fatty acids in plants: Biochemical and molecular genetic characterization of cyclopropane fatty acid synthesis of Sterculia foetida

Xiaoming Bao *, Sue Katz †, Mike Pollard *, John Ohlrogge *,‡
PMCID: PMC124547  PMID: 11997456

Abstract

Fatty acids containing three-member carbocyclic rings are found in bacteria and plants. Bacteria synthesize cyclopropane fatty acids (CPA-FAs) only by the addition of a methylene group from S-adenosylmethionine to the cis-double bond of monoenoic phospholipid-bound fatty acids. In plants CPA-FAs are usually minor components with cyclopropene fatty acids (CPE-FAs) more abundant. Sterculia foetida seed oil contains 65–78% CPE-FAs, principally sterculic acid. To address carbocyclic fatty acid synthesis in plants, a cDNA library was constructed from developing seeds during the period of maximum oil deposition. About 0.4% of 5,300 expressed sequence tags were derived from one gene, which shared similarities to the bacterial CPA-FA synthase. However, the predicted protein is twice as large as the bacterial homolog and represents a fusion of an FAD-containing oxidase at the N terminus and a methyltransferase at the C terminus. Functional analysis of the isolated full-length cDNA was conducted in tobacco suspension cells where its expression resulted in the accumulation of up to 6.2% dihydrosterculate of total fatty acids. In addition, the dihydrosterculate was specifically labeled by [methyl-14C]methionine and by [14C]oleic acid in the transgenic tobacco cells. In in vitro assay of S. foetida seed extracts, S-adenosylmethionine served as a methylene donor for the synthesis of dihydrosterculate from oleate. Dihydrosterculate accumulated largely in phosphatidylcholine in both systems. Together, a CPA-FA synthase was identified from S. foetida, and the pathway in higher plants that produce carbocyclic fatty acids was defined as by transfer of C1 units, most likely from S-adenosylmethionine to oleate.


A wide array of unusual fatty acids is found in seed oils (1, 2). Among these are fatty acids containing three-member carbocyclic rings, namely cis-cyclopropane fatty acids (CPA-FAs) and cyclopropene fatty acids (CPE-FAs). Carbocyclic fatty acids are distributed across several plant orders, most notably Malvales but including the Fabales and Sapindales (2–4). Sterculic acid is often the prevalent CPE-FA, but malvalic acid, one carbon shorter in chain length than sterculic acid, can be a significant component. In Litchi chinensis seed oil, dihydrosterculic acid is the major carbocyclic fatty (5, 6). The CPA- and CPE-FAs are not confined to seeds. Long-chain CPA-FAs have been described in various polar lipid classes of leaves of early spring plants (7), whereas both CPA- and CPE-FAs are found in root, leaf, stem, and callus tissue in plants of the Malvaceae (8, 9). In addition to carbon and energy storage in seeds, the function of CPA- and CPE-FAs in plants may involve resistance to fungal attack (10). Although CPA-FAs are widely distributed in bacterial lipids, no CPE-FAs have been reported in bacteria to date.

The cyclopropene ring of sterculic acid is highly strained, and therefore, the acid exhibits a unique and reactive chemistry (3) suggesting commercial oleochemical applications were sterculic acid available in sufficient quantity. Many seed lipids containing CPE-FAs are extensively consumed by humans, especially in tropical areas (11). It is well documented that dietary CPE-FAs lead to the accumulation of hard fats and other physiological disorders in animals (12, 13). CPE-FAs are strong inhibitors of a variety of desaturases (14, 15) in animals, which might be the underlying cause of some of the disorders. Because of the health concerns, vegetable oils containing CPE-FAs need to be treated with high temperature or hydrogenation before consumption (16). As a result, processing costs are increased whereas trans-fatty acids are also produced by the hydrogenation. Genetically eliminating CPE-FAs from seed oils is therefore a nutritionally desirable objective.

The biosynthetic pathway of CPA-FAs in bacteria is well understood (17). The first CPA-FA synthase gene was cloned from Escherichia coli on the basis of its ability to complement a CPA-FA-deficient mutant (18). It was demonstrated that bacterial CPA-FAs were synthesized from monounsaturated fatty acids by addition of a methylene group, derived from S-adenosylmethionine, across the double bond. The monoenoic fatty acyl substrates are esterified to phospholipids, most prominently phosphatidylethanolamine (17). After the identification of the E. coli CPA-FA synthase, three genes from Mycobacterium tuberculosis were found, which function as cyclopropane synthases in mycolic acid biosynthesis (19, 20). By contrast, little attention has been paid to the biosynthesis of CPE-FAs in plants. Yano et al. (21) conducted in vivo labeling experiments with several species of Malva and proposed that the pathway involved initial formation of dihydrosterculic acid from oleic acid with subsequent desaturation to sterculic acid (Fig. 1).

Figure 1.

Figure 1

Proposed pathway for the biosynthesis of sterculic acid from oleic acid (21).

In this study we examine the biochemical and molecular genetic basis for the biosynthesis of three-member ring carbocyclic fatty acids in plants. Sterculia foetida is a tropical tree belonging to the Sterculiaceae family of order Malvales. The seeds of S. foetida are rich in oil (55% dry weight) and contain up to 78% CPE-FAs (2, 22), one of the highest levels of carbocyclic fatty acids reported in nature. Here, we report the isolation, with an expressed sequence tag (EST) approach, and functional characterization of the eukaryotic CPA-FA synthase gene.

Materials and Methods

Plant Material and Chemicals.

Developing seeds of S. foetida L. were collected from July 20 to October 15, 1998 at Montgomery Botanical Center (Miami, FL); the accession number of the tree sampled is MBC 78453A. On receiving the fresh seeds, the seed coats were removed and the cotyledons and embryos were used for labeling experiments or were frozen and stored at −80°C for RNA extraction, enzymology, and lipid analysis. Tobacco suspension cells (Nicotiana tabacum L. cv. Bright yellow 2) were maintained in liquid medium containing Murashige and Skoog basal salts (GIBCO), 3% sucrose, 2.5 mM Mes⋅KOH (pH 5.7), 1 mg/ml thiamine, 1 mg/ml myo-inositol, and 1 μM 2,4-dichlorophenoxyacetic acid. Cultures were subcultured weekly with 5% (vol/vol) inoculum from a 7-day-old culture and shaken at 28°C in 200-ml flasks. L-[methyl-14C]methionine (55 mCi/mmol) and [1-14C]oleic acid (50 mCi/mmol) were purchased from American Radiolabeled Chemicals (St. Louis).

Lipid Analysis.

To determine fatty acid accumulation during S. foetida seed development an internal standard, tritridecanoin, was added to seed tissue before the lipid extraction. Lipids were extracted according to Bligh and Dyer (23). Lipids were transmethylated by vortexing at room temperature for 3 min with 0.5% sodium methoxide in methanol/heptane (1:1, vol/vol). After extraction, the fatty acid methyl esters (FAMEs) were analyzed by GC/MS by using a Hewlett Packard 5890 gas chromatograph MSD 5972 mass analyzer. Separations of FAMEs were performed on a 30 m × 0.25 mm i.d. DB-23 column. Lipid extraction, preparation of FAMEs, and GC/MS analysis for tobacco suspension cells used the same procedure as described for S. foetida seeds, except that no internal standard was added. To identify dihydrosterculic acid in transgenic tobacco suspension cells, saturated and unsaturated FAMEs were separated by argentation TLC (24). Argentation plates (15% silver nitrate in silica) were developed sequentially at −20°C to heights of 8, 13, and 19 cm in toluene. FAME bands were located by spraying with 0.2% (wt/vol) 2′,7′-dichlorofluorescein in ethanol and viewing under UV light. FAMEs were recovered from the scraped silica bands by elution with hexane/diethyl ether (2:1, vol/vol), and analyzed by GC/MS. A racemic methyl cis-dihydrosterculate standard was prepared by reaction of methyl oleate with diiodomethane and diethylzinc in hexane (25).

Radiolabeling Transgenic Tobacco Cells.

The independent transgenic callus was transferred back into liquid medium and subcultured as described above. After 3 days of subculture, 5 μCi of L-[methyl-14C] methionine or [1-14C]oleic acid was added to the medium and culture continued for 24 h. Cells were collected by brief centrifugation, lipids extracted, and FAMEs prepared as described above. Saturated FAMEs were separated from other FAMEs by argentation TLC. The saturated FAMEs were recovered and fractionated by C18 reverse-phase TLC by using acetonitrile/methanol/water (75:25:0.5, vol/vol/vol). The radioactivity was located and quantified by using an Instant-Imager. Finally, the labeled spots were recovered for GC/MS analysis.

Assay of CPA-FA Synthase.

Frozen cotyledon tissue from S. foetida developing seeds was ground to a fine powder in liquid nitrogen. A cell-free extract was prepared by thawing the powder and briefly homogenizing in four volumes of chilled buffer containing 0.1 M Na Tricine⋅NaOH (pH 7.0), 1% wt/vol defatted BSA, 1% wt/vol polyvinylpyrrolidone-40, 15% vol/vol glycerol, and 1 mM 2-mercaptoethanol, then filtering the slurry through miracloth. CPA-FA synthase assays contained 0.1 ml of cell-free homogenate, 0.02–0.05 mM oleoyl-CoA, and 0.02 mM S-[methyl-14C]adenosylmethionine substrate in a total volume of 0.2 ml and were incubated at 30°C for 1 h. The assay was terminated by the addition of 0.5 ml of 10% aqueous KOH and 1.0 ml of ethanol, and allowed to stand overnight to give complete saponification of the lipids. On acidification, the labeled free fatty acids were extracted into hexane, then the hexane phase washed with water and evaporated to dryness. An aliquot of the organic phase was assayed for radioactivity. The remainder of the product was analyzed by TLC directly or after treatment with an ether solution of diazomethane.

Library Construction and Sequencing.

Equal amounts of developing seeds from collections of August 5, August 25, September 10, and September 30, 1998, were pooled. During this period, the deposition of carbocyclic fatty acids showed a linear increase. Ten grams of the developing seeds were ground into fine powder in liquid nitrogen and RNA extracted as described by Schultz et al. (26). A cDNA library of S. foetida developing seeds was constructed by Stratagene. The cDNAs were directionally cloned into the Uni-ZAP vector at EcoRI and XhoI sites. The library consisted of 2.6 × 107 plaque-forming units of primary plaques with average insert size of 1.7 kb. Mass excisions were performed according to the protocol provided by Stratagene. Clones (21,120) were picked and grown in two hundred twenty 96-well plates. Twenty-eight of the 220 plates were directly sequenced at the Michigan State University sequencing facility. The remaining 192 plates (18,432 clones) were spotted on nylon filters for library subtraction as described by White et al. (27). Based on the information from the first 1,500 sequences from the nonsubtracted library, the three most abundant sequences were chosen to subtract the library on the filters. A total of seventy 96-well plates were re-racked and sequenced.

Constructs for Tobacco Expression.

A putative S. foetida CPA-FA synthase (SfCPA-FAS) clone was identified on the basis of its abundance and similarity to bacterial CPA-FA synthase. The complete cDNA of the putative SfCPA-FAS is 2,977 bp long compiled from two overlapping clones R50-D5 (1–1,732 bp) and R15-C3 (933–2,977 bp). Both clones were sequenced from both strands. To assemble a full-length SfCPA-FAS clone the sequence encoding amino acids 1–335 was amplified from clone R50-D5 with primers JO886 (TCCTCTAGACTCGAGCCCGGGATGGGAGTGGCTGTGATCGGTGGTGGGAATC) and JO883 (GTTGTAAGACGTCGTGTAACTCGGTCATACAATTCG). The sequence encoding amino acids 336–864 with the stop codon was amplified from clone R15-C3 with primers JO884 (CAATGTGCTGCAGAATGTTGGGAAAACAAGTCA GCC) and JO885 (GGGAGGATCTCGAGCCTATTTACTTTTGATAAAGTTAATAGGC). For the convenience of cloning, a silent mutation was made at the third position of the codon for lysine 335, from CTA to CTG, so that a PstI site could be created. The N-terminal sequence was inserted into pBluescript KS at XhoI and PstI sites, after which the C-terminal section was inserted at PstI and XbaI sites. The resulting construct was named pBluescript KS-SfCPA-FAS and the sequence was confirmed from both strands. The full-length SfCPA-FAS was subcloned from pBluescript KS into the binary vector pE1776 between SmaI and XbaI sites. pE1776 carries the constitutive promoter (derived from mannopine synthase gene of Agrobacterium tumefaciens) and agropine synthase terminator (28). The resulting construct was named as pE1776-SfCPA-FAS and transferred into Agrobacterium strain LBA4404 for tobacco suspension cell transformation.

Expression of SfCPA-FAS Clone in Tobacco Suspension Cells.

 Agrobacterium-mediated tobacco transformation was conducted as described by Rempel and Nelson (29). A 100-μl aliquot of overnight Agrobacterium culture containing the construct was added to 4 ml of 3-day-old tobacco suspension cells and kept at 28°C for 3 days. The cells were harvested by brief centrifugation and washed three more times with NT medium containing 100 μg/ml kanamycin and 500 μg/ml carbenicillin. The cells were spread on selection plates (NT medium with addition 0.7% phytagar, 100 mg/liter of kanamycin, and 500 mg/liter of carbenicillin). After 3–4 weeks, independent transformants were transferred to new plates. Tissue (0.5–1 g fresh weight) was collected, lipids were extracted, and FAMEs were prepared for GC/MS analysis.

Results

Lipid Deposition During Seed Development of S. foetida.

In S. foetida seed oils, sterculic acid is the major CPE-FA (55–78%) with malvalic acid present at about 10% of the amount of sterculic acid (2, 3, 30). To define the appropriate stage of seeds for studying the biosynthesis of CPE-FAs, developing seed pods of S. foetida were collected from July 20 to October 15, 1998, at Montgomery Botanical Center (Miami, FL). Each pod contained 10–20 seeds. The pods were dark green and the seeds white in July, and the color of the pod gradually turned red and the seed coats turned brown with the progress of seed development. The cotyledons of the first collection on July 20 were watery and filled progressively until seed desiccation began in late October. Both total fatty acids and CPE-FAs accumulated at linear rates from August 5 to October 14. During the same period the percent of CPE-FAs in total fatty acid increased from 40 to 60%.

Identification of CPA-FA Synthase from S. foetida Developing Seeds Through an EST Approach.

To maximize the representation of CPA-FA synthase and desaturase clones in the cDNA library, developing seeds at stages when CPE-FA accumulate at the highest rate were used to prepare the library. Because CPE-FA accumulated at a linear rate from August 5 to October 14, equal amounts of developing seeds from the collections during this period were mixed together and used for RNA extraction and cDNA library construction. After mass excision of the library, clones were picked and sequencing of the first 1,500 clones gave Legumin A, Legumin B, and a nonspecific lipid transfer protein as the three most abundant sequences. These were chosen for library subtraction because they represented about 30% of all of the clones in the library. After subtraction by filter hybridization and re-racking, another 3,800 sequences of 500 bp or greater were obtained. BLAST searches identified several ESTs showing similarities with bacterial CPA-FA synthase. On compiling these EST sequences it was clear that 23 overlapping ESTs were derived from the same gene. Assembly of sequences led to a predicted putative CPA-FA synthase protein of 864 aa with molecular weight of 98,046. Even though no significant transmembrane domains were identified, the S. foetida CPA-FA synthase is likely a membrane-associated protein, because 70% of the total CPA-FA synthase activity was recovered in the microsomal pellet after centrifugation at 100,000 × g for 1 h. In contrast, the bacterial cyclopropane synthase is a soluble protein and about half the size of the putative S. foetida CPA-FA synthase at 382 aa long. The bacterial protein shares significant homology only with the carboxyl-terminal half of the S. foetida clone with 32% (122 of 376) identity and 49% (188 of 376) similarity (Fig. 2).

Figure 2.

Figure 2

Alignment of the S. foetida CPA-FA synthase C-terminal portion with other known cyclopropane synthases. E. coli represents the CPA-FA synthase from E. coli. CMAS1, CMAS2, and MMAS2 are from M. tuberculosis (20). The dashed line below the sequences indicates the S-adenosylmethionine-binding site, and the * indicates the catalytically important cysteine.

Functional Analysis of the Putative SfCPA-FAS Sequence in Tobacco Suspension Cells.

To test its function, the putative SfCPA-FAS was subcloned into a plant transformation vector pE1776 behind a constitutive promoter (28) and transformed into tobacco suspension cells. These cells do not contain any cyclopropane fatty acids. After the transformation and antibiotic selection, independent transformants were subcultured at 20-day intervals. Lipids were extracted from 15 transformants with pE1776-SfCPA-FAS, and from 12 transformants with only empty vector pE1776. Fatty acid compositions of independent transformants with the SfCPA-FAS clone contained dihydrosterculic acid from 3.2 to 6.2% of total fatty acids, with an average of 4.0%. No CPE-FA (sterculate) was detected in the unfractionated tobacco lipid extract and no dihydrosterculate was detected in control transformants. To confirm the identity of dihydrosterculic acid, FAMEs prepared from lipid extracts were fractionated by argentation TLC to give a saturated FAME fraction, which was then analyzed by GC/MS. Fig. 3A shows the total ion current chromatogram of saturated fatty acids from control tobacco callus transformed with empty vector of pE1776. The major saturated fatty acids in tobacco callus are 16:0 and 18:0, with some 20:0. Fig. 3B shows the saturated fatty acids from one of the 15 tobacco lines transformed with the putative SfCPA-FAS clone. An additional prominent peak is present in the transformant, with a retention time identical with the methyl cis-dihydrosterculic acid standard (Fig. 3C). From GC equivalent chain-length data on cyclopropane FAMEs (31, 32), it is clear that trans-cyclopropane isomers would elute significantly before cis-isomers. However, a cis-11,12-isomer would run later than and probably be incompletely resolved from the cis-9,10-isomer. Inspection of peak shape and width suggested a single component eluting in the additional peak. The mass spectrum of the additional peak (Fig. 4A) matches the dihydrosterculate standard (Fig. 4B). A weak molecular ion at m/z = 310 along with (M-32) and (M-74) peaks at 278 and 236 atomic mass units, respectively define the molecular weight of the new compound (3), and fingerprinting of the two spectra shows a very close match. On the basis of the following criteria for the new fatty acid found in tobacco callus transformed with putative SfCPA-FAS clone, namely being isolated as a saturate and having a retention time and mass spectrum identical with the standard, we conclude with certainty it is dihydrosterculic acid.

Figure 3.

Figure 3

Total ion current gas chromatograms of the saturated FAME fraction from transgenic tobacco cells and the methyl dihydrosterculate standard. (A) Saturated FAMEs from transgenic tobacco cells with the control construct pE1776. (B) Saturated FAMEs from transgenic tobacco cells expressing the S. foetida CPA-FA synthase clone, pE1776-SfCPA-FAS-2. A major additional peak with retention time of 35.69 min is observed. (C) Methyl dihydrosterculate standard (retention time of 35.69 min).

Figure 4.

Figure 4

Comparison of the mass spectra of the methyl dihydrosterculate standard and the additional peak found in transgenic cells expressing S. foetida CPA-FA synthase construct. (A) Mass spectrum of the peak with retention time 35.69 from Fig. 2B. (B) Mass spectrum of methyl dihydrosterculate standard.

In Vivo Labeling of Tobacco Suspension Cells Transformed with the SfCPA-FAS Clone.

To confirm both the origin of and the acceptor for the methylene group, tobacco suspension cells transformed with the SfCPA-FAS were used for in vivo labeling experiments. Suspension cells were labeled with [1-14C]oleic acid and L-[methyl-14C]methionine separately for 24 h. Fig. 5A shows the distribution of radioactivity from the transmethylation products of total lipids labeled with [1-14C]oleic acid and analyzed by argentation TLC. In the transformant carrying the SfCPA-FAS about 3.5% of the total radioactivity was found in the upper band containing only saturated FAMEs, whereas no label was seen in this band in the vector control transformant. This result demonstrated that SfCPA-FAS-transformed lines converted oleate into a saturated fatty acid, most likely dihydrosterculate. Fig. 5B gives the radioactivity distribution from cells incubated with L-[methyl-14C]methionine. Again, radioactivity was only found in the saturated FAME band from the cells transformed with the SfCPA-FAS. To confirm that the radioactivity in the upper saturated FAME band does indeed represent dihydrosterculate, the saturated FAMEs of pE1776-SfCPA-FAS-2 were eluted from the argentation TLC plate and analyzed by C18 reverse-phase TLC. As shown in Fig. 5C, the radioactive FAMEs labeled by both [1-14C]oleic acid and L-[methyl-14C]methionine migrated at the same position as the dihydrosterculate standard. The mass coeluting with the labeled bands in Fig. 5C was confirmed as dihydrosterculate by elution and GC/MS analysis. These results demonstrated by in vivo labeling that the SfCPA-FAS gene product is responsible for synthesis of dihydrosterculic acid by transferring a methylene group from methionine to oleic acid. Additional in vivo labeling experiments (data not shown) showed that the dihydrosterculate product labeled from methionine accumulates mainly in phosphatidylcholine.

Figure 5.

Figure 5

In vivo labeling of fatty acids from transgenic tobacco suspension cells. Transgenic tobacco suspension cells were labeled for 24 h with [1-14C]oleic acid (A) or L-[methyl-14C]methionine (B). Labeled FAMEs were analyzed by argentation TLC. The control (lane 1) is tobacco transformed with the empty vector pE1776. SfCPA-FAS-2 (lane 2) is a cell line transformed with the S. foetida CPA-FA synthase construct, pE1776-SfCPA-FAS. In the saturated FAME band at the top of the plate radioactivity was detected only in transgenic line SfCPA-FAS-2. (C) To identify the radioactivity in the saturated FAME fraction further, the radioactive spots of SfCPA-FAS-2 (lane 2) from A and B were recovered and separated by C18 reverse-phase TLC. Radioactivity from both samples migrated with the methyl dihydrosterculate standard.

S-Adenosylmethionine Is a Methyl Donor for CPA-FA Synthase in Extracts of S. foetida Seeds.

To test whether S-adenosylmethionine is a potential C1 donor for plant carbocyclic fatty acid synthesis cell-free extracts of developing seeds were optimized for activity. S-[methyl-14C]Adenosylmethionine was tested as substrate, and under optimal conditions CPA-FA synthase activities in the range of 0.25–0.5 nmol⋅min−1⋅g−1 (fresh weight) of seed tissue were measured. The optimum pH was 7.0 with Tricine buffer preferred over Tris or sodium phosphate. The addition of BSA and polyvinylpyrrolidone-40 together enhanced activity 2-fold. Oleoyl-CoA in the assay at 20–50 μM enhanced activity about 2-fold; higher concentrations were inhibitory. The apparent Km for S-adenosylmethionine in the cell-free extract was 20 μM. After saponification and hexane extraction, >95% radioactivity in the hexane extract comigrated with free fatty acids. Analysis of labeled FAMEs by C18 reversed-phase TLC showed a single radioactive spot coeluting with the methyl dihydrosterculate standard. Thus, the radioactivity recovered in the hexane phase after saponification is a good measure of the total label incorporated into [methylene-9,10-14C]dihydrosterculate. When the reaction with the cell-free homogenate was terminated by lipid extraction most of the labeled dihydrosterculate was found in the phosphatidylcholine fraction, which suggests that oleoyl phosphatidylcholine may be a substrate for the enzyme in vivo.

Discussion

This study is a step toward understanding the biosynthesis of CPA- and CPE-FAs in plants at molecular and biochemical levels. The EST approach has yielded a CPA-FA synthase clone from the cDNA library of S. foetida developing seeds. Twenty-three ESTs derived from CPA-FA synthase clone give a relative abundance in the library of ≈0.4%. This level is higher than most enzymes of fatty acid metabolism in oilseed cDNA libraries. Thus, the expectation that the high oil and sterculic acid contents found in S. foetida seeds would result in a high expression level for an enzyme of the pathway proved correct in this instance. On expressing a full-length construct in tobacco suspension cells, dihydrosterculic acid was synthesized at levels as high as 6.2% of total fatty acids. By using the transgenic tobacco cells, dihydrosterculate was effectively labeled from both [1-14C]oleic acid and L-[methyl-14C]methionine (Fig. 5). This result defined the biosynthesis of dihydrosterculic acid in S. foetida as by addition of a methylene group to the double bond of oleate. The methylene group is derived from methionine, and in vitro assays with S. foetida seed extracts show that S-adenosylmethionine is indeed a methylene donor. Although the amino acid sequence does not display obvious transmembrane domains, the concentration of this activity in a microsomal fraction is consistent with the CPA-FA synthase being either a membrane-associated or an integral membrane protein. In summary, these data clearly demonstrate that the S. foetida clone homologous to the bacterial CPA-FA synthases encodes a functional CPA-FA synthase.

On the basis of in vivo labeling of Malva tissues Yano et al. (21) proposed that the biosynthesis of sterculic acid was a two-step reaction; first the addition of a methylene group to oleate, then desaturation of dihydrosterculate to sterculate (Fig. 1). They considered sterculic acid not to be derived by methylene addition across the 9,10-triple bond of stearolic acid, because no conversion of [1-14C]stearolic acid to sterculic acid was observed. Dihydrosterculate was clearly desaturated to sterculate, but the conversion rates were very slow, which agrees with our observations after labeling studies of S. foetida seeds (data not shown). A pathway for the biosynthesis of sterculic acid as a two-step reaction by way of dihydrosterculate is strongly supported by the isolation and functional demonstration of S. foetida CPA-FA synthase described here, but at this stage we cannot unequivocally rule out an additional route by way of an acetylenic precursor. An unusual feature associated with sterculic acid biosynthesis in both seeds and other plant tissues is substantial α-oxidation. Often malvalic acid is a major CPE-FA. Other noncarbocyclic fatty acids only rarely show limited amounts of α-oxidation products. Thus, extensive α-oxidation seems unique to CPE-FA biosynthesis, and it is possible to speculate that it may be associated, either by a biosynthetic linkage or because of a particular propensity of CPE-FAs to undergo and/or to induce α-oxidation. No chain-shortened CPA-FAs were found in any of the transgenic tobacco cell lines screened. The latter is an indication that the presence of CPA-FAs did not induce α-oxidation in tobacco. In L. chinensis, the only seed in which CPA-FAs accumulate without CPE-FA, no α-oxidation products of dihydrosterculic acid exist, although traces of 17- and 15-carbon β-oxidation products are seen (6).

So far, one gene from E. coli (33) and three closely related genes (cmas-1, cmas-2, and mmas-2) from Mycobacterium (20, 34) have been functionally proven as cis-CPA-FA synthases. The S. foetida CPA-FA synthase reported here is the first enzyme of this kind that has been isolated from eukaryotes. A comparison of the amino acid sequence of S. foetida CPA-FA synthase with these CPA-FAS genes is shown in Fig. 2. A striking difference is that all of the bacterial amino acid sequences are about half the length of S. foetida CPA-FA synthase and share significant similarity only to the C terminus half of the S. foetida sequence. The proposed S-adenosylmethionine binding motif (amino acid 171–179, with the E. coli numbering) and the catalytically important cysteine 354 are absolutely conserved for all of the proteins (33). The S. foetida and E. coli sequences are more closely related to each other than either are to the Mycobacterium genes. The C-terminal portion of the S. foetida CPA-FA synthase shares a high degree of similarity with a cluster of Arabidopsis genes on chromosome 3 and with other plant sequences, although no evidence of CPA-FA synthesis is known for these species. These genes possibly encode enzymes involved in methyl transfer reactions for other hydrophobic substrates.

The N-terminal half (amino acids 1–438) is unique for the S. foetida CPA-FA synthase sequence in that no other known cyclopropane synthases possess this portion. However, the N-terminal half of S. foetida CPA-FA synthase shares significant homology with Arabidopsis gene At3g23500 (and to a lesser extent with At3g23520). These putative genes encode products related to tryptophan 2-monooxygenases and belong to a flavin-containing group of oxidases. The tryptophan 2-monoxygenase gene product itself produces indole acetamide, which can be converted to the auxin indole acetic acid by hydrolysis. Most flavin-containing proteins have a highly conserved motif located at the N terminus of the protein and involved in binding of the ADP moiety of FAD (35–37). The proposed motif (G-X-G-X-X-G-X-X-X-A) is preceded by three or four hydrophobic residues (38). The conserved FAD-binding motif is present in the first 15 aa of S. foetida CPA-FA synthase (MGGGGIQGLVSAYVLAKAGVNVVVYE). Because the mechanism of cyclopropane ring formation is believed to proceed by a carbocation mechanism, with —CHCH3—CH+— the proposed intermediate formed by addition of the methyl group from S-adenosylmethionine (17), it is hard to see how a redox system such as a FAD-containing protein is involved in the catalytic reaction of methylene addition. Thus, the discovery that the CPA-FA synthase protein contains a fused redox domain, probably an oxidase, remains a puzzle. We cannot be sure that this domain is functional, but its potential functionality raises questions about a role in either the desaturation to sterculic acid, or more likely in the α-oxidation that accompanies the formation of sterculic acid. Such speculations can only be addressed by future experiments. The fact that in the transgenic tobacco cells neither CPE-FA nor α-oxidation products were observed suggests additional gene products are required for these functions.

In conclusion, the CPA-FA synthase gene was isolated from developing seeds of S. foetida. The gene product catalyzed the addition of a methylene group (possibly derived from S-adenosylmethionine) to oleic acid to form dihydrosterculic acid. Experiments are underway to determine the substrate specificity of the S. foetida CPA-FA synthase, both with respect to acyl chain unsaturation and length, and to the head group of the phospholipid acceptor. The functional expression of this clone gives us the essential tool to identify the gene(s), most likely desaturases, that will produce sterculic acid. From such studies we may eventually define the role for the FAD-containing, oxidase-like N-terminal domain of the S. foetida CPA-FA synthase. The homology between certain Arabidopsis thaliana putative methyltransferase and oxidase gene products and the S. foetida CPA-FA synthase raises interesting questions about alternative roles of these genes.

Acknowledgments

Dr. S. B. Gelvin (Purdue University) graciously provided vector pE1776 for plant transformation. This work was funded in part by The Dow Chemical Company and Dow AgroSciences. The Michigan Agricultural Experiment Station is also acknowledged for its support of this research.

Abbreviations

FAME

fatty acid methyl ester

CPA-FA

cyclopropane fatty acid

CPE-FA

cyclopropene fatty acid

SfCPA-FAS

Sterculia foetida cyclopropane fatty acid synthase

18:1

oleic acid

18:2

linolenic acid

EST

expressed sequence tag

Footnotes

Data deposition: The sequence reported in this paper has been deposited in the GenBank database (accession no. AF470622).

References

  • 1.Van de Loo F J, Fox B G, Somerville C. In: Lipid Metabolism in Plants. Moore TS Jr, editor. Boca Raton, FL: CRC; 1993. pp. 91–126. [Google Scholar]
  • 2.Badami R C, Patil K B. Prog Lipid Res. 1981;19:119–153. doi: 10.1016/0163-7827(80)90002-8. [DOI] [PubMed] [Google Scholar]
  • 3.Christie WW. In: Topics in Lipid Chemistry. Gunstone FD, editor. Vol. 1. London: Logos; 1970. pp. 1–49. [Google Scholar]
  • 4.Smith CR., Jr Prog Chem Fats Other Lipids. 1970;11:139–177. [Google Scholar]
  • 5. Lie Ken Jie, M. S. F. & Chan, M. F. (1977) J. Chem. Soc. Chem. Commun.78.
  • 6.Gaydou E M, Ralaimanarivo A, Bianchini J-P. J Agric Food Chem. 1993;41:886–890. [Google Scholar]
  • 7.Kuiper P J C, Stuiver B. Plant Physiol. 1972;49:307–309. doi: 10.1104/pp.49.3.307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yano I, Nichols B W, Morris L J, James A T. Lipids. 1972;7:30–34. [Google Scholar]
  • 9.Schmid K M, Patterson G W. Phytochemistry. 1988;27:2831–2834. [Google Scholar]
  • 10.Schmid K M, Patterson G W. Lipids. 1988;23:248–252. doi: 10.1007/BF02535466. [DOI] [PubMed] [Google Scholar]
  • 11.Ralaimanarivo A, Gaydou E M, Bianchini J P. Lipids. 1982;17:1–10. doi: 10.1007/BF02535115. [DOI] [PubMed] [Google Scholar]
  • 12.Phelps R A, Shenstone F S, Kemmerer A R, Evans R J. Poultry Sci. 1965;44:358–394. doi: 10.3382/ps.0440358. [DOI] [PubMed] [Google Scholar]
  • 13.Page A M, Sturdivant C A, Lunt D K, Smith S B. Comp Biochem Physiol B Biochem Mol Biol. 1997;118:79–84. doi: 10.1016/s0305-0491(97)00027-8. [DOI] [PubMed] [Google Scholar]
  • 14.Fogerty A C, Johnson A R, Pearson J A. Lipids. 1972;7:335–338. doi: 10.1007/BF02532651. [DOI] [PubMed] [Google Scholar]
  • 15.Cao J M, Blond J P, Bezard J. Biochim Biophys Acta. 1993;1210:27–34. doi: 10.1016/0005-2760(93)90045-b. [DOI] [PubMed] [Google Scholar]
  • 16.Bianchini J P, Ralaimanarivo A, Gaydou E M. J Food Sci. 1983;48:253–255. [Google Scholar]
  • 17.Grogan D W, Cronan J E. Microbiol Mol Biol Rev. 1997;61:429–441. doi: 10.1128/mmbr.61.4.429-441.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Grogan D W, Cronan J E. J Bacteriol. 1984;158:286–295. doi: 10.1128/jb.158.1.286-295.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yuan Y, Lee R E, Besra G S, Belisle J T, Barry C E. Proc Natl Acad Sci USA. 1995;92:6630–6634. doi: 10.1073/pnas.92.14.6630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Yuan Y, Barry C E. Proc Natl Acad Sci USA. 1996;93:12828–12833. doi: 10.1073/pnas.93.23.12828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yano I, Morris L J, Nichols B W, James A T. Lipids. 1972;7:35–45. [Google Scholar]
  • 22.Pasha M K, Ahmad F. J Agric Food Chem. 1992;40:626–629. [Google Scholar]
  • 23.Blight E G, Dyer W J. Can J Biochem Physiol. 1959;37:911–917. doi: 10.1139/o59-099. [DOI] [PubMed] [Google Scholar]
  • 24.Morris L J, Wharry D M, Hammond E W. J Chromatogr. 1967;31:69–76. [Google Scholar]
  • 25.Furukawa J, Kawabata N, Nishimura J. Tetrahedron. 1968;24:53–58. [Google Scholar]
  • 26.Schultz D J, Craig R, Cox-Foster D L, Mumma R O, Medford J I. Plant Mol Biol Rep. 1994;12:310–316. [Google Scholar]
  • 27.White J A, Todd J, Newman T, Focks N, Girke T, Martínez de Ilárduya O, Jaworski J G, Ohlrogge J, Benning C. Plant Physiol. 2000;124:1582–1594. doi: 10.1104/pp.124.4.1582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Gelvin, S. B., Hauptmann, R., Ni, M. & Cui, D. (1999) U.S. Patent 5,955,646.
  • 29.Rempel H C, Nelson L M. Transgenic Res. 1991;4:199–207. [Google Scholar]
  • 30.Bohannon M B, Kleiman R. Lipids. 1978;13:270–273. doi: 10.1007/BF02533669. [DOI] [PubMed] [Google Scholar]
  • 31.Christie W W, Holman R T. Lipids. 1966;1:176–182. doi: 10.1007/BF02531869. [DOI] [PubMed] [Google Scholar]
  • 32.Christie W W, Gunstone F D, Ismail I A, Wade L. Chem Phys Lipids. 1968;2:196–202. doi: 10.1016/0009-3084(68)90023-6. [DOI] [PubMed] [Google Scholar]
  • 33.Wang A Y, Grogan D W, Cronan J E. Biochemistry. 1992;31:11020–11028. doi: 10.1021/bi00160a011. [DOI] [PubMed] [Google Scholar]
  • 34.George K M, Yuan Y, Sherman D R, Barry C E. J Biol Chem. 1995;270:27292–27298. doi: 10.1074/jbc.270.45.27292. [DOI] [PubMed] [Google Scholar]
  • 35.Eggink G, Engel H, Vriend G, Terpstra P, Witholt B. J Mol Biol. 1990;212:135–142. doi: 10.1016/0022-2836(90)90310-I. [DOI] [PubMed] [Google Scholar]
  • 36.Eberhardt S, Richter G, Gimbel W, Werner T, Bacher A. Eur J Biochem. 1996;242:712–719. doi: 10.1111/j.1432-1033.1996.0712r.x. [DOI] [PubMed] [Google Scholar]
  • 37.Haigler B E, Suen W C, Spain J C. J Bacteriol. 1996;178:6019–6024. doi: 10.1128/jb.178.20.6019-6024.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Russel M, Model P. J Biol Chem. 1988;263:9015–9019. [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES