Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2025 Sep 29;11(6):e70609. doi: 10.1002/vms3.70609

Subtype Identification of Blastocystis sp. Among Humans and Domestic Animals in the West of Iran

Pourya Mohammadi 1, Arezoo Bozorgomid 2, Hamed Mirjalali 3, Amir Javadi 4, Mehrzad Saraei 5,6, Peyman Heydarian 5,6, Majid Fasihi Harandi 7, Mehran Ebrahimi Varkiani 8, Elham Hajialilo 5,6,✉
PMCID: PMC12477797  PMID: 41020667

ABSTRACT

Background

Blastocystis is a genetically diverse intestinal protozoan found in a wide range of human and animal hosts. The present study was conducted to identify the subtypes of Blastocystis in both humans and animals in Kermanshah province, Iran.

Methods

A total of 820 stool samples from humans, cattle, sheep, and pigeons were examined using the formalin‐ethyl acetate concentration method. All isolates were cultured in clotted fetal bovine serum medium. DNA extraction, PCR amplification and sequencing were performed targeting an identical fragment of the small subunit ribosomal RNA (SSU rRNA) gene. Phylogenetic tree and haplotype network were conducted by MEGA6 and PopART software. Data analysis was performed by Chi‐square and Fisher's exact tests, while a p value of < 0.05 was considered as statistically significant.

Results

Totally, Blastocyctis was found in 9.1% and 4.5% of human samples using microscopy and growing in culture medium, respectively. A significant association was observed between Blastocystis infection and both age and gastrointestinal symptoms. Two subtypes of ST2 and ST5 were identified in humans and livestock (cattle and sheep), respectively. The results of haplotype analysis showed clear classification of two groups and six haplotype (Group I and II) in the isolates.

Conclusion

This study highlights the zoonotic potential of Blastocystis species in the studied region. The subtype distribution may inform preventive strategies and help elucidate transmission routes. Additionally, further research is needed to fully understand the pathogenic potential of this parasite.

Keywords: Blastocystis sp, Iran, phylogenetic analysis, subtype, zoonotic potential

  • Stool samples of human, cattle, sheep, and pigeons were surveyed in the west of Iran.

  • Two subtypes of ST2 and ST5 were identified in humans and livestock.

  • The results of haplotype analysis showed clear classification of two groups among the isolates.

graphic file with name VMS3-11-e70609-g002.jpg

1. Introduction

Blastocystis is an anaerobic protozoan, colonizing the gastrointestinal tract of various animal hosts and humans. Numerous epidemiological studies have highlighted the global distribution of Blastocystis, particularly in developing countries with lower sanitation standards and poor hygiene (Abdulsalam et al. 2013; Fusaro et al., 2024; Guilavogui et al., 2022; Javanmard et al. 2018). Infection rates in humans have been reported as approximately 0.1–25% in European countries and 0.02–100% in Asian and African countries (Aydemir et al., 2024; Deng et al., 2019; Guilavogui et al., 2022; Lhotská et al., 2020; Maleki et al., 2022a; Marangi et al., 2023; Matovelle et al., 2022; Nemati et al., 2021; Rauff‐Adedotun et al., 2021; Rudzińska and Sikorska, 2023). Systematic reviews have reported Blastocystis infection rates of 25.3% in sheep, 24.4% in cattle, and 26.4% in birds (Mohammadi et al., 2025; Shams et al., 2022, 2021). Therefore, the prevalence of human Blastocystis infection is notable in Iran (Pestechian et al. 2021; Taherkhani et al. 2008), not only among humans but also in various animal hosts, such as cattle (0.9‐ 50%), sheep (4‐32%), and birds (15‐29%) approximately in different parts of Iran during in recent years (Barati et al., 2022; Heydarian et al., 2024; Rostami et al., 2020; Salehi et al., 2022; Shams et al., 2024; Sharifi et al., 2020).

Microscopic identification of Blastocystis is challenging due to its high morphological polymorphism in stool specimens (Karamati et al., 2019; Popruk et al., 2013; Tan, 2004). Therefore, identifying subtypes based solely on morphology is impossible, and molecular methods are needed for identification of Blastocystis subtypes. Up to now, approximately 44 subtypes (STs) of the parasite have been reported based on different gene regions (Fu et al., 2025; Šejnohová et al., 2024) Ten STs of ST1–ST9 and ST12 have been reported in humans, with the studies reporting primarily identifying ST1–ST4 as the most prevalent STs in human infections (Jiménez et al. 2019; Stensvold and Clark 2016). Currently, the STs of ST1–ST7 and ST9 have been reported from human of Iran (Alinaghizade et al. 2017; Asghari et al. 2020; Khademvatan et al. 2018; Sharifi et al. 2020; Sheikh et al. 2020). A wide range of STs such as, ST1–ST8, ST10, ST13 and ST 14 have been reported in various animals in the country (Asghari et al. 2019, Asghari et al. 2024; Badparva et al. 2015; Mohammadpour et al. 2020; Rostami et al. 2020; Salehi et al. 2022; Shams et al. 2024; Sharifi et al. 2020)

The same STs have been observed in humans and animals indicating the zoonotic potential of the parasite (Greige et al. 2018; Parkar et al. 2010; Salehi et al. 2022; W. Wang et al. 2014). ST1 has been identified in animals and zoo keepers (Parkar et al., 2010). The ST5 has been reported in piggery workers and pigs, while ST6 has been reported in slaughterhouse workers and chickens (Greige et al. 2018; W. Wang et al. 2014). However, it remains to be confirmed whether animal sources contribute to human Blastocystis infection or colonization. Therefore, more studies are necessary to evaluate the zoonotic origin of human Blastocystis in the societies.

Given that the only previous study in Kermanshah identified Blastocystis subtypes ST1 to ST6 in humans (Maleki et al., 2022b), the present study aimed to assess the frequency and subtype distribution of Blastocystis in both humans and domestic animals in the region.

2. Materials and Methods

2.1. Sample Collection

A total of 820 fresh stool samples were randomly collected from 220 human patients as well as cattle (n = 220), sheep (n = 240) and pigeons (n = 140) in Kermanshah County, west of Iran, during 2022–2023. Stool samples from cattle were collected from animal referred to the veterinary clinic of Mahidasht district in Kermanshah city. Samples from sheep were obtained from Samereh village in Mahidasht district, Golam Kabud village in Sarfirouzabad district and Sarab Nilufar area in Kermanshah city. Pigeon stool were collected from the bird‐sellers market in Kermanshah city. Human stool samples were obtained from patients referred to the Kermanshah reference laboratory (Figure 1). A demographic questionnaire variables was completed by patients during interviews. The questionnaire included the following information: age, gender, occupation, residence and gastrointestinal symptoms. The isolates were transferred to the parasitology laboratory at the Infectious Diseases Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran.

FIGURE 1.

FIGURE 1

Open in a new tab

Map of Kermanshah Province, located in west of Iran.

2.2. Sample Processing and Blastocystis Cultivation

The stool samples were transferred to the laboratory within a few hours under cold chain conditions for cultivation. The formalin–ethyl acetate concentration method and direct smear preparation were examined in stool isolates for parasite identification (Delshad et al. 2020). The clotted fetal bovine serum medium was used for cultivating the whole isolates. Briefly, a volume of one milliliter of sterile Locke’s solution was added to a slant of clotted fetal bovine serum (Razi Serum Institute, Iran), and then 200 mg stool sample along with Streptomycin and Nystatin was added into each tube. The cultures were incubated at 37°C under anaerobic conditions for 10 days. The growth of Blastocystis was evaluated after 24, 48 and 72 h by light microscopy examining the direct smears for parasite development. The negative culture was confirmed when there was a lack of growth of Blastocystis after 10 days (Delshad et al., 2020; Jalallou et al., 2017; Niaraki et al., 2020).

2.3. DNA Extraction, PCR Amplification and Sequencing Analysis

DNA extraction was performed on the positive isolates. The liquid phase of the culture medium (200 µL) was transferred to a 1.5 mL tube and centrifuged at 5000 rpm for 5 minutes. The pellets were used for DNA extraction in human isolates. Fresh stool samples were used for DNA extraction of animal isolates. DNA was extracted using the FavorPrep Stool DNA Isolation mini kit (Favorgen, Taiwan) according to the manufacturer’s recommendations. The extracted DNA was stored at −20°C until the PCR amplification.The SSU rRNA gene (~620 bp) was amplified using specific primers RD5 (5'‐ATCTGGTTGATCCTGCCAGT‐3') and BhRDr (5'‐GAGCTTTTTAACTGCAACAACG‐3')(Riabi et al., 2018). A 30 µL reaction volume containing 15 µL master mix (Amplicon; Taq DNA Polymerase Master Mix RED, Denmark) and 3 µL template DNA, 0.1 µM of each primer, and distilled water was used for PCR. The thermal cycling conditions were set as follows: initial denaturation at 95°C for 5 minutes, followed by 35 cycles of 95°C for 45 seconds, 59°C for 45 seconds, and a final extension at 72°C for 1 minute. The presence of PCR product bands was confirmed with UV light after electrophoresis on a 1.5% agarose gel in TBE buffer (Tris, boric acid and EDTA) and staining of PCR product. The isolates with proper PCR bands were selected for sequencing. The PCR products were sequenced using an ABI 3130X sequencer (ABI 3130X, USA).

The sequences were manually edited using Chromas (version 1.0.0.1), and compared with available reference sequences in the GenBank database using NCBI BLAST (Basic Local Alignment Search Tool) by software (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The obtained sequences were deposited in the GenBank database under the Accession Numbers PP091222‐ PP091224 and PP086816‐ PP086820.

2.4. Phylogenetic and Haplotype Network Analysis

Sequencing data in this study were trimmed and edited using previously published SSU rRNA gene sequences from Blastocystis isolates in BioEdit v.7.2 software. The alignment of multiple sequences was performed using the muscle algorithm. The maximum‐likelihood phylogram (ML) was constructed using MEGA6 software (version 6.0; Biodesign Institute, Tempe, USA) using the Hasegawa–Kishino‐Yano model, which was selected as the best‐fitting substitution model. Node support was assessed with 1000 bootstrap replicates. The Proteromonas lacertae sequence was used in the dendrogram as an outgroup (Figure 2). The SSU rRNA haplotype network of Blastocystis was obtained from TCS analysis using PopART software (v.1.7).

2.5. Statistical Analyses

Statistical analyses were performed using statistical tests including Chi‐square, and Fisher's exact tests, with SPSS software version 16 (SPSS Inc., Chicago, IL, USA). A p value of < 0.05 was considered statistically significant.

3. Results

In the current study, the stool samples of 220 patients were analysed, of which 102 (46.4%) and 118 (53.6%) were male and female, respectively. Of total human samples, 9.1% (20/220) were detected positive for Blastocystis in the microscopy and 4.5% (10/220) showed growth in culture medium. Blastocystis infection was found among both male 13.7% (14/102) and female 5.1% (6/118). The parasite prevalence rate in ≥ 60‐year‐old age group was 20% (4/20) and higher than the other age groups. Gastrointestinal symptoms among positive specimens for Blastocystis were 20.8% (5/24), whereas 7.7% (15/196) of the individuals did not show any intestinal symptoms. Finally, there was a significant association between Blastocystis infection and the study variables including age and gastrointestinal signs (Table 1).

TABLE 1.

Socio‐demographic features of Blastocystis sp. Isolated from human in Kermanshah, Iran.

Variable Number of non‐infected (%) Number of infected (%) p value Number of PCR (%)
Sex
Male 88 (86.3) 14 (13.7) 0.26 5 (35.7)
Female 112 (94.9) 6 (5.1) 5 (83.33)
Age (%Year)
<30 112 (97.4) 3 (2.6) 0.012 0
30–39 31 (86.1) 5 (13.9) 3 (60)
40–49 25 (83.3) 5 (16.7) 4 (80)
50–59 16 (84.2) 3 (15.8) 1 (33)
≥60 16 (80) 4 (20) 2 (50)
Location
City 193 (91) 19 (9) 0.732 9 (47.4)
Village 7 (87.5) 1 (12.5) 1 (100)
Job
No Job 66 (94.3) 4 (5.7) 0.15 1 (25)
Employee 28 (82.4) 6 (17.6) 3 (50)
Student 39 (95.1) 2 (4.9) 0
House keeper 60 (90.9) 6 (9.1) 5 (83.3)
Self‐employment 7 (77.8) 2 (22.2) 1 (50)
Gastroenteritis sign
Yes 19 (79.2) 5 (20.8) 0.034 4 (80)
No 181 (92.3) 15 (7.7) 6 (40)
Open in a new tab

In animal samples, Blastocystis was detected in 0.9 % (2/220) of cattle isolates, while the parasitic infection was not found among the birds and sheep isolates by microscopic survey. No growth was observed from animal isolates in culture. A total of 10 human isolates which grew in culture medium, along with 20 cattle isolates with clinical gastrointestinal symptoms were selected for molecular analysis. Therefore, 10 sheep isolates, and 10 pigeon isolates, were selected randomly for the analysis. A total of 15 isolates tested positive by PCR, including samples from 10 human, 4 bovine, and one ovine host. Eight PCR‐positive specimens were randomly selected for sequencing, including three human isolates and five animal isolates.

According to molecular and phylogenetic analysis of the eight sequence isolates, two STs of ST2 (37.5%) and ST5 (62.5%) were identified. The ST2 was identified among human isolates while ST5 was found in cattle and sheep isolates. ST5 was the predominant ST in animal samples (Figure 2, Table 2). A total of six haplotypes were identified for the SSU rRNA gene of Blastocystis isolates in this study. The sequences associated with each haplotype are as follows: H1: PP086818 and PP086820, H2: PP086819, H3: PP086816, H4: PP086817, H5: PP091224, H6: PP091223 and PP091222. The results of the haplotype network showed the existence of two groups of haplotypes separated by 31 mutational steps. Group I haplotypes are associated with subtypes of ST5 (isolates detected in cattle and sheep) and group II haplotypes are associated with subtypes of ST2 (isolates detected in human). The ST2 network (group II) was simpler; two identified haplotypes separated by two mutation steps. The ST5 network (group I) exhibited star‐like features across the entire population, with satellites suggesting recent population expansion (Figure 3, Table 2).

FIGURE 2.

FIGURE 2

Open in a new tab

Phylogenetic relationship of Blastocystis sp. isolate of Kermanshah, Iran. The tree identified in this study and known sequences previously published in GenBank as inferred by maximum‐likelihood analysis of small subunit ribosomal RNA gene calculated by Tamura 3‐parameter model. The numbers on the branches are percent bootstrap values from 1000 replicates. Sequences detected in this study are highlighted with the red circle.

TABLE 2.

Data obtained of Blastocystis sp. collected from human and animals in Kermanshah, Iran.

No. Isolate code Host Subtype Haplotype Accession no.
1 BH13 Human ST2 Hap6 PP091222
2 BH12 Human ST2 Hap6 PP091223
3 BH7 Human ST2 Hap5 PP091224
4 BG5 Cattle ST5 Hap3 PP086816
5 BG3 Cattle ST5 Hap4 PP086817
6 BG8 Cattle ST5 Hap1 PP086818
7 BG6 Cattle ST5 Hap2 PP086819
8 BSh27 Sheep ST5 Hap1 PP086820
Open in a new tab

FIGURE 3.

FIGURE 3

Open in a new tab

Haplotype analysis results of Blastocystis sp. isolates obtained from human and animal hosts in Kermanshah city. Each circle represents a unique haplotype; the circle size reflects frequency and colors indicate the region of origin. The mutational steps are indicated by the short marks crossing the connection lines. The sequences associated with each haplotype are as follows: H1: PP086818 and PP086820, H2: PP086819, H3: PP086816, H4: PP086817, H5: PP091224, H6: PP091223 and PP091222.

4. Discussion

Blastocystis ranks among the most widespread intestinal protozoan parasites, occurring globally in both high‐ and low‐income regions. The organism is frequently detected in stool samples from humans and various vertebrate animals (Abdulsalam et al. 2013; Scanlan 2012). In the present study, Blastocystis was detected in 9.1% of human samples by microscopic examination, while 4.5% of the human samples were positive in culture medium. This discrepancy may also be attributed to sample viability issues, including the presence of non‐viable parasites, as well as the inherently lower sensitivity of direct microscopy compared to culture (Yersal et al., 2016). In animal samples, Blastocystis was detected in 0.9% of cattle isolates, while no infections were identified in bird and sheep samples through microscopic examination. Due to its polymorphic nature, the parasite may be misidentified under light microscopy, particularly in animal isolates (Tan, 2004). The results of this study further highlight the diagnostic challenges associated with detecting Blastocystis in animal hosts. A higher parasite load typically facilitates detection through increased shedding, which may vary based on host‐related factors such as age and immune status (Hublin et al., 2021). Consequently, lower parasite burdens in animal samples, along with interference from yeast and other microbial contaminants in fecal matter, may hinder accurate microscopic diagnosis. Although the results of the present study in human isolates failed to show a significant association between gender, habitat and job, but age and gastrointestinal symptoms were found significantly associated with the presence of Blastocystis (Table 1). Accordingly, the prevalence rate of Blastocystis infection in the age group ≥ 60 years was higher than the other age groups. The reason for the higher prevalence in this age group may be linked to a weakened immune system or poor health. Several studies show a significant correlation between age and parasite infection (Beyhan et al., 2015; Dagci et al., 2014; Salehi et al., 2017), while some studies could not find any significant association (Delshad et al., 2020; Niaraki et al., 2020; Yersal et al., 2016). The pathogenesis of Blastocystis in humans has always been ambiguous and controversial. The presence of Blastocystis has been associated with gastrointestinal signs, but was also found in asymptomatic individuals (Ajjampur and Tan, 2016; Casero et al., 2015; Rojas‐Velázquez et al., 2019). The results of our study showed a notable association between Blastocystis infection and gastrointestinal symptoms. Some studies reported a statistically significant association with the parasite and gastrointestinal symptoms such as abdominal pain, diarrhea, inflammatory bowel disease and ulcerative colitis (Beyhan et al., 2015; Cekin et al., 2012; Matovelle et al., 2022). The findings indicated a potential link between Blastocystis infection and the presence of ulcerative colitis, warranting further investigation into this association (Feride et al., 2025). The relationship between different subtypes of the parasite and gastrointestinal symptoms varies across many studies. According to the molecular analysis of the present study, ST2 was identified among human isolates. Subtypes 1 to 3 of the parasite have been repeatedly reported in humans from different parts of Iran (Bahrami et al., 2020; Behravan et al., 2025; Delshad et al., 2020; Salehi et al., 2017; Shirvani et al., 2020). ST1 to ST3 appear to have an equal distribution among patients with diarrhea and healthy individuals (Cifre et al., 2018). A statistically insignificant correlation between different subtypes and the degree of inflammation has been suggested. In this regard, asymptomatic subjects infected with the genotypes II, III and IV, exhibited mild to moderate inflammatory changes, while genotypes I, III, and IV were detected among IBS patients (Fouad et al., 2011). Considering the very different findings, more extensive and careful researches should be conducted.This is the first study of Blastocystis in livestock from the study region. The microorganism was detected in cattle and sheep isolates, whereas no parasite infection was found in bird isolates. None of the animal isolates grew in the culture medium. Natural physiological conditions are required for the development and growth of Blastocystis, especially concerning the pH and temperature of animal isolates, which differ from those of human isolates. Subtype 5 was identified among cattle and sheep isolates. The subtype is common in animal and livestock hosts and rare in humans (Mohammad Rahimi et al., 2021; Skotarczak, 2018; Stensvold et al., 2009). The systematic review showed the frequency of ST5 among human cases in Iran (Badparva et al., 2017). Subtype 5 was reported as the most prevalent in cattle isolates from southern Iran (Sharifi et al., 2020). The study could found ST5 among sheep isolates in the southwest of the country (Salehi et al., 2022). In addition, ST5 (12%) was detected among individuals in Kermanshah, while the subtype was present in humans from the study region (Maleki et al., 2022b). In addition, ST1, ST2, and ST4 are the most frequently reported subtypes worldwide and are characterized by low host specificity, which underscores their potential role in zoonotic transmission (Shams et al., 2021). According to the findings, the zoonotic potential of the parasite is strengthened, so subtype specificity to a particular host is not precise. According to various findings, the zoonotic potential of the parasite is debatable and has not been definitively proven. Further studies with recent population expansion and whole‐genome sequencing should be conducted to provide more complete information about the heterogeneous protozoan.

5. Conclusion

This study provides the first molecular evidence of Blastocystis ST2 and ST5 in human and livestock hosts in Kermanshah, Western Iran. The absence of overlapping subtypes between human and animal hosts in this study does not eliminate the possibility of zoonotic transmission, especially given prior reports of ST5 in human populations. The significant association of Blastocystis infection with age and gastrointestinal symptoms reinforces the need for investigations into its pathogenic potential. Further studies are recommended to better understand the transmission dynamics, host specificity, and public health implications of Blastocystis. The findings highlight the need for enhanced surveillance and molecular diagnostics to clarify the zoonotic potential of Blastocystis subtypes in the region.

Author Contributions

Pourya Mohammadi: methodology, data curation, investigation, software, resources, writing – original draft. Arezoo Bozorgomid: supervision, validation, formal analysis, methodology. Hamed Mirjalali: methodology, writing – review and editing, validation. Mehrzad Saraei: supervision, validation, investigation, resources. Peyman Heydarian: supervision, validation, investigation, visualization. Majid Fasihi Harandi: writing– review and editing, methodology, validation, visualization. Amir Javadi: Methodology, data curation, formal analysis. Mehran Ebrahimi Varkiani: supervision, writing– review and editing. Elham Hajialilo: writing – original draft, writing – review and editing, project administration, conceptualization, resources, supervision, validation, visualization, data curation, investigation, methodology, software, funding acquisition.

Ethics Statement

This study was approved by the Medical Ethics Committee of Qazvin University of Medical Sciences (Approval code: IR.QUMS.REC.1401.093).

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgements

We would like to appreciate the assistance offered by the colleagues at the Department of Parasitology and Mycology, Medical School, Qazvin University of Medical Sciences. The present study was a part of thesis for receiving the degree of MSc in medical parasitology at the Qazvin University of Medical Sciences, Qazvin, Iran. We also appreciate the assistance provided by colleagues at the Infectious Diseases Research Center, Health Institute, Kermanshah University of Medical Sciences, Kermanshah, Iran.

Mohammadi, P. , Bozorgomid A., Mirjalali H., et al. 2025. “Subtype Identification of Blastocystis sp. Among Humans and Domestic Animals in the West of Iran.” Veterinary Medicine and Science 11, no. 6: e70609. 10.1002/vms3.70609

Funding: This study was financially supported by a grant from Qazvin University of Medical Sciences (Grant no. 401000097).

Data Availability Statement

The raw data supporting the findings of the study are available upon reasonable request.

References

  1. Abdulsalam, A. M. , Ithoi I., Al‐Mekhlafi H. M., Al‐Mekhlafi A. M., Ahmed A., and Surin J.. 2013. “Subtype Distribution of Blastocystis Isolates in Sebha, Libya.” PLoS ONE 8: e84372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ajjampur, S. S. , and Tan K. S.. 2016. “Pathogenic Mechanisms in Blastocystis spp.—Interpreting Results From In Vitro and In Vivo Studies.” Parasitology International 65: 772–779. [DOI] [PubMed] [Google Scholar]
  3. Alinaghizade, A. , Mirjalali H., Mohebali M., Stensvold C. R., and Rezaeian M.. 2017. “Inter‐and Intra‐Subtype Variation of Blastocystis Subtypes Isolated From Diarrheic and Non‐Diarrheic Patients in Iran.” Infection, Genetics and Evolution 50: 77–82. [DOI] [PubMed] [Google Scholar]
  4. Asghari, A. , Sadraei J., Pirestani M., and Mohammadpour I.. 2019. “First Molecular Identification and Subtype Distribution of Blastocystis sp. Isolated From Hooded Crows (Corvus cornix) and Pigeons (Columba livia) in Tehran Province, Iran.” Comparative Immunology, Microbiology and Infectious Diseases 62: 25–30. [DOI] [PubMed] [Google Scholar]
  5. Asghari, A. , Yousefi A., Mohammadi M. R., et al. 2024. “Comparative Molecular Epidemiology, Subtype Distribution, and Zoonotic Potential of Blastocystis sp. in Equus Animals (Horses, Donkeys, and Mules) in Northwestern Iran.” Comparative Immunology, Microbiology and Infectious Diseases 106: 102124. [DOI] [PubMed] [Google Scholar]
  6. Asghari, A. , Zare M., Hatam G., Shahabi S., Gholizadeh F., and Motazedian M.. 2020. “Molecular Identification and Subtypes Distribution of Blastocystis sp. Isolated From Children and Adolescent With Cancer in Iran: Evaluation of Possible Risk Factors and Clinical Features.” Acta Parasitologica 65: 462–473. 10.2478/s11686-020-00186-2. [DOI] [PubMed] [Google Scholar]
  7. Badparva, E. , Ezatpour B., Mahmoudvand H., Behzadifar M., Behzadifar M., and Kheirandish F.. 2017. “Prevalence and Genotype Analysis of Blastocystis hominis in Iran: A Systematic Review and Meta‐Analysis.” Archives of Clinical Infectious Diseases 12: 1–9. [Google Scholar]
  8. Aydemir, S. , Barlik F., Yürektürk Ş., et al. 2024. “Prevalence of Blastocystis Infection in Humans in Türkiye: A Systematic Review and Meta‐Analysis.” Microbial Pathogenesis. 106876. [DOI] [PubMed] [Google Scholar]
  9. Badparva, E. , Sadraee J., and Kheirandish F.. 2015. “Genetic Diversity of Blastocystis Isolated From Cattle in Khorramabad, Iran.” Jundishapur Journal of Microbiology 8: e14810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bahrami, F. , Haghighi A., Zamini G., and Khademerfan M.. 2020. “Molecular Evidence for Zoonotic Transmission of Blastocystis Subtypes in Kurdistan Province, West of Iran.” Annals of Parasitology 66, no. 1: 19–25. [PubMed] [Google Scholar]
  11. Behravan, M. , Haghighi A., Javanmard E., Mohebi M., and Nemati S.. 2025. “Molecular Identification and Subtypes Analysis of Blastocystis in South Khorasan Province, Eastern Iran.” Molecular Biology Reports 52: 80. 10.1007/s11033-024-10135-1. [DOI] [PubMed] [Google Scholar]
  12. Beyhan, Y. E. , Yilmaz H., Cengiz Z. T., and Ekici A.. 2015. “Clinical Significance and Prevalence of Blastocystis hominis in Van, Turkey.” Saudi Medical Journal 36: 1118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Casero, R. D. , Mongi F., Sánchez A., and Ramírez J. D.. 2015. “ Blastocystis and Urticaria: Examination of Subtypes and Morphotypes in an Unusual Clinical Manifestation.” Acta Parasitologica 148: 156–161. [DOI] [PubMed] [Google Scholar]
  14. Cekin, A. H. , Cekin Y., Adakan Y., Tasdemir E., Koclar F. G., and Yolcular B. O.. 2012. “Blastocystosis in Patients With Gastrointestinal Symptoms: A Case–Control Study.” BMC Gastroenterology 12: 122. 10.1186/1471-230X-12-122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cifre, S. , Gozalbo M., Ortiz V., Soriano J. M., Merino J. F., and Trelis M.. 2018. “ Blastocystis Subtypes and Their Association With Irritable Bowel Syndrome.” Medical Hypotheses 116: 4–9. [DOI] [PubMed] [Google Scholar]
  16. Dagci, H. , Özgür K., Demirel M., et al. 2014. “Epidemiological and Diagnostic Features of Blastocystis Infection in Symptomatic Patients in Izmir province, Turkey.” Iranian Journal of Parasitology 9: 519. [PMC free article] [PubMed] [Google Scholar]
  17. Delshad, A. , Saraei M., Alizadeh S. A., et al. 2020. “Distribution and Molecular Analysis of Blastocystis Subtypes From Gastrointestinal Symptomatic and Asymptomatic Patients in Iran.” African Health Sciences 20: 1179–1189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Fouad, S. A. , Basyoni M. M., Fahmy R. A., and Kobaisi M. H.. 2011. “The Pathogenic Role of Different Blastocystis hominis Genotypes Isolated From Patients With Irritable Bowel Syndrome.” Arab Journal of Gastroenterology 12: 194–200. [DOI] [PubMed] [Google Scholar]
  19. Greige, S. , El Safadi D., Bécu N., et al. 2018. “Prevalence and Subtype Distribution of Blastocystis sp. Isolates From Poultry in Lebanon and Evidence of Zoonotic Potential.” Parasites & Vectors 11: 389. 10.1186/s13071-018-2975-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jalallou, N. , Iravani S., Rezaeian M., Alinaghizade A., and Mirjalali H.. 2017. “Subtypes Distribution and Frequency of Blastocystis sp. Isolated From Diarrheic and Non‐Diarrheic Patients.” Iranian Journal of Parasitology 12: 63. [PMC free article] [PubMed] [Google Scholar]
  21. Javanmard, E. , Niyyati M., Ghasemi E., Mirjalali H., Aghdaei H. A., and Zali M. R.. 2018. “Impacts of Human Development Index and Climate Conditions on Prevalence of Blastocystis: A Systematic Review and Meta‐Analysis.” Acta Parasitologica 185: 193–203. [DOI] [PubMed] [Google Scholar]
  22. Jiménez, P. A. , Jaimes J. E., and Ramírez J. D.. 2019. “A Summary of Blastocystis Subtypes in North and South America.” Parasites & Vectors 12: 376. 10.1186/s13071-019-3641-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Karamati, S. A. , Mirjalali H., Niyyati M., et al. 2019. “Comprehensive Study of Phenotypic and Growth Rate Features of Blastocystis Subtypes 1–3 and 6 in Symptomatic and Asymptomatic Subjects.” Iranian Journal of Parasitology 14: 204. [PMC free article] [PubMed] [Google Scholar]
  24. Khademvatan, S. , Masjedizadeh R., Yousefi‐Razin E., et al. 2018. “PCR‐Based Molecular Characterization of Blastocystis hominis Subtypes in Southwest of Iran.” Journal of Infection and Public Health 11: 43–47. [DOI] [PubMed] [Google Scholar]
  25. Matovelle, C. , Tejedor M. T., Monteagudo L. V., Beltrán A., and Quílez J.. 2022. “Prevalence and Associated Factors of Blastocystis sp. Infection in Patients With Gastrointestinal Symptoms in Spain: A Case‐Control Study.” Tropical Medicine and Infectious Disease 7: 226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Mohammad Rahimi, H. , Mirjalali H., and Zali M. R.. 2021. “Molecular Epidemiology and Genotype/Subtype Distribution of Blastocystis sp., Enterocytozoon bieneusi, and Encephalitozoon spp. in Livestock: Concern for Emerging Zoonotic Infections.” Scientific Reports 11: 17467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mohammadpour, I. , Bozorg‐Ghalati F., Gazzonis A. L., Manfredi M. T., Motazedian M. H., and Mohammadpour N.. 2020. “First Molecular Subtyping and Phylogeny of Blastocystis sp. Isolated From Domestic and Synanthropic Animals (Dogs, Cats and Brown Rats) in Southern Iran.” Parasites & Vectors 13: 365. 10.1186/s13071-020-04225-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nemati, S. , Zali M. R., Johnson P., Mirjalali H., and Karanis P.. 2021. “Molecular Prevalence and Subtype Distribution of Blastocystis sp. in Asia and in Australia.” Journal of Water and Health 19: 687–704. [DOI] [PubMed] [Google Scholar]
  29. Niaraki, S. R. , Hajialilo E., Delshad A., et al. 2020. “Molecular Epidemiology of Blastocystis spp. in Children Referred to Qods Hospital in Northwest of Iran.” Journal of Parasitic Diseases 44: 151–158. 10.1007/s12639-019-01177-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Parkar, U. , Traub R. J., Vitali S., et al. 2010. “Molecular Characterization of Blastocystis Isolates From Zoo Animals and Their Animal‐Keepers.” Veterinary Parasitology 169: 8–17. [DOI] [PubMed] [Google Scholar]
  31. Pestechian, N. , Tavakoli S., Adibi P., Safa A. H., Parsaei R., and Yousefi H. A.. 2021. “Prevalence of Intestinal Protozoan Infection in Patients With Ulcerative Colitis (UC) in Isfahan, Iran.” International Journal of Preventive Medicine 12: 114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Popruk, S. , Pintong A., and Radomyos P.. 2013. “Diversity of Blastocystis Subtypes in Humans.” Journal of Tropical Medicine and Parasitology 36: 88–88. [Google Scholar]
  33. Riabi, T. R. , Mirjalali H., Haghighi A., et al. 2018. “Genetic Diversity Analysis of Blastocystis Subtypes From Both Symptomatic and Asymptomatic Subjects Using a Barcoding Region From the 18S rRNA Gene.” Infection, Genetics and Evolution 61: 119–126. [DOI] [PubMed] [Google Scholar]
  34. Rojas‐Velázquez, L. , Maloney J. G., Molokin A., et al. 2019. “Use of Next‐Generation Amplicon Sequencing to Study Blastocystis Genetic Diversity in a Rural Human Population From Mexico.” Parasites & Vectors 12: 566. 10.1186/s13071-019-3814-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Rostami, M. , Fasihi‐Harandi M., Shafiei R., Aspatwar A., Derakhshan F. K., and Raeghi S.. 2020. “Genetic Diversity Analysis of Blastocystis Subtypes and Their Distribution Among the Domestic Animals and Pigeons in Northwest of Iran.” Infection, Genetics and Evolution 86: 104591. [DOI] [PubMed] [Google Scholar]
  36. Salehi, R. , Haghighi A., Stensvold C. R., et al. 2017. “Prevalence and Subtype Identification of Blastocystis Isolated From Humans in Ahvaz, Southwestern Iran.” Gastroenterology and Hepatology From Bed to Bench 10: 235. [PMC free article] [PubMed] [Google Scholar]
  37. Salehi, R. , Rostami A., Mirjalali H., Stensvold C. R., and Haghighi A.. 2022. “Genetic Characterization of Blastocystis From Poultry, Livestock Animals and Humans in the Southwest Region of Iran—Zoonotic Implications.” Transboundary and Emerging Diseases 69: 1178–1185. 10.1111/tbed.14078. [DOI] [PubMed] [Google Scholar]
  38. Scanlan, P. D. 2012. “ Blastocystis: Past Pitfalls and Future Perspectives.” Trends in Parasitology 28: 327–334. [DOI] [PubMed] [Google Scholar]
  39. Shams, M. , Bahrami A. M., Mousivand A., et al. 2024. “First Molecular Characterization of Blastocystis Subtypes From Domestic Animals (Sheep and Cattle) and Their Animal‐Keepers in Ilam, Western Iran: A Zoonotic Concern.” Journal of Eukaryotic Microbiology 71: e13019. 10.1111/jeu.13019. [DOI] [PubMed] [Google Scholar]
  40. Sharifi, Y. , Abbasi F., Shahabi S., Zaraei A., Mikaeili F., and Sarkari B.. 2020. “Comparative Genotyping of Blastocystis Infecting Cattle and Human in the South of Iran.” Comparative Immunology, Microbiology and Infectious Diseases 72: 101529. [DOI] [PubMed] [Google Scholar]
  41. Sheikh, S. , Asghari A., Sadraei J., Pirestani M., and Zare M.. 2020. “ Blastocystis sp. Subtype 9: As the First Reported Subtype in Patients With Schizophrenia in Iran.” SN Comprehensive Clinical Medicine 2: 633–639. 10.1007/s42399-020-00285-1. [DOI] [Google Scholar]
  42. Shirvani, G. , Fasihi‐Harandi M., Raiesi O., et al. 2020. “Prevalence and Molecular Subtyping of Blastocystis From Patients With Irritable Bowel Syndrome, Inflammatory Bowel Disease and Chronic Urticaria in Iran.” Acta Parasitologica 65: 90–96. 10.2478/s11686-019-00131-y. [DOI] [PubMed] [Google Scholar]
  43. Skotarczak, B. 2018. “Genetic Diversity and Pathogenicity of Blastocystis .” Annals of Agricultural and Environmental Medicine 25: 411–416. [DOI] [PubMed] [Google Scholar]
  44. Stensvold, C. R. , Alfellani M. A., Nørskov‐Lauritsen S., et al. 2009. “Subtype Distribution of Blastocystis Isolates From Synanthropic and Zoo Animals and Identification of a New Subtype.” International Journal for Parasitology 39: 473–479. [DOI] [PubMed] [Google Scholar]
  45. Stensvold, C. R. , and Clark C. G.. 2016. “Current Status of Blastocystis: A Personal View.” Parasitology International 65: 763–771. [DOI] [PubMed] [Google Scholar]
  46. Taherkhani, H. , Sardarian K., Semnani S., and Roshandel G.. 2008. “ Blastocystosis in Iran: Epidemiological Characteristics and Clinical Manifestations.” Journal of Clinical and Diagnostic Research 2: 969–972. [Google Scholar]
  47. Wang, W. , Owen H., Traub R. J., Cuttell L., Inpankaew T., and Bielefeldt‐Ohmann H.. 2014. “Molecular Epidemiology of Blastocystis in Pigs and Their in‐Contact Humans in Southeast Queensland, Australia, and Cambodia.” Veterinary Parasitology 203: 264–269. [DOI] [PubMed] [Google Scholar]
  48. Barati, M. , KarimiPourSaryazdi A., Rahmanian V., et al. 2022. “Global Prevalence and Subtype Distribution of Blastocystis sp. in Rodents, Birds, and Water Supplies: A Systematic Review and Meta‐Analysis.” Preventive Veterinary Medicine 208: 105770. [DOI] [PubMed] [Google Scholar]
  49. Deng, L. , Chai Y., Zhou Z., et al. 2019. “Epidemiology of Blastocystis sp. Infection in China: A Systematic Review.” Parasite 26: 41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Feride, Ş. , Rugıyya S., Hüseyin K., and Salih M.. 2025. “Investigation of Blastocystis spp. in Patients With Inflammatory Bowel Disease by Direct Microscopy and Molecular Methods.” African Health Sciences 25: 74–83. [Google Scholar]
  51. Fu, X. , Lyu J., Shi Y., et al. 2025. “Epidemiological Survey on Prevalence and Subtypes Distribution of Blastocystis sp. in Southern Guizhou.” Biomolecules and Biomedicine 25: 1508–1516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Fusaro, C. , Bernal J. E., Baldiris‐Ávila R., et al. 2024. “Molecular Prevalence and Subtypes Distribution of Blastocystis spp. in Humans of Latin America: A Systematic Review.” Tropical Medicine and Infectious Disease 9: 38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Guilavogui, T. , Gantois N., Even G., et al. 2022. “Detection, Molecular Identification and Transmission of the Intestinal Protozoa Blastocystis sp. in Guinea From a Large‐Scale Epidemiological Study Conducted in the Conakry Area.” Microorganisms 10: 446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Heydarian, M. , Manouchehri Naeini K., Kheiri S., and Abdizadeh R.. 2024. “Prevalence and Subtyping of Blastocystis sp. in Ruminants in Southwestern.” Scientific Reports 14: 20254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Hublin, J. S. , Maloney J. G., and Santin M.. 2021. “ Blastocystis in Domesticated and Wild Mammals and Birds.” Research in Veterinary Science 135: 260–282. [DOI] [PubMed] [Google Scholar]
  56. Lhotská, Z. , Jirků M., Hložková O., et al. 2020. “A Study on the Prevalence and Subtype Diversity of the Intestinal Protist Blastocystis sp. in a Gut‐Healthy human Population in the Czech Republic.” Frontiers in Cellular and Infection Microbiology 10: 544335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Maleki, B. , Olfatifar M., Dodangeh S., Ahmadi N., Gorgipour M., and Javanmard E.. 2022a. “Subtype Distribution of Blastocystis sp. Isolated From Humans in Iran: A Systematic Review and Meta‐Analysis.” Gastroenterology and Hepatology From Bed to Bench 15: 294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Maleki, B. , Sadraei J., Asl A. D., and Pirestani M.. 2022b. “High Occurrence of Blastocystis sp. Subtype 3 in Individuals Referred to Medical Laboratories in Kermanshah, Iran.” Gastroenterology and Hepatology From Bed to Bench 15: 164. [PMC free article] [PubMed] [Google Scholar]
  59. Marangi, M. , Boughattas S., De Nittis R., et al. 2023. “Prevalence and Genetic Diversity of Blastocystis sp. Among Autochthonous and Immigrant Patients in Italy.” Microbial Pathogenesis 185: 106377. [DOI] [PubMed] [Google Scholar]
  60. Mohammadi, M. R. , Asghari A., Badri M., Maleki F., Bijani B., and Karampour A.. 2025. “Global Epidemiology and Subtype Distribution of Blastocystis sp. in Birds: A Systematic Review and Meta‐Analysis.” Foodborne Pathogens and Disease. 10.1089/fpd.2025.0007. [DOI] [PubMed] [Google Scholar]
  61. Rauff‐Adedotun, A. A. , Meor Termizi F. H., Shaari N., and Lee I. L.. 2021. “The Coexistence of Blastocystis spp. in Humans, Animals and Environmental Sources From 2010–2021 in Asia.” Biology 10: 990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Rudzińska, M. , and Sikorska K.. 2023. “Epidemiology of Blastocystis Infection: A Review of Data From Poland in Relation to Other Reports.” Pathogens 12: 1050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Šejnohová, A. , Koutenská M., Jirk∖uu M., et al. 2024. “A Cross‐Sectional Survey of Blastocystis sp. and Dientamoeba Fragilis in Non‐Human Primates and Their Caregivers in Czech Zoos.” One Health 19: 100862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Shams, M. , Asghari A., Baniasad M., Shamsi L., and Sadrebazzaz A.. 2022. “ Blastocystis sp. in Small Ruminants: A Universal Systematic Review and Meta‐Analysis.” Acta Parasitol. 67: 1073–1085. 10.1007/s11686-022-00589-3. [DOI] [PubMed] [Google Scholar]
  65. Shams, M. , Shamsi L., Sadrebazzaz A., et al. 2021. “A Systematic Review and Meta‐Analysis on the Global Prevalence and Subtypes Distribution of Blastocystis sp. Infection in Cattle: A Zoonotic Concern.” Comparative Immunology, Microbiology and Infectious Diseases 76: 101650. [DOI] [PubMed] [Google Scholar]
  66. Tan, K. S. W. 2004. “ Blastocystis in Humans and Animals: New Insights Using Modern Methodologies.” Veterinary Parasitology 126: 121–144. 10.1016/j.vetpar.2004.09.017. [DOI] [PubMed] [Google Scholar]
  67. Yersal, O. , Malatyali E., Ertabaklar H., Oktay E., Barutca S., and Ertug S.. 2016. “ Blastocystis Subtypes in Cancer Patients: Analysis of Possible Risk Factors and Clinical Characteristics.” Parasitology International 65: 792–796. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The raw data supporting the findings of the study are available upon reasonable request.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES