Investigation of new Helicobacter pylori variants among cagA positive strains using MLST typing method in Iraq

Abstract

Helicobacter pylori is commonly found in the upper gastrointestinal tract of over 50% of the global population. There is growing recognition of the importance of Helicobacter pylori infections, specifically gastric cancer, and a clear gap in the literature about the clinical and epidemiological studies on the pathogen, especially in Iraq. Therefore, this study aimed to analyze the genetic diversity and phylogeographic origins of Helicobacter pylori strains in Iraq and their relationship to global phylogeographic groups using MLST. This cross-sectional study involved 203 biopsy specimens from patients admitted to the gastroenterology units, biopsy specimens were cultured on selective media and identified as Helicobacter pylori. DNA was extracted, and PCR was used for molecular identification, and phylogeographic analysis was performed, for which primers were taken from the MLST website. The sequences were aligned and submitted to the MLST database. Molecular polymorphism analysis revealed the identification of 112 new alleles. Phylogenetic analysis using the TBTool software was investigated for these Helicobacter pylori isolates, which showed that the 19 unique STs can be classified into five clusters. Data from this study showed that Helicobacter pylori strains were in the same cluster as isolates from the Middle East area. Results revealed that the clinical isolates identified from this study were like their European ancestors and belonged to the hpEurope haplotype. The study concluded that the population structure of Helicobacter pylori strains in Iraq was closely similar to their European counterparts and belonged to the hpEurope haplotype. No isolates were identified from the hpAfrica or hpEastAsia sub-populations.

Introduction

Helicobacter pylori (H. pylori) is classified as spiral shaped, microaerophilic, and belongs to the gram-negative group. It is commonly found in the upper gastrointestinal tract (GI tract) of over 50% of the global population¹. H. pylori appears in the great majority of cases; however, colonization is asymptomatic, and only 10–20% of carriers develop pathological changes in the GI tract^1,2. H. pylori has a significant impact on chronic gastroduodenal diseases such as gastritis, peptic ulcer, mucosa-associated lymphoid tissue (MALT), and gastric cancer³.

H. pylori is categorized as a category I cancer by the International Agency for Research on Cancer (IARC), which is part of the World Health Organization (WHO)⁴. Many virulence factors are required for gastric colonization and surviving in the harsh gastric environment⁵. A well-known pathogenic characteristic cytotoxin-associated gene A (CagA) is a protein encoded by the cagA gene, which is situated within the terminal of the cag pathogenicity island, it is a strong immunoreactive protein having a molecular weight of 125–145 kDa^5,6, its effect on various cellular processes, and its relationship to disease outcomes. CagA activates signaling pathways that disrupt epithelial junctions, leading to changes in tight junction function, cell polarization, and differentiation. H. pylori strains can be classified according to whether they possess the cagA gene or not. CagA expression in individuals with inflammation has been related to a higher risk of significant clinical outcomes compared to strains without it. cagA positive strains have specific isoforms of the gene (EPIYA), which are tyrosine phosphorylation sites that disrupt intracellular signaling pathways in infectious epithelial cells^5–8. The frequency of strains carrying the island shows significant variation between different phylogeographic regions. People with East Asian strains that possess the EPIYA-D segment are more likely to develop gastric cancer is more prevalent in strains that carry the EPIYA-C segment^5,9. CagA has been shown to have a considerable impact on the development of gastropathies, as the prevalence of cagA-positive H. pylori strains is above 70% in neighboring countries such as Turkey and Iran¹⁰. Additionally, H. pylori has the gene encoding vacuolating toxin A (VacA) and shows allelic variance in three main areas, the s (signal), i (intermediate), and m (middle) areas, and finally, the cytotoxicity of the toxin differs between strains. There are various combinations of two significant alleles in each area (s1, s2, i1, i2, m1, m2), leading to VacA toxins’ development with different abilities to induce vacuolization epithelium. It is capable of stimulating the formation of membrane channels, inducing the release of cytochrome C from mitochondria, and attaching to cell membrane receptors, resulting in a pro-inflammatory response^6,9. Furthermore, blood group antigen-binding adhesin (BabA) is a pathogenic factor that allows H. pylori to adhere to the gastric epithelium and deliver toxins into host cells, causing direct or indirect tissue damage through inflammatory or immune responses^6,11. The outer inflammatory protein A (OipA) increases inflammatory response by affecting interleukin 8 (IL-8) production⁵. Another factor related to the pathogenicity of the bacteria is gene induced by contact with epithelium (iceA); this gene has two main allelic variants: iceA1 and iceA2¹.

Genetic studies show that a wide range of H. pylori strains are affected by environmental factors, including climate and geography. For example, H. pylori strains from East Asia are different from those found in Europe. In addition, differences in the incidence of duodenal ulcers, chronic atrophic gastritis, and gastric cancer are to some extent related to the regional origin of the strains. While estimates indicate a high prevalence of H. pylori infection in Africa and South Asia, the frequency of gastric cancer in certain regions is significantly lower than in other countries, and from North Asia to Southeast Asia, the infections’ malignancies associated with this disease are decreasing. Therefore, it is of therapeutic importance to perform genetic studies on the H. pylori group^9,12–16. New information on the development and genetic structure of the H. pylori population is derived from multi-locus sequence typing (MLST), a technique used to identify and classify bacterial isolates by examining the sequences of internal segments of usually seven housekeeping genes. atpA, efp, mutY, ppa, trpC, ureI and yphC that represent the chosen neutral location in the genome as well as two virulence-related genes “cagA and vacA” which are not always included in MLST analysis^16–18. This technique has been used to identify seven distinct demographic categories: hpEurope, hpEastAsia, hpAfrica1, hpAfrica2, hpAsia2, hpNEAfrica, and hpSahul^16,19. This study aims to analyze the genetic diversity and phylogeographic origins of H. pylori strains in Iraq, as well as their relationship to global phylogeographic groups, using MLST.

Materials and methods

Sample collection

A total of 203 patients with presenting symptoms and dyspeptic disorder were referred to the Outpatient Gastroenterology and Endoscopy Unit at Rizgary Hospital. These patients underwent gastric endoscopy between July 2021 and May 2022. This study included cases with upper abdominal pain, gastroesophageal reflux, dyspepsia, and dysphagia. Participants were excluded from the study if they were taking antimicrobial agents, proton pump inhibitors, H2 blockers, or non-steroidal anti-inflammatory drugs in the 2 weeks prior to the endoscopy. As these criteria affect the density of the bacterial population in the stomach and their culture results. Individual patient data included clinical observations, and comprehensively, four biopsies (two antrum and two corpuses) were obtained from each case. It was placed in aseptic tubes, containing 1 ml of sterile saline, and immediately transmitted to the microbiology laboratory for H. pylori culturing.

Bacterial culture

Biopsy specimens were transported to the medical microbiology lab at 4 °C within two hours of sampling in sterile saline. Then, the specimens were well mixed and cultured on selective medium Brain–Heart-Infusion Agar (Oxoid, England) and Columbia Agar (Sigma-Aldrich USA) supplemented enriched with H. pylori selective supplement (Dent) and 10% defibrinated sheep blood, and incubated for 5–7 days at 37 °C in a microaerophilic environment. The isolates were identified as H. pylori based on colony morphology, Gram stain, as well as by positive reactions for oxidase, catalase, and significant urease activity.

DNA extraction

The extraction of genomic DNA was performed using a commercially available kit (AddPrep Genomic DNA Extraction Kit) from cultured H. pylori according to the guidelines provided by the manufacturers. DNA extracts were evaluated for quality using 0.8% agarose gel electrophoresis, and Nanodrop (Thermo Inc.) was used to measure the extracted DNA’s concentration.

Polymerase chain reaction (PCR)

Extracted bacterial DNA were used as a template DNA in polymerase chain reaction (PCR), H. pylori was determined using a PCR targeted the 16S rRNA gene, additionally identified the virulence factors of H. pylori including cagA, vacAs1/s2, vacAm1/m2, iceA1/2, babA2 and oipA. The primer sequences and PCR product sizes utilized in this investigation were summarized in Table 1. The whole amount of the amplification reaction was 25 µL with 2.5 µL DNA template and 2.5 µL 10× PCR buffer, 1.25 mM Mgcl2, 0.1 mM of each dNTP, 0.5 µL reverse and forward primer, and 1U Taq polymerase enzyme. The PCR cycle conditions were the following: initial denaturation stage at 95 °C for a duration of 10 min, 35 cycles of 95 °C for 45 s; annealing at (44–58) °C for 45 s; 72 °C for 90 s; and the last extension phase at 72 °C for 10 min. The visualization of all PCR products was achieved by agarose gel electrophoresis utilizing (1.5%) concentration of the gel and a safe stain for staining^20–23.

Table 1.

Sequences of oligonucleotide primers and PCR conditions for the genotyping of H. pylori isolates.

Genes	Primers	References
16S rRNA	F: AGGGGTAAAATCCGTAGAGAT R: CGTTTAGGGCGTGGACTA	20
cagA	F: GTTGATAACGCTGTCGCTTC R: GGGTTGTATGATATTTTCCATAA	21
vacAs1/s2	F: ATGGAAATACAACAAACACAC R: CTGCTTGAATGCGCCAAAC	22
vacAm1/m2	F: CAATCTGTCCAATCAAGCGAG R: GCGTCAAAATAATTCCAAGG	22
babA2	F: CCAAACGAAACAAAAAGCG R: GCTTGTGTAAAAGCCGTCGT	22
iceA1	F: GTGTTTTTAACCAAAGTATC R: CTATAGCCACTTTCTTTGCA	23
iceA2	F: GTTGGGTATATCACAATTTAT R: TTACCCTATTTTCTAGTAGGT	23
oipA	F: CAAGCGCTTAACAGATAGGC R: AAGGCGTTTTCTGCTGAAGC	22
atpA	F: GGACTAGCGTTAAACGCACG R: CTTGAAACCGACAAGCCCAC	pubmlst.org/Helicobacter
efp	F: GGCAATTTGGATGAGCGAGCTC R: CTTCACCTTTTCAAGATACTC	pubmlst.org/Helicobacter
mutY	F: GTGGTTGTAGYTGGAAACTTTACAC R: CTTAAGCGTGTGTYTTTCTAGG	pubmlst.org/Helicobacter
ppa	F: GGAGATTGCAATGAATTTAGA R: GTGGGGTTAARATCGTTAAATTG	pubmlst.org/Helicobacter
trpC	F: TAGAATGCAAAAAAGCATCGCCCTC R: TAAGCCCGCACACTTTATTTTCGCC	pubmlst.org/Helicobacter
urel	F: AGGTTATTCGTAAGGTGCG R: GTTTAAATCCCTTAGATTGCC	pubmlst.org/Helicobacter
yphC	F: CACGCCTATTTTTTTGACTAAAAAC R: CATTYACCCTCCCAATGATGC	pubmlst.org/Helicobacter

Sequencing

For phylogeographic analysis, each strain was typed by amplifying the seven standard MLST genes, namely atpA, efp, mutY, ppa, trpC, ureI, and yphC, using housekeeping gene primers taken from the MLST website, as shown in Table 1.

To incorporate index sequences into PCR amplicons, appropriate tails have been added to the 5ʹ ends of the primers utilizing the sequence information given by Illumina Inc. PCR was performed to incorporate index sequences into the amplicons, enabling multiplexing in next-generation sequencing. Each sample was assigned a unique combination of index primers. The same amount of indexed PCR reactions was combined to create a PCR pool, which contains all the amplicons from all the samples.

The prepared pools are subsequently purified by the NucleoFast® 96 PCR clean-up kit (MACHEREY–NAGEL GmbH). Purified PCR pools were quantified by using a Nanodrop 1000 microvolume spectrophotometer (Thermo Inc.) and diluted according to Illumina’s recommendations prior to sequencing. The PCR products are purified and standardized using the NexteraXT sample prep kit from (Illumina Inc.) in order to prepare them for next generation sequencing (NGS). The procedure is carried out using Miseq equipment, produced by Illumina Inc., as well as using MiSeq Reagent Kit v2 2 × 150 cartridges (MS-102-2002, Illumina Inc.).

Analysis

The sequences were aligned to the H. pylori genome with the Burrows-Wheeler Aligner. For the purpose of identifying alleles and sequence types, the resulting sequences have been submitted to the H. pylori MLST database, available at http://pubmlst.org/Helicobacter. Each isolate’s MLST profile contained the allele numbers ascribed to each of the seven genes, allowing for the determination of each isolate’s sequence type. Using concatenated nucleotide sequences from seven different gene loci, the phylogenetic tree of thirty-four Iraqi H. pylori isolates were created. The neighbor-noining algorithm was used TBTool software (https://pubmlst.org/helicobacter/). Next, using iTol software (https://pubmlst.org/helicobacter/), a phylogenetic tree was constructed using 30 isolates to compare Iraqi isolates with others from other Asian countries. In order to assess the relatedness of Iraqi H. pylori populations to global populations and examine their population structure, 423 sequences from hpEurope, hpAfrica hpNEAfrica, hpEAsia (hspEAsia and hspMaori), hspSAfrica1, hspWAfrica1, and hpAfrica2 were added.

Result

Out of 203 samples with symptomatic H. pylori infection, we identified 137 positive cases by rapid urease testing, including (90) strains from females with an age range of 17–71 years (mean age 39.971 ± 14.3) and (47) from male patients with an age range of 21–58 years (mean age 34 ± 11.5). However, only 91 of these positive cases were found to grow on selective media. Clinical H. pylori strains were identified using a combination of Gram staining and biochemical tests and appeared as a spiral shape under a microscope. All isolates showed positive results for urease, oxidase, and catalase tests, and all 91 isolates were subsequently verified as H. pylori by amplification and sequencing of the 16SrRNA gene. Additionally, vacA and cagA genotypes were identified by PCR; these two genes were identified in 80 (87.91%) and 55 (60.4%) of the 91 H. pylori strains, respectively. The cagA gene was present in all vacA gene-positive strains, however, 25 of the vacA positive isolates were negative for the cagA gene.

The sequence types of 34 H. pylori strains, which were selected randomly out of 91 isolates were determined using MLST. In this observation, genes were accurately classified for typing cagA, vacA s1/s2, vacA m1/m2, iceA1/A2, babA2, and oipA from all strains we subjected to multi-locus sequence typing.

In this observation, the combination of virulent allelic s1m1 was most common and found in 12 (35.29%) of the H. pylori strains, the s1m2 was observed in 7 (20.58%) and other genotypes, s2m1 and s2m2 were detected in 11 (32.35%) and 3 (8.82%) strains, respectively. Furthermore, vacAm1/m2 allele was undetected in one strain (Table 2).

Table 2.

Distribution of H. pylori virulence genes in 34 isolates identified in this study.

Gene ID	cagA	vacAs1	vacAs2	vacAm1	vacAm2	iceA1	iceA2	babA2	oipA
3146	+	+		+		+	+		+
3147	+	+		+			+	+	+
3148	+		+		+	+		+	+
3149	+	+		+		+		+
3150	+		+	+		+		+
3151	+	+		+		+	+	+	+
3152	+		+		+	+		+	+
3153	+		+	+		+		+
3154	+		+	+		+		+
3155	+	+			+	+	+	+	+
3156	+	+			+	+	+	+	+
3157	+		+	+		+		+	+
3158	+		+		+	+		+	+
3159	+		+	+		+	+		+
3160	+	+		+			+	+	+
3161	+	+		+					+
3162	+		+	+		+	+	+
3163	+		+	+		+	+	+
3164	+	+		+					+
3165	+	+		-	-		+	+	+
3166	+	+			+		+		+
3167	+		+	+		+		+	+
3168	+	+			+	+	+	+	+
3169	+	+		+		+	+		+
3170	+	+		+		+	+		+
3171	+		+	+		+	+	+
3172	+		+	+		+	+	+
3173	+	+		+		+	+	+	+
3174	+	+			+	+		+	+
3175	+	+		+		+		+
3176	+	+			+		+		+
3177	+	+		+			+	+	+
3178	+	+			+		+	+	+
3179	+		+	+		+		+

The “+” sign indicates the mean for isolates in which the virulence factor was detected, while the “−” sign indicates the mean for isolates where the virulence factor was undetected.

Additionally, the iceA1/A2 was found in 32 strains (94.11%), while babA2 was found in 26 strains (76.47%), oipA was detected in 24 strains (70.58%). All virulence genes cagA, vacA s/m, iceA, babA2 and oipA were observed in 16 strains. Identified alleles and nucleotide diversity of the housekeeping genes.

Molecular profiling was performed on 34 strains. For the genes shown in Table 3, molecular polymorphism analysis revealed the identification of 112 new alleles. These alleles were distributed as follows: sixteen additional alleles were found for atpA, fifteen alleles for efp, sixteen alleles for mutY, fifteen alleles for ppa, sixteen alleles for trpC, seventeen alleles for ureI, and eighteen alleles for yhpC. The gene yphC showed the greatest allelic diversity, while efp and ppa showed the least allelic diversity. Twelve of the 34 isolates presented the seven sequenced alleles described for the first time. Each isolate had an allelic profile showing the uniqueness of each of the 34 sequence types, none of which had been previously documented in the polymorphic sequence database. Of 34 strains, the MLST analysis revealed 19 unique STs, ST4240 being the dominant strain. Followed by ST4228, ST4233, and ST4239 each containing three strains, ST4227, ST4229, ST4230, ST4238, ST4244, and ST4247 each containing two strains, while each of the other nine genotypes contained one strain (Table 3), in which the newly identified alleles and STs of the isolates from this study are indicated in bold. Each allele, profile, and isolate in this study was assigned a unique identifier (allele number, ST number, and ID number, respectively), which serves as an accession for reference. The complete list of isolates analyzed is available on the MLST database and can be accessed using the following link: https://pubmlst.org/bigsdb?db=pubmlst_helicobacter_isolates.

Table 3.

MLST Sequence typing of 34 H. pylori isolates identified and their allele numbers.

ID	atpA	efp	mutY	ppa	trpC	ureI	yphC	ST (MLST)
3146	1303	1500	3094	2618	2929	1446	1721	4143
3147	1220	2506	932	1586	659	1769	2674	4225
3148	1688	2369	1993	671	2917	2865	1808	4226
3149	3462	3234	3550	3263	3589	3576	3624	4227
3150	79	3235	3551	3264	3590	3577	3678	4228
3151	3463	563	3552	3265	3591	3578	3679	4229
3152	3464	3236	3553	3266	3592	3579	3680	4230
3153	3465	3237	3554	3267	3593	3580	3681	4231
3154	79	3235	3551	3264	3590	3577	3678	4228
3155	3466	3238	3555	3268	3594	3581	3682	4233
3156	3466	3238	3555	3268	3594	3581	3682	4233
3157	3467	2369	3556	3269	3595	3582	3683	4235
3158	3464	3236	3553	3266	3592	3579	3680	4230
3159	3468	3239	3557	3270	3596	3583	3684	4237
3160	3469	3240	3558	1586	3597	3584	3685	4238
3161	3470	3241	3559	3271	3598	3585	3686	4239
3162	3474	3246	3565	3275	3604	3591	3691	4240
3163	3474	3246	3565	3275	3604	3591	3691	4240
3164	3470	3241	3559	3271	3598	3585	3686	4239
3165	3471	3242	3560	1531	3599	3586	3687	4243
3166	3472	3243	3561	3272	3600	3587	3406	4244
3167	1978	3244	3562	3273	3601	3588	3688	4245
3168	115	1865	3563	1633	3602	3589	3689	4246
3169	3473	3245	3564	3274	3603	3590	3690	4247
3170	3473	3245	3564	3274	3603	3590	3690	4247
3171	3474	3246	3565	3275	3604	3591	3691	4240
3172	3474	3246	3565	3275	3604	3591	3691	4240
3173	3463	563	3552	3265	3591	3578	3679	4229
3174	3466	3238	3555	3268	3594	3581	3682	4233
3175	3462	3234	3550	3263	3589	3576	3624	4227
3176	3472	3243	3561	3272	3600	3587	3406	4244
3177	3469	3240	3558	1586	3597	3584	3685	4238
3178	3470	3241	3559	3271	3598	3585	3686	4239
3179	79	3235	3551	3264	3590	3577	3678	4228

Significant values are in bold.

The full details of the isolate ID numbers, MLST STs, and all accession numbers provided by NCBI are included in supplementary file (S1).

Cluster analysis of the MLST genotyping relationship

Phylogenetic analysis using the TBTool software showed that the 19 different ST types can be classified into five clusters comprised of the isolates that were documented in this investigation. The first cluster included 6 isolates with ID numbers 3151, 3173, 3168, 3155, 3156 and 3174 which corresponded to three STs 4229, 4246 and 4233. The second cluster contained four isolates (ID numbers 3149, 3175, 3159, and 3167) with three STs. The rest of clusters are shown in Fig. 1.

Fig. 1.

MLST analysis of 34 isolates of H. pylori identified in this study. The phylogenetic tree was constructed using a neighbor-joining tree with TBTool software.

Furthermore, the isolates obtained in the present study were compared to those obtained from adjacent nations in Iraq using the iTol software in Fig. 2. 75% of the H. pylori strains found in Iraq were found to be in the same cluster as isolates from Iran, Turkey, Saudi Arabia, Jordan, and Lebanon, according to phylogenetic analyses.

Fig. 2.

Phylogenetic analysis of 34 isolated Iraqi H. pylori isolates with 30 isolates from neighboring Asian countries using data from 7 housekeeping genes in the iTol software.

Geographic distribution of the isolates

In the present study, examination of H. pylori sequences from Iraq using phylogenetic analysis showed that thirty-four of the H. pylori clinical isolates were found similar to their European ancestors and belonged to the hpEurope haplotype (Fig. 3).

Fig. 3.

Global analysis of 34 Iraqi isolates with 423 strains from other countries using 7 housekeeping genes in the iTol Software based on population structure of isolates (H. pylori strains of Iraq are blue).

Discussion and conclusion

H. pylori has a significant role in the pathogenesis of gastrointestinal diseases²⁴. The prevalence of an infection caused by H. pylori in Iraq is relatively high and varies according to geographical distribution: It ranges from 47.8 to 75% in different regions from southern to northern Iraq^25,26. In this investigation showed that 60.4% of the participants had the cagA gene, and the prevalence of the cagA genotype was lower than that reported in Iraq by Salih et al.²⁶. The existence of the cagA gene and vacA gene contributes to the pathogenesis of many gastrointestinal diseases, they can be regarded as the most common virulence genes in H. pylori²⁷. Due to the high mutation rate, virulence factors vary among geographic lineages, which contributes to the strains’ high genetic diversity^16,28. Data produced from this study showed that the most common genotype for cagA and vacA was vacA + cagA+/s1m1 (12/34, 35.29%). Several studies were also found a higher incidence of the cagA gene in patients with peptic ulcer disease, as they showed that the incidence of cagA positive strains was higher than in cagA-negative strains^16,29. Worldwide, the prevalence of the s1m1 genotype is over 24% in Hong Kong, Nigeria, Ethiopia, Korea, Brazil, Iran, and south Iraq^30,31. In this present study, the occurrence rate of the s1m2 genotype was 20.58% (7/34), in the same way, the most common genotype in Middle-East patients, England and China is s1m2^16,29.

The iceA can be considered as a genetic component to peptic ulcer illness^32,33, even though other research has suggested a different correlation³⁴. On the other hand, iceA was present in 94.11% of study patients. The iceA1 and iceA2 percentages among the studied subjects were different (73.52%) and (58.82%), respectively, the iceA1 allele was found to be more frequent than the iceA2 allele in Saudi Arabia, and Korea^33,35, additionally, disagree findings were obtained with Abu Taleb et al. 2018³⁶. BabA is a virulence factor that allows H. pylori to adhere to the gastric epithelium and deliver toxins into host cells, causing direct or indirect tissue damage through inflammatory or immune responses^6,37. OipA is closely linked to the adherence, colonization, induction, and development of gastrointestinal diseases^1,5. In this regard, these results showed that 76.47% (26/34) of the subjects had the babA2 gene and 70.58% (24/34) had the oipA gene. However, several studies reported different percentages of babA2 and oipA genes in different regions, for example oipA reported 81% in Iran and babA prevalence was 91.5% in China^34,35,37,38.

H. pylori is characterized by its extensive genetic diversity and widespread global distribution. They serve as a bacterial model for investigating the microevolution of infections within an individual host and the co-evolution of geographically defined populations. This can be utilized to examine human migration pathways. H. pylori is recognized for the occurrence of single nucleotide polymorphisms, the ability for homologous recombination, and pseudogene formation from mutations. Clonal populations of H. pylori strains have been identified in different ethnicities and countries around the world. This bacterium is also known for its extensive single nucleotide polymorphisms and homologous recombination^14,16,39,40.

The genetic analysis of H. pylori was utilized in this study showed that the strains have a global structure rather than a phylogenetic structure. The large genetic rearrangement may be the result of frequent recombination and horizontal gene transfer. H. pylori appears to have a clonal structure only when moving from one host to another or for a short period of time^39,41,42. However, the obtained data suggest that mutations can contribute to the genetic variability of H. pylori.

Studying H. pylori infection involves understanding various aspects including host characteristics, nutritional, environmental conditions, and different strains of H. pylori. Genetic studies reveal the diverse nature of this bacterium because of its geographical and racial structures. The biogeographic relationship is likely caused by transmission within the same family. MLST-based population analysis categorizes the H. pylori groups that dictate the distribution and occurrence of gastric cancer, depend on H. pylori groups defined by MLST-based population analysis. Bacterial clones are the main factor behind the dissemination of the disease and increased infection incidence. These investigations have consequences for understanding infectious diseases and quantifying public health in order to mitigate their detrimental impact on the population^16,41,42.

MLST is a molecular typing approach frequently used to determine the genetic relatedness among bacterial clones⁴³. In this observation, MLST analysis of 34 isolates of H. pylori exhibited the genetic diversity of their genotypes, in accordance with prior findings^15,44. Consequently, none of the strains examined by MLST in this study were associated with the hpEAsia population. In fact, the strains under analysis are mainly associated with hpEuropean and, to a lesser degree, hpAfrican populations, according to our MLST results. Similar findings were also obtained with neighboring countries¹⁵.

It was discovered that genetic variability between patients, along with H. pylori virulence factors, also played a role in the incidence of this disease, which helped partially explain the so-called “Asian enigma”—which is used to describe an area in which there is a low occurrence of gastric cancer, although a high number of people are infected with this bacterium⁴⁴. Although infection with African strains (hpAfrica1) was not linked to premalignant histological lesions, a previous investigation indicated that a strain of European origin, known as hpEurope, was present. However, no prior research has examined the connection between the phylogeographic origin of H. pylori and the risk of gastric cancer in Asia, specifically for hpAsia2^9,12,44,45. Limitations of the present study were sample size and geographical representation, as the study was a part of the Ph.D. study, the period and the fund was limited. The study concluded that the population structure of H. pylori strains in Iraq closely similar to their European counterparts and belonged to the hpEurope haplotype.

Author contributions

SB designed, drafting the work and reviewing it critically for important intellectual content, guided thoroughly. KO performed practical part of the study, analyzed data using related software and appropriately investigated the accuracy and integrity of any part of the work. Both authors read and approved the final manuscript.

Data availability

The datasets generated and/or analyzed during the current study are available in the pubMLST repository: https://pubmlst.org/bigsdb?db=pubmlst_helicobacter_isolates. The full details of the isolate ID numbers, MLST STs, and all accession numbers provided by NCBI are included in S1 file

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee, College of Health Sciences, Hawler Medical University (Code: ERB 1461/Sept. 2021).

Informed consent

Informed consent was obtained from all individual participants included in the study.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-05195-7.