Exosomes derived from mesenchymal stem cells repair ovarian function by suppressing NLRP3-mediated pyroptosis in cyclophosphamide-induced premature ovarian failure

Abstract

Background

Premature ovarian failure (POF) is a debilitating condition impairing fertility and health in women. Mesenchymal stem cell-derived exosomes (MSC-EVs) have emerged as a promising therapeutic option for POF due to their regenerative capabilities. This study explores the effectiveness of human umbilical cord mesenchymal stem cell-derived exosomes (HuMSCs-Exos) in counteracting NLRP3-mediated pyroptosis and restoring ovarian function in a cyclophosphamide (CTX)-induced POF model.

Methods

HuMSCs-Exos were characterized using transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA), and western blot for exosomal markers. A CTX-induced POF mouse model was treated with HuMSCs-Exos to assess their impact on ovarian morphology, function, and fertility. Additionally, in vitro studies on granulosa cells (GCs) evaluated the effects of HuMSCs-Exos on cell viability, apoptosis, oxidative stress, and NLRP3 inflammasome pathway components.

Results

In the CTX-induced POF model, HuMSCs-Exos treatment significantly improved ovarian structure, increased follicle counts, restored estrous cycles, and enhanced fertility outcomes. Hormonal balance was also achieved, with a notable reduction in NLRP3 inflammasome activation and oxidative stress markers. In vitro, HuMSCs-Exos promoted GCs viability and reduced apoptosis and oxidative damage, further inhibiting the NLRP3 inflammasome pathway.

Conclusion

HuMSCs-Exos effectively mitigate CTX-induced POF through the suppression of NLRP3-mediated pyroptosis, enhancing ovarian function and fertility. This study underscores the potential of MSC-EV-based therapies for treating POF and possibly other inflammatory and degenerative reproductive disorders.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13048-025-01785-1.

Introduction

Premature ovarian failure (POF) represents a significant clinical challenge characterized by the loss of normal ovarian function before the age of 40 [1, 2]. It is a multifactorial syndrome that leads to infertility, decreased estrogen levels, and various health complications, including osteoporosis and cardiovascular disease [3, 4]. The etiology of POF is complex, involving genetic, autoimmune, and iatrogenic factors, among others [5–7]. Cyclophosphamide (CTX), a chemotherapeutic agent, has been known to induce POF, highlighting the need for effective therapeutic strategies to mitigate this adverse effect and restore ovarian function [1].

Mesenchymal stem cells (MSCs), with their potent regenerative and immunomodulatory properties, have been at the forefront of regenerative medicine research [1, 8–10]. MSCs can differentiate into a variety of cell types and secrete bioactive molecules that promote tissue repair and modulate inflammatory responses [8]. Among the therapeutic entities secreted by MSCs, exosomes, small extracellular vesicles, have garnered significant attention [7, 11]. These vesicles carry nucleic acids, proteins, and lipids, mediating intercellular communication and facilitating the regenerative processes [12, 13]. Human umbilical cord mesenchymal stem cells (HuMSCs) are particularly appealing due to their abundance, non-invasive collection, and low immunogenicity, making them an ideal source of therapeutic exosomes [1, 14].

Recent studies have elucidated the role of the NLRP3 inflammasome in the pathogenesis of various inflammatory and degenerative diseases, including POF [15, 16]. The NLRP3 inflammasome, a multiprotein complex, plays a critical role in the activation of inflammatory responses and pyroptosis, a form of programmed cell death associated with inflammation [17, 18]. In the context of POF, NLRP3-mediated pyroptosis contributes to follicular atresia and ovarian dysfunction, suggesting that targeting NLRP3 inflammasome activation could be a viable therapeutic strategy.

Against this backdrop, the present study aims to investigate the therapeutic potential of HuMSC-derived exosomes (HuMSCs-Exos) in a CTX-induced POF model. We hypothesize that HuMSCs-Exos can ameliorate CTX-induced ovarian damage by suppressing NLRP3-mediated pyroptosis, thereby restoring ovarian function and fertility. Through a combination of in vivo and in vitro experiments, this study explores the effects of HuMSCs-Exos on ovarian morphology, function, hormonal balance, and the NLRP3 inflammasome pathway. By elucidating the mechanisms underlying the regenerative effects of HuMSCs-Exos, this research contributes to the development of MSC-EV-based therapies for POF and potentially other inflammatory and degenerative reproductive disorders.

Materials and methods

Laboratory animals and POF model establishment

Female C57BL/6J mouse (n = 36, 5 weeks old) were obtained from Shanxi Medical University’s Experimental Animal Center, with all procedures approved by its Medical Ethics Committee and in accordance with National Institutes of Health of China guidelines. Mouse were acclimatized for a week in conditions of 22 ± 2 °C and a 12-hour light/dark cycle, with free access to food and water. Post-acclimatization, mouse weighing 18 ± 2 g were divided into control (n = 9) and POF model groups (n = 27). The POF model was induced using cyclophosphamide (CTX): 50 mg/kg on day one, followed by 8 mg/kg for 14 days, while controls received saline. Post-induction, the POF group was subdivided into POF (n = 9), saline-treated POF (POF + NC, n = 9), and exosome-treated POF (POF + Exosomes, n = 9). MSC-EVs were administered via intraperitoneal injection at a dose of 100 µg in 200 µL PBS per mouse. The injection was performed once every three days for a total of 28 days starting immediately after POF induction.

Euthanasia was performed after 21 days via CO₂ asphyxiation for hormone analysis and ovarian function assessment, including ovarian coefficient and volume calculations, and fertility evaluation through mating trials.

Histology analysis and follicle counting

Ovarian tissues were fixed in 4% paraformaldehyde (PFA) for 24 h, followed by dehydration in an ascending ethanol series and paraffin embedding. Sections of 5 μm thickness were cut using a microtome and every fifth section was stained with Hematoxylin and Eosin (H&E) for examination under light microscopy. Follicles were categorized into primordial, primary, secondary, antral, and atretic based on established criteria [19–23], as follows: primordial follicles were identified as oocytes surrounded by a single layer of flattened squamous granulosa cells; primary follicles were defined as oocytes enclosed by a single layer of cuboidal granulosa cells; secondary follicles contained oocytes surrounded by two or more layers of cuboidal granulosa cells, without an antral cavity; antral follicles were characterized by the presence of a clearly visible antral cavity; atretic follicles were identified by morphological signs of degeneration, including pyknotic granulosa cells, shrunken oocytes, and disrupted follicular structure. To estimate the total follicle count, the number of primordial follicles was counted on every fifth section and multiplied by. This approach was similarly applied for atretic, preantral, and antral follicle counts. The entire process aimed to minimize observer bias and ensure accurate assessment of ovarian morphology and follicular status.

Estrous cycle characterization

Vaginal smears from mice were collected daily over 10 days, stained with alkaline methylene blue, and examined under a light microscope to distinguish the estrous cycle stages: proestrus, estrus, metestrus, and diestrus, based on cell types [24]. The cycle’s phases were identified by the presence of nucleated epithelial cells, keratinized cells, and leukocytes in varying proportions. Trypan Blue staining of vaginal secretions was used for daily detection of the cycle phase, particularly identifying diestrus.

MSC-EVs isolation and identification

HuMSCs were cultured in accordance with previously established protocols [11] and ethical guidelines approved by Shanxi Medical University. Briefly, HuMSCs were maintained in a suitable complete medium until they reached 70–80% confluence. Subsequently, the medium was replaced with serum-free medium to promote EV secretion. To isolate MSC-derived EVs, the cell culture supernatant was subjected to a series of centrifugation steps to remove cellular debris and non-specifically secreted factors. This was followed by ultracentrifugation at 100,000×g to pellet the EVs. The isolated EVs were then characterized for size and concentration using nanoparticle tracking analysis (NTA). Morphological assessment was performed via transmission electron microscopy (TEM), while the presence of EV markers CD81, CD63, and HSP70 was confirmed by Western blotting. The final MSC-derived EVs were stored at -80 °C for subsequent analyses.

Enzyme-linked immunosorbent assay (ELISA)

Serum levels of Anti-Müllerian Hormone (AMH), Follicle-Stimulating Hormone (FSH), Estradiol (E2), and Luteinizing Hormone (LH), as well as the concentrations of interleukin-1 beta (IL-1β) and interleukin-18 (IL-18) in cell supernatants, were determined using commercial ELISA kits (Elabscience, Wuhan, China), following the manufacturer’s instructions. Briefly, serum samples were diluted 10-fold and added to 96-well plates pre-coated with corresponding antibodies, followed by a 2-hour incubation period. The optical density (OD) was measured using a microplate reader at a wavelength of 450 nm to determine the hormone concentrations in the serum. The concentrations were then calculated based on standard curves.

TUNEL assay for apoptosis detection

In the study, the TUNEL assay was employed to detect apoptosis in both ovarian tissue sections and cultured granulosa cells. The procedure for ovarian tissue involved deparaffinization, rehydration, and permeabilization using 50 µg/ml Proteinase K for 30 min, followed by incubation with the TUNEL reaction mixture for 2 h in the dark. The sections were then washed, stained with DAPI for 5 min to label all nuclei, and mounted with an anti-fade medium for fluorescence microscopy analysis using specific filters for DAPI and FITC. For cultured granulosa cells, the preparation included washing with PBS, fixation with 4% paraformaldehyde for 15 min, and permeabilization with 0.5% Triton X-100 for 5 min. Similar to tissue staining, cells were treated with the TUNEL mixture for 1.5 h at 37 °C in a humidified chamber, followed by DAPI staining and mounting. Fluorescence microscopy enabled the identification and quantification of apoptotic cells (TUNEL-positive, green or red) in contrast to all nuclei (DAPI-stained, blue), providing insights into the extent of apoptosis in the context of ovarian function and granulosa cell viability.

Ovarian tissue immunofluorescence

Ovarian tissues were collected and fixed in 4% paraformaldehyde (PFA) for formalin fixation, followed by dehydration in 30% sucrose at 4 °C. The tissues were then sectioned into 20 μm slices. To block non-specific binding, sections were incubated with 5% bovine serum albumin (BSA) at room temperature (20–25℃) for 1 h. Subsequently, the sections were incubated with primary antibodies: DDX4 (51042-1-AP, 1:2000; Proteintech) and PCNA (AF0239, 1:2000; Affinity) to target specific proteins of interest. After primary antibody incubation, the sections were exposed to a FITC-conjugated secondary antibody (ab150077, 1:100; Abcam) for visualization. Nuclei were stained with DAPI to highlight cellular nuclei. Finally, the sections were sealed with an anti-fade solution and observed and analyzed using a confocal system (Nikon) to examine the localization and expression of the targeted proteins within the ovarian tissue.

Western blot analysis

For Western blot analysis, proteins were extracted from ovarian tissues, granulosa cells, and extracellular vesicles using RIPA buffer with inhibitors (KeyGEN BioTECH). Protein levels were measured with the BCA Kit (Sigma-Aldrich, Merck KGaA), and 30 µg of protein were separated on a 10% SDS-PAGE gel and transferred to PVDF membranes (Merck Millipore). Membranes were blocked with 5% BSA for 1 h, then incubated overnight at 4 °C with primary antibodies: NLRP3, Caspase-1, IL-1β, IL-18 (1:1000), GAPDH, β-actin (1:5000) from Abcam; CYP19A1 (1/500, Bioss); AMH (1/1000, ABclonal); FSHR (1/1000, Proteintech); Bcl-2 (1/500), Bax (1/1000) from Affinity. This ensured specific protein detection. After primary antibody incubation, membranes were washed with TBST, incubated with HRP-conjugated secondary antibodies for 1.5 h, and visualized using an ECL kit (Millipore) and Image J software (Bio-Rad). This streamlined protocol allows for accurate protein identification and quantification, providing insights into ovarian biology and disorders.

Fluorescence quantitative PCR

Total RNA was isolated from mouse ovarian tissues and granulosa cells using TRIzol reagent (Termo Fisher), and cDNA was synthesized using the PrimeScript RT reagent Kit (Takara). The expression levels of the genes DDX4, PCNA, IL-1β, IL-18, Caspase-1, and NLRP3 were quantified by fluorescence quantitative PCR (FQ-PCR) employing SYBR Premix Ex Taq (Bao Biological Engineering, Dalian, China) on a CFX-96 Real-Time PCR Detection System (BIO-RAD) (Table 1). PCR conditions included an initial denaturation, followed by 40 cycles of denaturation and annealing/extension, with a final melting curve analysis to ensure specificity. Gene expression was analyzed using the 2^−ΔΔCt method, with results normalized to an internal control and expressed as mean values from triplicate experiments.

Table 1.

Sequences of primers used for fluorescence quantitative PCR in this study

Gene	Primer sequence (forward)	Primer sequence (reverse)
DDX4	GAGAACACATCTACAACTGGTGG	CCTCGCTTGGAAAACCCTCT
PCNA	CCTCGCTTGGAAAACCCTCT	GGTGAACAGGCTCATTCATCTCT
IL-1β	CGAAGACTACAGTTCTGCCATT	GACGTTTCAGAGGTTCTCAGAG
IL-18	GAAGTGATAGCAGTCCCA	AGCTAAAATCAGCAAAGTGTC
NLRP3	ATTACCCGCCCGAGAAAGG	CATGAGTGTGGCTAGATCCAAG
Caspase-1	TGCCCAGAGCACAAGACTTC	TCCTTGTTTCTCTCCACGGC
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA

Cell culture and treatment

The human granulosa cell tumor cell line KGN, obtained from Procell Life Science & Technology (China), was cultured in DMEM/F12 medium (KeyGEN BioTECH, China) supplemented with 10% fetal bovine serum (ExCell Bio, China) and 1% penicillin-streptomycin (New Cell & Molecular Biotech, China). The cells were maintained in a humidified incubator at 37 °C with 5% CO₂. For the treatments, granulosa cells (GCs) were exposed to 500µM cyclophosphamide (CTX) and subsequently divided into four groups: Control, Model, Model + NC, and Model + Exosomes. Following these treatments, GCs were collected for further experimental analyses.

Cell viability assay

Cell viability was assessed using a Cell Counting Kit-8 (CCK-8, APExBIO Technology, USA) following the manufacturer’s protocol. GCs were seeded at 8,000 cells/well in 96-well plates for 24 h. Post 48-hour co-culture with CTX or HuMSCs-Exos, 10% CCK-8 reagent was added, followed by a 2-hour incubation. Optical density (OD) was measured at 450 nm using a microplate reader. The assay was performed in triplicate, and the mean OD from three independent experiments was used to evaluate cell viability under different conditions.

Assessment of oxidative stress

Oxidative stress was assessed by quantifying malondialdehyde (MDA), superoxide dismutase (SOD), lactate dehydrogenase (LDH) and glutathione peroxidase (GSH) using specific assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), following the manufacturer’s protocols. Ovarian tissue homogenates and cell culture supernatants were centrifuged to obtain clear samples for analysis. The absorbance for each marker was measured with a microplate reader at kit-specified wavelengths. Concentrations of MDA and LDH were reported in nM/mg and U/L, while SOD and GSH activities were expressed in U/mg protein and µM/mg protein, respectively.

Statistical analysis

Statistical evaluations of the data were performed utilizing GraphPad Prism 9.0 (GraphPad Software, USA). The results are expressed as mean ± standard error of the mean (SEM). To determine the statistical significance among groups, data were subjected to either one-way analysis of variance (ANOVA), contingent upon the data distribution and homogeneity of variance. Each experimental condition was replicated a minimum of three times to ensure reliability of the findings. A P-value < 0.05 was considered to denote statistical significance.

Results

Characterization of HuMSCs-Exos

To investigate the therapeutic potential of MSC-EVs for POF we isolated MSC-EVs from the supernatant of human umbilical cord mesenchymal stem cells (HuMSCs). Characterization techniques including transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA) with high-sensitivity flow cytometry, and western blot analysis were employed. TEM images showed the MSC-EVs as round, bilayered vesicles (Fig. 1A), with exosomal markers CD81, Hsp70, and CD63 confirmed via western blot (Fig. 1C). NTA revealed a size range of 30–150 nm and a concentration of 2.1 × 10^10 particles/ml (Fig. 1B). This characterization confirms the MSC-EVs’ identity and supports further exploration of their therapeutic effects on POF.

Fig. 1.

Characterization of MSC-EVs Isolated from HuMSCs. (A) TEM images displaying the typical morphology of MSC-EVs as round, bilayered vesicles. Scale bar represents 100 nm. (B) NTA indicating the size distribution of MSC-EVs, with most particles ranging between 30–150 nm in diameter. The concentration of MSC-EVs is shown as 2.1 × 10^10 particles/ml. (C) Western blot analysis confirming the presence of exosomal markers CD81, Hsp70, and CD63 in the MSC-EVs, verifying their exosomal nature. These characterizations affirm the MSC-EVs’ identity and suggest their potential for further investigation in the therapeutic management of POF

HuMSCs-Exos restored ovarian morphology and structure in CTX-induced POF mice

To evaluate the therapeutic effects of HuMSCs-Exos on POF in mice, we meticulously assessed ovarian morphology and structure following the administration of HuMSCs-Exos. The experimental design for animal treatment is illustrated in Fig. 2A. The POF model was established by administering cyclophosphamide (CTX) at a dosage of 50 mg/kg on the first day, followed by 8 mg/kg for the subsequent seven days, whereas the control group received saline. Our findings revealed that compared to the standard model group, treatment with HuMSCs-Exos significantly ameliorated ovarian organ coefficients and ovarian volume (Fig. 2B and C). Histopathological assessments further demonstrated that the POF + Exosomes group exhibited an increase in the total number of follicles, antral follicles, secondary follicles, primary follicles, and primordial follicles, alongside a reduction in the number of atretic follicles, as shown in Figs. 2D and E. These results suggest that HuMSCs-Exos effectively restored ovarian morphology and structure in CTX-induced POF mice. The increase in follicle numbers across various developmental stages indicates a potential reversal of the detrimental effects induced by CTX, highlighting the therapeutic potential of HuMSCs-Exos in the treatment of POF.

Fig. 2.

HuMSCs-Exos restored ovarian morphology and structure in CTX-induced POF mice. (A) Schematic representation of the experimental design for animal treatment. Mice were divided into control, POF model, and POF + Exosomes groups. (B) Ovarian organ coefficients and (C) ovarian volume measurements indicating significant improvement in each group. (D) Representative histological sections of ovaries stained with H&E from each group. Scale bars represent 100 μm. (E) Quantitative analysis of follicles at different developmental stages (primordial, primary, secondary, and antral follicles) and atretic follicles. *P < 0.05; **P < 0.01, n = 9

HuMSCs-Exos restored ovarian function and fertility in CTX-induced POF mice

Subsequently, we evaluated the estrous cycle and hormone levels to further understand the impact of HuMSCs-Exos on the CTX-induced POF mice. The results demonstrated significant improvements in the proestrus and estrus phases of the estrous cycle following HuMSCs-Exos transplantation (Fig. 3A). Additionally, fertility mice, including the number of pregnant mothers and offspring, were assessed, revealing that exosomes significantly enhanced the reproductive capacity of POF mice (Figs. 3B and C). Further analysis of hormone levels showed notable changes in anti-Müllerian hormone (AMH) (Fig. 3D), estradiol (E2) (Fig. 3E), follicle-stimulating hormone (FSH) (Fig. 3F), and luteinizing hormone (LH) (Fig. 3G) in the POF + Exosomes group compared to the POF group. These findings indicate a restoration of hormonal balance critical for ovarian function. To confirm the regulatory effects on GCs, Western blotting was employed to detect the expression levels of functional proteins associated with GCs (FSHR, AMH, CYP19A1, and FOXL2) in the ovaries. The results revealed that the protein expression levels in the POF + Exosomes group were significantly higher than those in the POF group, further substantiating that GCs are a regulatory target of HuMSCs-Exos. This highlights the therapeutic potential of HuMSCs-Exos in treating POF by modulating the ovarian microenvironment and granulosa cell function.

Fig. 3.

HuMSCs-Exos restored ovarian function and fertility in CTX-induced POF mice. (A) Analysis of the estrous cycle phases showing significant improvements in the proestrus and estrus phases in each group. (B) The number of pregnant mice and (C) the total number of offspring in the POF + Exosomes group, indicating enhanced reproductive capacity following HuMSCs-Exos treatment. (D-G) Hormone level assessments in serum: (D) AMH, (E) E2, (F) FSH, and (G) LH, demonstrating a restoration of hormonal balance in the POF + Exosomes group compared to the POF model group. (H) Western blot analysis of GCs functional proteins (FSHR, AMH, CYP19A1, and FOXL2) in ovarian tissues, with significantly higher expression levels observed in the POF + Exosomes group, indicating the regulatory effects of HuMSCs-Exos on GCs function. *P < 0.05; **P < 0.01, n = 9

HuMSCs-Exos enhance ovarian regenerative capacity in CTX-induced POF mice

We investigated the therapeutic potential of HuMSCs-Exos in a mouse model of POF induced by CTX. To assess the extent of cellular apoptosis within the CGs, Tunel assay was employed, with the findings depicted in Figs. 4A and B. Compared to the control group, the POF model mice exhibited a significant elevation in the level of cellular apoptosis, indicating the detrimental impact of CTX treatment on ovarian granulosa cells. However, upon administration of HuMSCs-Exos, a notable reduction in apoptosis levels was observed, suggesting the protective and restorative effects of the exosomes against CTX-induced cellular damage. Further analysis was conducted to evaluate the expression levels of DDX4 (DEAD-box helicase 4) and PCNA (Proliferating Cell Nuclear Antigen) both at the mRNA and protein levels, as indicators of ovarian follicle health and cell proliferation, respectively. Our results demonstrated a significant upregulation in the expression of DDX4 and PCNA in the POF model mice treated with HuMSCs-Exos, as compared to the untreated POF group (Fig. 4C-H). This upsurge in DDX4 and PCNA levels signifies not only a restoration of ovarian function but also an enhancement in the regenerative capacity of the ovarian tissue post-exosome treatment. These findings collectively underscore the potential of HuMSCs-Exos in mitigating CTX-induced apoptosis in CGs and promoting ovarian tissue repair and regeneration, as evidenced by the upregulation of crucial markers DDX4 and PCNA.

Fig. 4.

HuMSCs-Exos enhance ovarian regenerative capacity in CTX-induced POF mice. (A) Representative images of Tunel assay in ovarian sections of each groups. Scale bar represents 100 μm. (B) Quantitative analysis of Tunel-positive cells per section. (C and D) RT-qPCR analysis showing the relative mRNA expression levels of DDX4 and PCNA. (E-H) Immunofluorescence detection and graphical representation for DDX4 and PCNA. *P < 0.05; **P < 0.01, n = 9

HuMSCs-Exos ameliorate CTX-induced POF by alleviating inflammasome-induced pyroptosis

Furthermore, we evaluated the effects of HuMSCs-Exos on inflammatory cytokine expression and inflammasome activation in CTX-induced POF mice. Our findings revealed that treatment with HuMSCs-Exos significantly downregulated the protein expression of inflammatory cytokines IL-1β and IL-18 in the ovarian tissues of the POF model (p < 0.05) (Fig. 5A, D, and E). Compared to the control group, the expression levels of NLRP3, ASC, and caspase-1, which are critical components of the inflammasome pathway, were markedly increased in the ovaries of POF mice. However, in the POF + Exosomes group, the expression of NLRP3 was significantly reduced. Similarly, the expression levels of ASC and caspase-1 were also lower in the POF + Exosomes group (Fig. 5A-C). To further elucidate the potential mechanisms underlying GCs pyroptosis, we assessed the levels of oxidative stress in ovarian tissues. The results indicated significant changes in the levels of MDA, GSH, and SOD activity in the POF + Exosomes group compared to the POF group (Fig. 5F-H). These findings suggest that HuMSCs-Exos can ameliorate CTX-induced POF by alleviating inflammasome-induced pyroptosis, potentially through the downregulation of inflammatory cytokines and the modulation of oxidative stress markers in ovarian tissues.

Fig. 5.

HuMSCs-Exos ameliorate CTX-induced POF by alleviating inflammasome-induced pyroptosis. (A) Western blot analysis of inflammasome components (NLRP3, caspase-1) and inflammatory cytokines (IL-1β, IL-18) in ovarian tissues of each groups. (B-E) Quantitative analysis of the expression levels of NLRP3, IL-1β, IL-18 and caspase-1. (F-H) Assessment of oxidative stress markers in ovarian tissues: (F) MDA levels, (G) GSH content, and (H) SOD activity. *P < 0.05; **P < 0.01, n = 9

HuMSCs-Exos inhibit CTX-induced pyroptosis by inhibiting NLRP3 inflammasome activation in GCs

To explore the effect of HuMSCs-Exos on CTX-induced pyroptosis in GCs, we conducted a series of experiments to assess cell apoptosis, viability, oxidative damage, and the expression of apoptosis-related markers and components of the NLRP3 inflammasome pathway. Tunel assay results demonstrated a significant increase in apoptosis levels in the model group of immortalized human granulosa cells compared to the control group. However, transfection with HuMSCs-Exos led to a notable decrease in apoptosis levels (Figs. 6A and B). The CCK8 assay revealed a significant reduction in cell viability in the model group compared to the control group, which was significantly reversed upon transfection with HuMSCs-Exos, indicating an enhancement in granulosa cell viability (Fig. 6C). Furthermore, oxidative damage was evaluated by measuring levels of GSH, MDA) and LDH. Our findings indicated that HuMSCs-Exos could mitigate oxidative damage in GCs (Figs. 6D-F). Western blot analysis of apoptosis markers showed a significant decrease in Bcl-2 expression and an increase in Bax expression in the model group compared to the normal group, which was ameliorated by HuMSCs-Exos treatment (Figs. 6G-H).

Fig. 6.

HuMSCs-Exos Mitigate CTX induced death in GCs. (A) Representative images of Tunel assay in GCs from each groups, showing apoptotic cells (red fluorescence). Scale bar represents 100 μm. (B) Quantification of Tunel-positive cells, indicating a significant decrease in apoptosis in the Model + Exosomes group compared to the model group. (C) Cell viability assessed by CCK8 assay. (D-F) Oxidative damage markers in GCs: (D) LDH activity, (E) GSH levels, and (F) MDA content. (G-I) The expression levels of Bcl-2 and Bax exhibited significant changes in the Model + Exosomes group, indicating a potential attenuation of apoptosis. *P < 0.05; **P < 0.01, n = 3

In addition, compared to the control group, CTX treatment resulted in elevated levels of IL-1β and IL-18 in the supernatant of GCs (P < 0.05). Treatment with HuMSCs-Exos was able to reduce the levels of IL-1β and IL-18 induced by CTX in GCs (P < 0.05), suggesting an anti-inflammatory effect. To further investigate whether the therapeutic effect of HuMSCs-Exos on POF is associated with the NLRP3/Caspase-1 pathway, we examined the mRNA and protein expression of NLRP3, caspase-1, IL-1β, and IL-18 in GCs. Following CTX treatment, a significant increase in the expression of these markers was observed (P < 0.05). However, treatment with HuMSCs-Exos led to a significant decrease in their levels (P < 0.05), as shown in Figs. 7C-K. These findings suggest that HuMSCs-Exos inhibit CTX-induced pyroptosis in granulosa cells by inhibiting the activation of the NLRP3 inflammasome pathway, thereby ameliorating inflammation and oxidative damage, and enhancing cell viability.

Fig. 7.

HuMSCs-Exos inhibit CTX-induced activation of the NLRP3 inflammasome pathway in GCs. (A-B) ELISA analysis showing the levels of IL-1β and IL-18 in the supernatant of GCs from each group. (C-F) Quantitative RT-qPCR analysis of NLRP3, caspase-1, IL-1β and IL-18 mRNA expression in GCs. (G-K) Western blot analysis and quantification of NLRP3, caspase-1, IL-1β and IL-18 protein levels. *P < 0.05; **P < 0.01, n = 3

Discussion

In light of the global endeavor to counteract declining birth rates, the challenge of infertility, particularly stemming from ovarian aging, remains a formidable obstacle for a significant proportion of women desiring to conceive [25, 26]. The process of ovarian aging, leading to a decrease in reproductive capacity, is not only clinically irreversible with existing pharmacological interventions but also presents a significant health risk to perimenopausal women [7, 27, 28]. This includes an elevated risk of osteoporosis and cardiovascular diseases. The present study elucidates the therapeutic potential of HuMSCs-Exos in ameliorating CTX-induced POF by counteracting NLRP3-mediated pyroptosis, thereby restoring ovarian function and fertility (Fig. 8). Our findings align with the emerging paradigm that MSC-EVs possess regenerative capabilities, which can be harnessed for treating various degenerative diseases, including reproductive disorders such as POF. This not only underscores the intricate interplay between cellular senescence mechanisms and reproductive health but also opens new doors for addressing the pressing issue of infertility linked to ovarian aging.

Fig. 8.

Schematic overview of HuMSCs-Exos therapeutic action in CTX induced POF

In the field of regenerative medicine, the use of exosomes derived from HuMSCs presents a novel approach that addresses the limitations of direct stem cell therapies [29, 30]. Traditional stem cell treatments face challenges such as embolism, immunogenicity, and potential for malignant transformation [31–33]. Exosomes, however, do not express major histocompatibility complex (MHC) class I or II molecules, significantly reducing the risk of immune rejection and enhancing their safety for therapeutic use [34–36]. Exosomes from HuMSCs, sourced from bone marrow, adipose tissue, and amniotic membranes, contain a variety of bioactive molecules capable of promoting tissue regeneration [37–39]. This makes them particularly advantageous for targeting ovarian dysfunction and improving female fertility, without the risks of embolism and malignant transformation associated with cell-based therapies. Their non-cellular nature, coupled with ease of isolation and storage, positions exosomes as a practical and versatile option in regenerative medicine. HuMSC-derived exosomes thus offer a promising strategy for overcoming reproductive challenges by leveraging stem cell regenerative capabilities while minimizing associated risks.

Our in vivo results demonstrated that HuMSCs-Exos treatment significantly improved ovarian structure, enhanced follicle counts, restored estrous cycles, and improved fertility outcomes in a CTX-induced POF mouse model. These findings are particularly noteworthy, as they suggest that HuMSCs-Exos can reverse the detrimental effects of CTX on ovarian function, offering hope for fertility preservation in patients undergoing cytotoxic treatments.

Furthermore, the restoration of hormonal balance and the observed reduction in NLRP3 inflammasome activation and oxidative stress markers underscore the comprehensive therapeutic potential of HuMSCs-Exos in combating ovarian aging. The NLRP3 inflammasome, a critical component of the innate immune system, plays a pivotal role in the pathogenesis of inflammatory diseases by facilitating the production of pro-inflammatory cytokines such as IL-1β and IL-18. In the context of ovarian aging, the activation of the NLRP3 inflammasome contributes to a chronic inflammatory state, exacerbating follicular atresia and diminishing ovarian reserve [40–42].

Concurrently, oxidative stress, characterized by an imbalance between ROS production and antioxidant defense mechanisms, further accelerates ovarian aging through the induction of DNA damage, apoptosis, and lipid peroxidation, thereby impairing oocyte quality and ovarian function. This intricate interplay between anti-inflammatory and antioxidative mechanisms positions HuMSCs-Exos as a potent therapeutic agent against ovarian aging. The ability of HuMSCs-Exos to simultaneously address the inflammatory and oxidative underpinnings of ovarian aging not only elucidates their therapeutic efficacy but also underscores the complexity of ovarian aging as a multifactorial condition. Future investigations into the precise molecular pathways modulated by HuMSCs-Exos will further elucidate their role in rejuvenating ovarian function and potentially extending reproductive lifespan.

The suppression of NLRP3-mediated pyroptosis by HuMSCs-Exos represents a critical mechanism through which these vesicles restore ovarian function and fertility. Pyroptosis, a form of programmed cell death associated with inflammation, has been implicated in various pathological conditions, including POF [18, 43–45]. In our vitro studies on GCs provided additional insights into the cellular and molecular mechanisms underlying the therapeutic effects of HuMSCs-Exos. The promotion of GC viability, alongside the reduction in death and oxidative damage, highlights the protective role of HuMSCs-Exos against CTX-induced cellular stress. Importantly, the inhibition of the NLRP3 inflammasome pathway by HuMSCs-Exos not only prevents cell death but also mitigate the inflammatory milieu that contributes to ovarian dysfunction in POF. This dual action underscores the therapeutic versatility of HuMSCs-Exos and their potential to address the complex pathophysiology of POF.

The findings of this study have significant implications for the development of MSC-EV-based therapies for POF and potentially other inflammatory and degenerative reproductive disorders. Our results demonstrate that MSC-derived exosomes can promote ovarian repair by suppressing NLRP3-mediated pyroptosis in a cyclophosphamide-induced model of POF. This highlights the therapeutic potential of MSC-EVs in restoring ovarian function and suggests a promising avenue for treating POF and similar conditions. However, several challenges and questions remain. The precise molecular mechanisms through which HuMSCs-Exos exert their therapeutic effects need further elucidation. While our study shows improvements in ovarian function, including increased follicle counts, restored hormonal balance, and reduced pyroptotic activity, it is important to note that exosome treatment was administered for only a period of seven days. The observed improvements were evident two weeks after the completion of treatment, suggesting that MSC-derived exosomes may exert short-term, long-lasting effects. However, the sustainability of these benefits over a longer period remains unclear. Given the transient nature of the treatment regimen, we believe that future studies should aim to investigate the long-term effects of exosome therapy. Specifically, it would be essential to assess whether the observed therapeutic benefits are sustained for months or if the positive effects diminish after the exosome treatment ends. Furthermore, it would be valuable to explore whether repeated treatments or maintenance therapies could further enhance and prolong the beneficial outcomes of exosome-based interventions for ovarian repair. We acknowledge that this aspect represents a key limitation of the current study and believe that further research in this area would be a worthwhile pursuit.

In conclusion, our study provides compelling evidence for the therapeutic efficacy of HuMSCs-Exos in counteracting NLRP3-mediated pyroptosis and restoring ovarian function in a CTX-induced POF model. These findings highlight the potential of MSC-EV-based therapies as a novel, promising approach for treating POF and underscore the need for further research to translate these findings into clinical practice.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

POF

Premature ovarian failure

MSCs

Mesenchymal stem cells

Tunel

TdT-mediated dUTP nick-end labeling

HuMSCs

Human umbilical cord mesenchymal stem cell-derived exosomes

NLRP3

NOD-like receptor family, pyrin domain containing 3

ROS

Reactive oxygen species (ROS)

GCs

Granulosa cells

FSH

Follicle-Stimulating Hormone

E2

Estradiol

LH

Luteinizing Hormone

IL-1

Interleukin-1 beta

IL-18

Interleukin-18

Author contributions

Xiangrong Cui and Xuan Jing chose the subject and gave guidance for every step. Xia Huang, Tingting Xue, Huihui Li, Xinyu Zhu, Shu Wang searched the literature and wrote the article. All authors read and approved the final manuscript.

Funding

This study was supported by National Natural Science Foundation of China (grant no. 82000722 and 82000302), Natural Science Foundation of Shanxi (grant no. 201901D211519 and 201901D211546), Research Project Supported by Shanxi Scholarship Council of China (grant no. HGKY2019092), China Postdoctoral Science Foundation (grant no. 2020 M670703), Initial Scientifc Research Fund of PhD in Shanxi Provincial People’s Hospital (grant no. b201635), Fund Program for the Scientific Activities of Selected Returned Overseas Professionals in Shanxi Province (grant no. 20200033 and 20220050), Key Research and Development Projects of Shanxi Province (grant no.188821) and Medical and Technological Innovation Team of Shanxi (grant no.2020TD19).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This review study was based on published work and therefore did not require approved by an institutional committee.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Clinical trial number

Not applicable.