Histone Deacetylase Inhibitors orchestrate epigenetic signalling and alter the nucleoporins and nuclear envelope in cervical cancer

Highlights

• •Histone deacetylases inhibitors (HDACi) enhance the decompaction of chromatin evident through increase in nuclear area and nuclear volume in cervical cancer cells.
• •HDAC inhibitors regulate invasion by altering the expression of nuclear envelope including nucleoporins.
• •Higher expression of NUP58/SETD6 correlates with poor survival in cervical cancer patients.

Abstract

Histone Deacetylases inhibitors (HDACi) modulate the acetylation profile of lysines on the histone tails to facilitate DNA accessibility to transcription factors. While the phenotypes caused by HDAC inhibition on cancer cells have been studied extensively, the nuclear geometry and expression signatures modulated by these enzymes have not been well understood.This work attempts to understand the functional implication of HDAC inhibitor treatment (NaB and MS275) on cervical cancer cells. We observed an increase in nuclear area upon HDAC inhibition correlating with an increase in expression of active histone marks and lamins and a decrease in levels of repressive epigenetic marks. Our transcriptomic sequencing of HeLa cells treated individually with these inhibitors have identified dysregulation of nucleoporins affecting the nucleocytoplasmic exchange and nucleo-cytoplasmic transport through the nuclear pores. These act in concert with the increase in acetylation due to HDAC inhibition and contribute to the increase in nuclear area. In order to derive clinical implications of the observed mechano signalling genes and epigenetic factors differentially expressed in HeLa cells, we verified these on a TCGA cervical cancer cohort of 148 patients and observed an upregulation of various nucleoporins in cervical cancer patients. Interestingly, the low expression of LMNA and high expression of NUP58 were associated with lower survival rate in the cohort. These signatures have also been validated on Indian cervical cancer tissues. This novel and intricate mechanism of modulating epigenetic regulation and nuclear architecture changes by HDAC inhibition can be utilized for designing targetted epigenetic therapy for cervical cancer.

Graphical abstract

Introduction

Covalent modifications on the core histone tails exert dynamic control on gene expression states and are regulated by the epigenetic reader, writer and eraser machinery in cell nuclei [1] Acetylation events on the core histone tails are intricately linked to chromatin states that represent actively transcribed genomic regions or those that are poised for transcription [2,3]. Histone acetylation is dynamic and is regulated by the antagonistic activity of Histone Acetyl Transferases (HATs) and Histone Deacetylases (HDACs) [4,5]. The balanced interplay between the HATs and the HDACs is crucial in disease and development states [6]. Histone deacetylases and their inhibitors have extensively been used to modulate the acetylome and hence regulate disease progression.

In several instances, the functional substrates of HATs and HDACs are modulated at multiple levels by acetylation events. For example, the function of the tumour suppressor p53 is predominantly governed by acetylation which regulates p53 stability, its interaction with DNA and its transcriptional outcome [7]. Inhibitors of Histone Deacetylases show potent anti-cancer activity as evidenced by in-vitro and in-vivo data demonstrating their therapeutic benefits [8]. Though HDAC inhibitors have evolved as promising candidates for epigenetic therapy, their precise targets and mechanisms are yet to be clearly explored and the lack of isoform specificity is a major concern in cancer therapy. Extensive work on structure-based design in the recent years have aided the design of HDAC inhibitors with more substrate specificity [9,10].

Epigenetic therapies targeting histone modification, DNA methylation, and chromatin remodeling have emerged as promising strategies across various cancers. Among them, histone deacetylase inhibitors (HDACi) represent a clinically advanced class of agents with pleiotropic effects on tumor biology. Despite limited efficacy as monotherapy in solid tumors, HDACi have shown potential in combinatorial regimens and immunomodulatory contexts [11,12].

Histone deacetylase inhibitors (HDACi) promote chromatin relaxation and expression of silenced tumor suppressor genes. While they are approved for hematologic malignancies (e.g., cutaneous T-cell lymphoma), their role in solid tumors remains investigational due to limited single-agent efficacy and context-dependent activity. Emerging data suggest that genomic alterations such as ARID1A mutations may predict sensitivity to HDACi. ARID1A-deficient urothelial carcinomas have shown objective responses to pan-HDAC inhibitors, highlighting the need for biomarker-guided trials [13]. Furthermore, a phaseII study of combination therapy with Exemestane and Entinostat (HDACi) in ER+ve breast cancer suggested that increased histone acetylation in peripheral blood mononuclear cells (PBMCs) led to clinical benefits [14].

Experiments over the recent years have established that the 3D genome architecture regulates the shape of the nucleus through binding with the nuclear envelope proteins besides modulating their nuclear geometry. The spatial organization of the 3D genome epigenetically controls gene expression patterns [15,16]. The repositioning of specific genes to the nuclear lamina and the differential chromatin arrangements in normal and cancer cell nuclei imply that a re-organization of higher order structure in cancer nuclei may be mediated by epigenetic enzymes and modifications [[17], [18], [19], [20]]. This is also evidenced by cytological observation of decondensed chromatin in epithelial cells treated with HDAC inhibitors – Trichostatin A and NaB. Advances in microscopy and genomic sequencing have helped understand changes in nuclear geometry and transcriptomic level changes that accompany treatment with epigenetic drugs. Nuclear size is a key feature used in cancer grading, and HDACi-induced changes may influence how pathologists interpret malignancy. Histone deacetylases (HDACs) play a pivotal role in maintaining chromatin structure and nuclear morphology. Inhibitors of HDACs, have been shown to induce significant nuclear enlargement in cancer cells. Various studies suggest that nuclear enlargement is associated with increased susceptibility to apoptosis or senescence following HDACi exposure [21], furthermore enhanced apoptotic sensitivity in solid tumor models exhibiting nuclear enlargement post-HDACi exposure, supporting a link between nuclear morphology and therapeutic response [22]. However, specific molecular level alterations that impinge on nuclear size and irregularities on nuclear membrane that lead to alterations in chromatin organization, nuclear architecture and altered functions in tumour nuclei during oncogenesis and progression have not been explored in detail.

This work attempts to understand the functional influence of two structurally diverse HDAC inhibitors NaB and MS-275 in modulating nuclear geometry and epigenetic landscape of cervical cancer cells (HeLa). We have also profiled the transcriptome of these cells after individual treatment for 48 h and have assayed their influence on the expression pattern of genes involved in nuclear architecture, epigenetic factors and mechanosignalling. We observed that structurally diverse HDAC inhibition increases the area of cervical cancer nuclei while maintaining their overall morphology. An increase in the levels of active histone marks H3K4me3 and H4 acetylation was observed along with increase in the levels of nuclear envelope proteins Lamin A. Transcriptomic analysis reveals that HDAC inhibition differentially modulates the transcriptomic expression of inner and outer nuclear membrane NET37, SUN1, LAP1 and LAP2 implying a signalling mechanism coordinating histone deacetylation and mechano signalling events. Interestingly, we observed that HDAC inhibition is accompanied by downregulation of most of the nuclear porins including NUP155, NUP158, NUP88, NUP58, etc. most of which are associated with increased invasion and metastasis in cervical cancer.

We have attempted to validate our observations on HeLa cells on a cervical cancer cohort of 148 patients (TCGA-CESC). We find that cervical patients who expressed high levels of NUP58/SETD6 and low levels of Lamin A are associated with poor survival. These have also been validated in Indian cervical tumours. The newer layers of finding from this work can be exploited to design epigenetic therapy based on the expression profile of nuclear components in cervical cancer.

Materials and methods

Cell culture

Cervical cancer cells (HeLa) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (#12,500,062 Invitrogen-Gibco) supplemented with 5 % Fetal Bovine Serum (FBS) (#16,000,044 Invitrogen Gibco) and 1 % Penicillin/Streptomycin (#1507,070,063 Invitrogen-Gibco) and were maintained at 37 °C in a 5 % CO₂ incubator. The experiments were set up with HeLa cells plated at a density of 0.05 million cells/ml on 35 mm petri dishes (Nunc- GmbH Wiesbaden, Germany). The cells were incubated overnight for adherence.

Treatment with HDAC inhibitors

HDAC inhibitors Sodium Butyrate (NaB) [(Sigma Aldrich Co., USA; CAS. No 156–54–7; B5887)] and MS-275 (Cayman Chemical Co., USA; CAS. No 209783–80–2; 13284) were reconstituted in distilled water and ethyl alcohol respectively as per manufacturer’s instructions. Final concentrations were made using DMEM. NaB was administered in milli molar concentrations (1 mM and 3 mM) while MS-275 was used in concentrations of 5 nM and 10 nM. The drug treated plates along with the relevant non-treated controls were taken for further experimentation after 48 h of treatment.

Transfection

HeLa cells stably expressing histone H2B-EGFP and those exogenously expressing histone H3-EGFP were used for probing alterations in the nuclear area of HeLa cells. For probing epigenetic modifications, HeLa cells overexpressing H3-EGFP were used. (HeLa H2B-EGFP was a kind gift from Shivashankar lab earlier at NUS, Singapore.

Immunostaining

HeLa cells transiently transfected with H3-EGFP treated with NaB or MS-275 for 48 h were fixed with 4 % paraformaldehyde for 20 min at room temperature. The cells were permeabilized with 0.3 % Triton X-100 for 10 min and were blocked with the blocking buffer (5 % Goat serum in PBS) for 1 hour at room temperature. Primary antibodies at appropriate dilutions (Bovine Serum Albumin with 0.3 % Triton X-100 in PBS) were added to the cells and the plates were kept at overnight incubation at 4 °C. The antibody against H3K4me3 was used at the dilution of 1:400 and the antibodies against H3K9me3, H3K27me3, H4ac, HP1α, Lamin A were used at dilutions of 1:100 and 1:1600, 1:500, 1:200, 1:100 respectively (All the epigenetic antibodies were purchased from Cell Signalling Technologies, Danvers, USA). The medium containing the primary antibody was then removed and secondary antibodies tagged to Alexa Fluor 647 at a dilution of 1:1000 were added to the plates and incubated for 1 hour at room temperature. The cells were then washed with PBS and made ready for imaging the epigenetic marks.

Imaging epigenetic marks

HeLa cells exogenously expressing H3-EGFP were immunostained for epigenetic marks and were imaged using the Olympus FV-1000 Laser Scanning Confocal Microscope under the 60X oil immersion objective (NA: 1.4). Imaging of H3-EGFP was done using Multi Argon Ion Laser (488 nm). Epigenetic marks and Lamin A (stained with Alexa Fluor-647) were imaged using the Helium-Neon Laser (635 nm). 60 images (Z sections) of HeLa cell nuclei were obtained from each plate and the Total Fluorescence Intensity of epigenetic marks was calculated using an in-house program developed for the same.

Calculation of nuclear parameters and geometry

60 images of Hela cell nuclei were obtained from each plate and the mean area, nuclear contour index, total fluorescence intensity of the epigenetic marks were calculated using an in-house program developed for the same.

Trans well migration assay

Trans well migration assays were performed using 24-well plates with an 8-μm pore membrane (# 354,578 Corning). 2 × 10⁵ control and HDACi (Both NaB and MS275) treated HeLa cells were seeded on Matrigel (1:1 ratio) (#354,234 Corning) in serum free DMEM-F12 media and coated on upper Boyden chambers (24-well inserts; pore size 8um) (# 354,578 Corning). The bottom chamber was filled with complete media supplemented with 10 % FBS, which acted as a chemo attractant to stimulate invasion. The plates were incubated for 24 h in the incubator. After incubation, cells that had migrated to the lower surface of the filter membrane were fixed using prechilled methanol at room temperature. Matrigel was removed and the membrane with invaded cells was stained with 0.2 % crystal violet solution (#TC510–25 G Hi-Media) for 10 min. Cells remaining on the upper surface of the filter membrane were gently scraped off with a cotton swab. The number of invaded cells was counted in five representative fields of the membrane under a light microscope (10X objective). Cell migration was quantified using ImageJ software.

Clinical samples

Five tumours and adjacent normal tissues from cervical cancer patients were obtained from the tissue repository at Rajiv Gandhi Cancer Institute and Research Centre, New Delhi. Formalin fixed parafilm embedded curls (4 µm, 8–10 curls with high tumour purity) were used for RNA isolation. The approval of the Institutional Ethics Committee was obtained before starting the work (Institutional Ethics Committee (IEC) number IBABIEC-06/PR01/08082024.

RNA-Extraction from HeLa cells

HeLa cells after treatment with HDAC inhibitors were lysed with 500 µl of RNA iso reagent (#9108 Takara). 1/5th volume of chloroform was added to samples, briefly vortexed and centrifuged at 12 K rpm for 12 mins at 4 degrees. The aqueous phase was carefully collected and transferred to fresh tubes. 0.7 vol of isopropanol were added to samples and incubated at room temperature for 10 mins to precipitate the RNA. The samples were centrifuged at 12 K rpm for 12 minutes; supernatant was discarded without disturbing the pellet. The pellet obtained was washed with 80 % ethanol and was allowed to dry for 20 mins before dissolving in DEPC treated water. 500 ng of RNA was used for library preparation. RIN Values for all the samples were calculated and found to be above 9.

RNA isolation from patient tissues

The tumor portion of five shaved cuts (4 µm) from each selected block was deparaffinized (∼20 min) and digested with protease (30 min). RNA was then isolated using 500μl of TRIzol reagent (RNA iso) (#9108 Takara). 1/5th volume of chloroform was added to each sample for phase separation. The aqueous phase was carefully transferred to fresh tubes and equal volume of isopropyl alcohol was used for precipitation. The samples were centrifuged at 12,000 rpm for 10 min at 4 °C. The pellets obtained were washed with 80 % ethanol to remove contaminants and impurities and The RNA obtained was quantified using Nanodrop spectrophotometer. The final volume of extracted RNA was 40 µL. RNA concentration and purity were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA).

cDNA synthesis and qRT-PCR analysis

The RNA concentration was determined using a NanoDrop 2000 (Thermo Fisher Scientific, USA). For gene expression analysis, 5ug of total extracted RNA from cell lines, while 2ug of total RNA from patient tissues were used to generate cDNA. RNA obtained was treated with DNase (NEB- M0303S) to remove the traces of contaminating DNA. cDNA synthesis was performed using random hexamer primers (NEB #S1330S) and M-MuLV Reverse Transcriptase (NEB M0253S) as per manufacturer instructions. Real-time-PCR analysis was performed using Universal SYBR master mix (CST # 88989S) on the Applied Biosystems StepOnePlus Real-Time PCR System with the following conditions: 3 min at 95 °C Denaturation, Annealing and Extension (15 s at 95 °C, 1 min 60 °C) for 40 cycles followed by melt curve (15 s 95 °C,1 min 60 °C, 15 s 95 °C). Relative gene expression was calculated using the 2^−△△Ct method after normalizing C_t-values to those of the housekeeping gene GAPDH. All primers used in the study are listed in Supplementary Table S1.

Library preparation and RNA sequencing

RNA-seq libraries were prepared with Illumina-compatible NEBNext® Ultra™ II Directional RNA Library Prep Kit (New England BioLabs). 500 ng of total RNA was taken for mRNA isolation, fragmentation and priming. The fragmented and primed mRNA was further subjected to first strand synthesis followed by second strand synthesis. The double stranded cDNA was purified using NEBNext sample purification beads. Purified cDNA was subjected to end-repair and adenylation and was ligated to Illumina adapters as per NEBNext® UltraTM II Directional RNA Library Prep protocol followed by second strand excision using USER enzyme at 37 °C for 15mins.

Illumina Universal Adapters used in the study were:

5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′

5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTCGTATGCCGTCTTCTGCTTG-3′.

Adapter ligated cDNA was purified using NEBNext beads and was subjected to 11 cycles for indexing-(98 °C for 30 s, cycling (98 °C for 10 s, 65 °C for 75 s) and 65 °C for 5 min) and enrich the adapter-ligated fragments. Final PCR products (sequencing library) were purified with NEBNext beads, followed by library quality control check. Illumina-compatible sequencing library were quantified by Qubit fluorometer (Thermo Fisher Scientific, MA, USA) and fragment size distribution was analyzed on Agilent 2200 TapeStation. The libraries were sequenced on Illumina Next Seq platform to generate 40–50 million paired end reads/sample with 150 bp read length.

RNA-Seq data processing and analysis

Reads from the paired end RNA sequencing reads were mapped to GRCh38/hg38 reference genome using STAR (v2.5.3a) aligner [23]. To perform differential expression analysis, raw read counts matrix was estimated by HTseq count [24]. Differential expression analysis was carried out using R/Bioconductor package DESeq2 (v1.22.1) [25]. Genes with FDR <0.05 and absolute fold change more than |0.5| were considered as differentially expressed genes. Heat maps were generated using log of FPKM values with pheatmap (v1.0.10) R package. GSEAPreRanked Analysis was done using GSEA Software [26].

Determination of agonistic and antagonistic relationships

Raw counts of the expression of genes were obtained using HTseq-count from RNA sequencing data and were normalized using the ‘R’ package. To explore the potential agonistic and antagonistic relationships between differentially expressed genes involved in nuclear architecture, Epigenetic Factors and mechanosignalling, pairwise Spearman correlation analysis was conducted using the corr function in R. To visualize the agonistic and antagonistic relationships between nuclear architecture, mechanosignalling and epigenetic factors, correlation heatmaps were constructed in R using corrplot function.

Analysis of gene expression from TCGA and GTEx cervical cancer cohorts

mRNA expression profiles of normal cervical tissues were obtained from the Cancer Genome Atlas (TCGA) database(N = 3) and the Genotype Tissue Expression Project (GTEx) database (n = 16). The raw expression counts of protein-coding genes for cervical cancer patients as well as solid tissue normal samples were obtained from the GDC portal using TCGAbiolinks(http://tcga—data.nci.nih.gov/tcga). Tumor population with purity ratio >0.6 was filtered using TCGA tumor_purity. Outliers were removed after PCA clustering. The raw count matrix for normal and tumour cervical tissue was subjected to differential expression analysis using Deseq2 (v1.22.1) [25]. PCA was done in R using ggplot2 package.

Survival analysis for TCGA CESC patients

To investigate the clinical significance of the differentially expressed genes upon HDAC inhibition, survival analysis was performed on the TCGA-CESC (The Cancer Genome Atlas - Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma) cohort [27] for 148 cervical cancer patients. The Kaplan-Meier curves were generated using GEPIA2 [28] to screen the hazard ratio of genes which were selected with p-value≤0.1 and the “median” as the group cutoff.

Results

Structurally diverse HDAC inhibitors (NaB) and (MS-275) induce dose dependent alterations in nuclear size while maintaining the nuclear contour

To understand how pharmacological intervention through two structurally diverse HDACi alter nuclear architecture, Sodium Butyrate (NaB) and Entinostat (MS-275) were chosen for investigating the probable changes they might induce in nuclear morphology in HeLa cells after a 48 h treatment. HeLa cells stably expressing core histone H2BEGFP were treated with sub apoptotic concentrations of NaB (1 mM and 3 mM) for 48 h and the nuclear area, nuclear volume and contour ratio were calculated from the 3D images of the treated cells. We observed a relative increase of 35.52 % and 55.45 % in nuclear area after treatment with 1 mM and 3 mM NaB respectively for 48 h (Figs.1A, B and S1A). Trichostatin A and NaB have been reported to cause reversible nuclear area increase in human small cell lung carcinoma cells (A549) [29] which correlates with our observation. We also observed a significant increase in nuclear volume after treatment with 1 mM and 3 mM NaB respectively for 48 h (Fig. 1B). These observations suggest an overall decompaction of nucleus upon sodium butyrate treatment.

Fig. 1.

Structurally diverse HDAC inhibitors alter the nuclear architecture of cervical cancer cells A. 3D Images (confocal) of HeLa cell nuclei treated with HDAC inhibitor NaB(1mM and 3mM). Panel 1 represents HeLa cells expressing core histone H2B-EGFP and Panel 2 represents HeLa cells expressing core histone H3-EGFP. B. NaB treatment increases the nuclear area and nuclear volume. Boxplot representing significant increase in mean area (left) and volume of HeLa cell nuclei expressing core histone H3-EGFP treated individually with 1mM and 3mM of NaB. p > 0.05 is non-significant. * for p < 0.05, ** for p < 0.01, *** for p < 0.001, and **** for p < 0.0001 based on two-sided student’s t-testC. 3D Images (confocal) of HeLa cell nuclei treated with MS-275 (5nM and 10nM). Panel 1 represents HeLa cells expressing core histone H2B-EGFP and Panel 2 represents HeLa cells expressing core histone H3-EGFP. D. MS-275 treatment increases the nuclear area and nuclear volume. Boxplot representing significant increase in mean area (left) and volume of HeLa cell nuclei expressing core histone H3-EGFP treated individually with 5nM and 10nM of MS-275 p > 0.05 is non-significant. * for p < 0.05, ** for p < 0.01, *** for p < 0.001, and **** for p < 0.0001 based on two-sided student’s t-testE. NaB does not alter the nuclear contour of HeLa cells expressing H2B-EGFP or core histone H3-EGFP. (N=60 nuclei, n=3). F. MS-275 does not alter nuclear contour in HeLa cells expressing H2B-EGFP or core histone H3-EGFP. (N=60 nuclei, n=3).

Overexpression of H3-EGFP in HeLa cells followed by NaB treatment for 48 h also increased the nuclear area to 23.80 % (1 mM) and 58.02 % (3 mM) respectively (Fig. 1A, and FigS1A). MS-275 treatment also showed relative increase of 45.31 % in nuclear area of HeLa cells stably expressing H2B-EGFP when used at a concentration of 5 nM while in HeLa cells transiently expressing H3-EGFP, the same drug showed a relative increase of 36.5 % with 5 nM and 83.56 % with 10 nM of (MS-275) suggesting a dose dependent increase in nuclear area on HDAC inhibition (Figs.1C, D and S1B). Similar significant increase in nuclear volume was observed upon MS-275 treatment in HeLa cells (Fig. 1D).

The experiments thus established that structurally diverse HDAC inhibitors show a convergent function of increasing nuclear area and nuclear volume. The observed increase in area may be attributed to the decondensation of chromatin caused by enhanced acetylation status of NaB/ MS-275 in HeLa cells. NaB has been shown to hinder interphase chromatin compaction in HeLa cells by enhancing histone hyperacetylation [30]. Though NaB and MS-275 were found to increase the nuclear area in HeLa cells, these inhibitors did not alter nuclear contour in HeLa cells under the same conditions as demonstrated in Fig. 1E and F

NaB treatment enhances the levels of lamin A as well as specific epigenetic marks

Epigenetic modifications on the core and linker histones are intricately linked to oncogenesis and cancer progression. It is hence expected that HDAC inhibitors not only alter the key acetylation profiles but also regulate the expression levels of methylation marks on the core histones. Though the inhibition of Histone Deacetylases (HDACs) has been shown to globally alter the nuclear architecture, it is very clear that HDAC inhibitors influence the transcription and epigenetic profile of a subset of genes [31].

In order to understand the alterations in epigenetic modifications of the histones and on nuclear lamins upon HDAC inhibition, HeLa cells transiently expressing H3-EGFP and treated with NaB for 48 h were assayed for different epigenetic marks using immunofluorescence. NaB treated cells showed a significant increase in the levels of active marks H3K4me3 and total H4ac in 48 h as compared to the untreated cells. The active epigenetic mark H3K4me3 and H4 acetylation showed an increase appearing on the periphery of the nucleus as represented in Fig 2A. The relative increase in H3K4me3 and H4ac respectively upon NaB treated cells compared to untreated ones is shown in Figure (Fig. 2A and B). Human dermal fibroblast cells treated with TSA, a well-known pan HDACi increased the interaction between HDAC2-LaminA/C, suggesting that the catalytically inactive conformation of HDAC2 has a higher affinity for lamin A/C [32]. This interaction of HDAC with lamins might lead to an elevation in the level of lamin A/C which correlates with our observation upon NaB treatment. Lamins also promote epigenetic changes during ageing through functional interactions with Sirtuins [33].

Fig. 2.

Structurally diverse HDAC inhibitors alter the epigenetic modifications in HeLa cells. A. Images of live HeLa cells expressing H3-EGFP and changes in epigenetic modifications on treatment with NaB. Panel 1, 3 and 4 depict increase in the levels of H3K4me3, H3K27me3, H4acetylation and levels of Lamin A upon NaB treatment and are localised to the nuclear periphery. All epigenetic marks(histones), laminA and HP1α are stained with Alexa Flour 647(red)B. Total Fluorescence Intensity (3D) showing expression levels of various epigenetic marks and lamin A on NaB treatment in HeLa cells expressing H3-EGFP (N=60 nuclei,n=1) (Paired t-test was performed for the statistical analysis, pvalue>0.05, ns; p value<=0.05,*; p value<=0.01,**; p value<=0.001,***).C. Images of live HeLa cells expressing H3-EGFP showing changes in epigenetic profiles on treatment with MS-275. N=60, n=1. Unlike NaB, MS-275 shows spreading of H3K4me3 all over the nuclei (Panel 1) while decreasing the levels of H3K27me3 (Panel 3). All epigenetic marks(histones), laminA and HP1α are stained with Alexa Flour 647(red)D. Total Fluorescence Intensity (3D) showing expression levels of various epigenetic marks and lamin A on MS-275 treatment in HeLa cells transiently expressing H3- EGFP (N=60 nuclei, n=1) (Paired t-test was performed for the statistical analysis, pvalue>0.05, ns; p value<=0.05,*; p value<=0.01,**; p value<=0.001,***).

MS-275 treatment enhances the levels of active epigenetic marks and Lamin A

As observed with NaB treatment, MS-275 also showed enhancement in the levels of the active epigenetic mark H3K4me3. However, unlike NaB, the active mark was located more in the periphery as well as the nuclear interior (Fig. 2C and D). Total levels of H4ac also increased predominantly near nuclear periphery upon MS-275 treatment like NaB (Fig. 2B and D). Increase in H3K4me3 levels has also been reported in rat cortical neurons and astrocytes upon treatment of different HDACi including MS-275 [34]. Global increase in H4 acetylation levels was also observed in SAHA and MS-275 treated normal diploid fibroblasts and transformed human cells [35]. MS-275 treatment has also been seen to enhance the levels of lamin A similar to NaB treatment in HeLa cells (Fig. 2C).

NaB differentially regulates repressive histone marks in cervical cancer cells

NaB induced a reduction in the levels of repressive silencing mark H3K9me3 (Fig. 2A and C). Pharmacological intervention with NaB resulted in an increase in the levels of H3K27me3 which was found to be clustered peripheral to the cell nucleus (Fig. 2A and C). Lamin A expression also showed significant increase near the nuclear periphery upon NaB treatment (Fig. 2A and C).

H3K9me3 is a repressive mark and leads to propagation of heterochromatin through heterochromatin protein 1 alpha (HP1α) [36]. Similar effect has been reported in LNCaP cells after treatment with diverse HDACi, AR-42 and MS-275 [37]. In our experiments, quantitative analysis of the levels of HP1α revealed a relative decrease in HP1α levels compared to untreated cells (Fig. 2C). This is validated by earlier reports where decrease in HP1α levels was seen in A549 and HT29 cells after Trichostatin(TSA) and NaB treatment [29]. Recent work on C57BL/6 J mice treated with Panobinostat (PB) showed an increase in histone H3K9Ac, H4Ac and H3K4me3 marks, while the level of the silencing H3K9me3 mark decreased which correlates with our observation of decreased levels of H3K9me3 upon NaB treatment [38]. H3K27me3 is a gene repressive mark. This mark catalysed and maintained by Polycomb group proteins (PcG) proteins is associated with silencing [39,40]. NaB enhanced the levels of transcription permissive epigenetic marks like H3K4me3, H4ac but showed differential function by reducing H3K9me3 and enhancing H3K27me3 levels.

MS-275 decreases the levels of repressive epigenetic marks

MS-275 treatment decreased the levels of both repressive marks (H3K9me3 and H3K27me3), the decrease being higher in H3K9me3. H3K27me3 was confined to the periphery in MS-275 treated cells (Fig. 2C and D). These observations suggest enhanced chromatin decompaction as evidenced by the increase in the levels of H3K4me3 and H4ac and decrease in H3K9me3 and HP1α which promote increase in nuclear area and volume.

Pharmaco-transcriptomic profiling upon HDAC inhibition reveals alterations in nuclear mechanosignalling and lamin networks

In order to probe the transient expression and dynamics of gene regulation networks triggered by HDAC inhibition and to assay their probable impact on key nuclear components, lamin and chromatin, we performed individual transcriptomic profiling of HeLa cells treated with structurally diverse HDAC inhibitors NaB and MS-275 for 48 h separately. Differential RNA expression analysis upon HDACi treatment resulted in the identification of 4334 and 8431 significant differentially expressed genes (Log2 fold change of |0.5|, p value< 0.05) after NaB and MS-275 treatment respectively. Out of the total 4334 differentially expressed genes upon NaB treatment, 1905 were upregulated while 2429 were downregulated. Out of the 8431 differentially expressed genes upon MS-275 treatment, 4026 were upregulated while 4368 were downregulated (Fig. 3A and B). We also observed 989 upregulated genes and 1327 downregulated genes common to both HDACi treatments (Fig S1C and S1D). preRanked Gene Set Enrichment Analysis (GSEA) of differentially expressed genes under both the conditions showed different enrichment score profile of hallmark gene sets. Treatment upon NaB revealed significant negative enrichment score for MYC and E2F (Fig. 3C) targets while MS-275 showed significant downregulation of genes associated with EMT and Interferon alpha response (Fig. 3D and Fig S1F) pathways suggesting that structurally diverse HDAC inhibitors function regulate different functional pathways such as MYC and EMT pathways respectively. We also observe a positive enrichment score for apical junction and apical surface pathways (Fig. 3C, D and Fig S1E and Fig S1F) upon both NaB and MS-275 treatment.

Fig. 3.

Pharmaco transcriptomic profiling of HeLa cells upon individual treatment with NaB and MS-275 for 48 hours. Differential regulation of gene expression upon NaB and MS-275 treatment in cervical cancer cells. A. Volcano plot representing differential gene expression profile of Hela cells on treatment with NaB (p <0.05 and logFC|0.5|) B. Volcano plot representing differential gene expression of Hela cells on treatment with MS-275 (p <0.05 and logFC|0.5|)C. pre-Ranked Gene Set Enrichment analysis (GSEA) of differentially expressed genes after treatment with NaB for 48 h. In each panel, the enrichment score (ES) along the data set is shown on the X axis. Each vertical bar represents a gene. The normalized enrichment score (NES) and the p-value are indicated in the insert. Positive enrichment score of Apical junctions and negative enrichment score of MYC and E2F targets were observed upon NaB treatment.D. pre-Ranked Gene Set Enrichment analysis (GSEA) of differentially expressed genes after MS-275 treatment for 48 h. In each panel, the enrichment score (ES) along the data set is shown on the X axis of the graphic. Each vertical bar represents a gene. The normalized enrichment score (NES) and the p-value are indicated in the insert. Positive enrichment score of Apical junctions and negative enrichment score of epithelial to mesenchymal transition was observed upon MS-275 treatment.E. Alteration in the expression profile of E2F targets (ATAD2 and TOP2A) and MYC target CBX3 upon NaB treatment for 48h. qRT-PCR analysis was performed to evaluate the expression profile of ATAD2, TOP2A and CBX3. Decrease in relative expression of ATAD2 and TOP2A and CBX3 was observed upon NaB treatment as compared to untreated cells. RT-qPCR data analysis was based on 2-∆∆CT and GAPDH was used as housekeeping gene for RT-qPCR data normalization. Results depict mean ± SD .

HDAC inhibition has been shown to directly or indirectly repress MYC and E2F targets across cancers [41,42]. Furthermore, Chromatin immunoprecipitation (ChIP) and RNA based study in primary tumours have revealed that inhibition by HDACi directly targets transactivating and transrepressing functions of MYC's [43]. Recent work using novel thiazole based HDAC inhibition (HR488B) has shown that these inhibitors suppress the growth of colorectal cancer cells mostly by inducing G0/G1 arrest and downregulating E2F1 [41]. This correlates with our observation where we observe the downregulation of various E2F targets including ATAD2 and TOP2A (Fig. 3E) upon NaB treatment. The downregulation of ATAD2 a well-studied oncogene in cervical cancer serves as a prognostic marker and therapeutic target for cervical cancer [44] suggests the role of HDAC inhibition in suppressing the expression of such oncogenes. We observed a significant downregulation of genes involved in E2F and MYC targets as depicted in figures (Fig. 3E, and Fig S2A and Fig S2B).

HDAC inhibition induces alteration in expression of genes involved in nuclear architecture

Tumour cells are often characterised by altered nuclear morphology, expression and redistribution of nuclear envelope proteins - lamins, SUN proteins and nesprins [45,46]. Gleason grading patterns 3–5 of prostate cancer tissues have shown significant alterations in nuclear morphology, predictive of recurrence and metastasis in these patients. Variations in nuclear structure aided by chromatin reorganisation have also been correlated to drug resistance in prostate cancer [47].

In order to understand if HDAC inhibition influences the genes involved in nuclear architecture, we investigated the expression signatures of the nuclear lamins, inner nuclear membrane (INM) and outer nuclear membrane (ONM) after HDAC inhibition. In the differential expression analysis between the cervical cancer cells treated with HDAC inhibitors as compared to untreated cells, we observed a higher expression of lamins (LMNA and LMNB2) in both NaB and MS-275 treated HeLa cells suggesting that HDAC inhibition influences the expression of lamins irrespective of its subtypes as represented in Fig. 4A. Loss of lamin A/C during adipogenic differentiation of mesenchymal stem cells (MSCs) correspond to increase in both the heterochromatin H3K27me3 and H4K20me3 and the euchromatin histone marks H4K8ac and H3K9ac [48]. These suggest that global hyperacetylation of histones correlates with increase in nuclear lamin expression.

Fig. 4.

Differential regulation of nuclear envelope proteins and epigenetic factors upon NaB and MS-275 treatment in cervical cancer cells. A. Heat Map representing differential expression of genes on the nuclear envelope, Inner nuclear membrane (INM), Lamins, Nuclear Pore and Outer Nuclear Membrane (ONM) after NaB treatment for 48h in cervical cancer cells B.B. Heat Map representing differential expression of genes on the nuclear envelope, inner nuclear membrane (INM), Lamins, Nuclear Pore and Outer Nuclear Membrane (ONM) after MS-275 treatment for 48h in cervical cancer cells. C. Alterations in the expression profile of Lamin A, NUPs (NUP58, NUP155), epigenetic factors (CBX3, SuV39H1 and SETD6) upon NaB treatment for 48h in Hela cells. qRT-PCR analysis was performed to evaluate the expression profile of LMNA, NUP58, NUP155, CBX3, SuV39H1 and SETD6 upon NaB treatment in Hela cells. Graphs show an increase in relative expression of Lamin A and a decrease in expression profiles of NUPs, (NUP58 and NUP155), suggesting an antagonistic relationship between NUPs and Lamin A upon NaB treatment. We also observed a decrease in expression profile of CBX3 and SETD6 upon NaB treatment as compared to control. RT-qPCR data analysis was based on 2-∆∆CT and GAPDH was used as housekeeping gene for RT-qPCR data normalization. Results show mean ± SD D. Alteration in the expression profile of Lamin A, NUPs (NUP58, NUP155) and epigenetic factors (CBX3, SuV39H1 and SETD6) upon MS-275 treatment for 48h in Hela cells. qRT-PCR analysis was performed to evaluate the expression profile of LMNA, NUP58, NUP155, CBX3, SuV39H1 and SETD6 upon MS-275 treatment in Hela cells. Graphs show an increase in relative expression of Lamin A and a decrease in expression profiles of NUP155 suggesting an antagonistic relationship between NUP155 and Lamin A upon MS-275 treatment. We also observed a decrease in expression profile of CBX3 and SETD6 upon MS-275 treatment as compared to control. RT-qPCR data analysis was based on 2-∆∆CT and GAPDH was used as housekeeping gene for RT-qPCR data normalization. Results show mean ± SD.E. Transwell migration assay on HeLa cells upon 3mM NaB and 10nM MS275 treatment. A significant decrease in invasive ability is observed upon individual inhibition by the two HDACs. F. Quantification of relative number of invaded cells. We observe a significant decrease in invasion upon both the HDAC inhibition. Student's t-test has been performed with respect to the control group. (Paired t-test was performed for the statistical analysis, pvalue>0.05, ns; p value<=0.05,*; p value<=0.01,**; p value<=0.001,***).

In order to understand the role of nuclear envelope upon HDAC inhibition, we screened for the expression of key genes of the inner and outer nuclear membrane (INMs and ONMs) from our transcriptome profile. Out of the 18 inner nuclear membrane (INM genes, NET8 (also known as LPGAT1) was found to be downregulated while NET37 (also known as MYORG) was found to be upregulated upon NaB treatment (Fig.4A). MS-275 treatment showed differential regulation of 7 genes involved with the inner nuclear membrane. We observed an upregulation of NET37 (MYORG), SUN1, LBR, ALG2 and TMEM43/LUMA while TOR1AIP1 (also known as LAP1), TMPO (also known as LAP2) and Nurim were found to be downregulated (Fig. 4B). This suggests a different regulatory mechanism of HDAC inhibition on the inner nuclear membrane genes. LAP2β is an intra-nuclear molecule that binds to Lamin B1. It is reported that LAP2β interacts with HDAC3 at the nuclear periphery and induces histone H4 deacetylation [49]. Similarly, out of 7 outer nuclear membrane genes, SYNE3 was found to be upregulated while SYNE1 was downregulated upon both the treatment conditions (Fig. S2C). Upon treatment with MS-275, we observed SYNE4 to be highly upregulated with a log2foldchange value of 8.3. SYNE4 is a member of nespirin family of genes that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. Nesprins anchor the cytoskeleton to the nuclear membrane either by direct interaction with the cytoskeleton or through accessory proteins. These membrane proteins play an important role in mechanosignalling. Expression of Nesp4 is associated with significant changes in cellular organization involving relocation of the centrosome and Golgi apparatus relative to the nucleus [50]. These observations suggest that HDAC inhibition leads to a significant alteration in nuclear architecture by differentially regulating the genes involved in nuclear membrane integrity.

HDAC inhibition induces alterations in expression of nuclearporins

Nuclear porins (NUPs) regulate gene expression through interactions with various chromatin modifiers. High resolution structured illumination microscopy (SIM) based studies have revealed open chromatin or heterochromatin exclusion zones at the nuclear pores [51]. Recent work in the field has shown that pharmacological intervention with Trichostatin A, (TSA), NaB and SAHA on HeLa and MCF7 cell lines relocates Tpr, NUP153 and NUP98 from the nuclear pore towards the nuclear interior. These nucleoporins accumulate in the interior of the cell nucleus as intra-nuclear nucleoporin cluster (INCs). The formation of intra nuclear nucleoporin cluster requires hyperacetylation of chromatin which is mediated by HDACi treatment [52]. Our transcriptome results reveal that the mRNA levels of NUP153, NUP155, NUP160, NUP205 and NUP35 were downregulated. We therefore hypothesize that hyperacetylation of histone H4 due to HDAC inhibition aids the alteration of dynamic equilibrium of nucleoporins towards chromatin interacting regions leading to the formation of INCs. Dysregulation in the expression profiles of various nucleoporins has been reported in various cancers [[52], [53], [54], [55]].

In order to understand the differential regulation of nuclear porins upon HDAC inhibition from both the structurally diverse classes, we screened for 32 nuclear pore genes. Upon NaB treatment, 13 nuclear pore genes were differentially expressed and strikingly all of them were found to be downregulated. These include NUP155, NUP58, SEH1L, NUP160, NUP42, NUP205, NUP153, NDC1, NUP54, NUP107, NUP35, TPR and RANBP2 suggesting that hyperacetylation upon HDAC inhibition leads to downregulation of nuclear pore genes in HeLa cells as represented in the heatmap (Fig. 4A). Similarly, upon MS-275 treatment, we observe 11 differentially expressed nuclear pore genes out of which 9 were downregulated (NUP160, NUP155, NUP205, NUP214, NDC1, NUP35, NUP153, NUP188 and SEC13) while two nuclear pore genes (POM121 and NUP58) were upregulated (Fig.. 4B). Furthermore, out of all the differentially expressed nuclear pore genes NDC1, NUP153, NUP155, NUP160, NUP205 and NUP35 were found to be downregulated upon both the treatment conditions while, NUP58 and NUP88 show decreased expression only upon NaB treatment (Fig. S2C).

Furthermore, a critical exportin 1 molecule (XPO1/CRM1) involved in nucleo-cytoplasmic trafficking and critical for protein and RNA subcellular localization is reported to overexpressed and upregulated in cervical cancer [56]. Overexpression of XPO1/CRM1 in various cancers, highlights the importance of targeting both nucleoporins and nuclear export processes in therapeutic strategies for cancer. These molecules are major transporter responsible for exporting major EMT promoting TFs including Snail1 [57].

Interestingly we observed a downregulation of XPO1 upon both the HDAC inhibition treatment and SNAI1(EMT-TF) to be downregulated upon MS-275 suggesting that HDAC inhibition provides a promising strategic intervention by targeting these nucleoporins and exportin molecule in cervical cancer.

HDAC inhibition differentially regulates expression of various epigenetic factors and mechanosignalling genes

In order to understand the observed differential levels of H3K4me3, H3K9me3 and H3K27me3 through immunofluorescence upon HDAC inhibition by diverse inhibitors, we screened for the expression profile of reader, writer and eraser machinery regulating post translational modifications of histones. We screened 720 epifactors through the Epifactor database [58] and analysed their expression profiles from our RNA sequencing data upon individual treatments with NaB and MS-275. We observed a differential regulation of 188 and 327 epigenetic factors upon NaB and MS-275 treatment respectively (p value <0.05 and logFC|0.5|), out of which top 30 differentially expressed epigenetic factors (top 15 upregulated and top 15 downregulated) are represented as heatmap in Fig. S2D (NaB) and Fig. S2E (MS-275).

We observed that GADD45A, GADD45B and KDM4B were upregulated upon both the treatment conditions (Fig. S2F). We observed an increase in the levels of MEN1, (multiple endocrine neoplasia type 1) gene, upon both NaB and MS-275 treatment correlating with elevated H3K4me3 levels in cervical cancer cells. LC-MS/MS based study upon HDAC inhibition with MS-275 showed dose dependent increase in arginine methylation, and decreased KDM1A (LSD1) expression, while other KDMs were unaffected or showed increased expression [59]. This further correlates with our data which observed an increase in the expression of KDM4B upon both NaB and MS-275 treatment. Increased expression of KDM4B correlates with decreased expression of H3K9me3. These finding suggests a complex crosstalk of various epigenetic factors upon HDAC inhibition. MS-275 treatment also shows a lower expression of Suv39H1, the predominant H3K9 methyltransferase, thus correlating with decreased H3K9me3 levels upon MS-275 treatment. However, SUV39H1 doesn’t show significant change in the expression profile upon NaB treatment suggesting SUV39H1 independent decrease in the levels of H3K9.methylation upon HDAC treatment in cervical cancer cells. We also observed downregulation of methyl transferases SETD6, SETD7, CBX3 and CBX5 upon both NaB and MS-275 treatment (Fig. S2G).

Recent literature has extensively documented the involvement of mechanosignalling cascades that regulate nuclear morphology and histone acetylation patterns in cancer cells. Enhanced matrix stiffness alters both lamina-associated domains and accessible regions of chromatin to promote the tumorigenic phenotype in mammary epithelium through HDAC3/8-mediated pathways [60]. In order to investigate the differential regulation of mechanosignalling genes upon HDAC inhibition, we screened for 35 genes responsible in mechanosignalling pathways. Out of 35 mechanosignalling genes 12 were differentially regulated (11 upregulated while 1 downregulated) upon NaB treatment while 15 were differentially regulated (9 were upregulated while 6 were downregulated) upon MS-275 treatment (Fig. S2H and S2I respectively). Interestingly, we found 7 mechanosignalling genes to be upregulated upon both the treatment conditions (CDH1, AKT1, FZR1, KRT19, KRT8, MYH14 and TUBB3).

Cadherin-based adherens junctions and desmosomes play a role in maintaining cell-cell contacts and mechanosignalling. CDH1 regulates Hippo-YAP/TAZ signaling pathway through recognizing and degrading large tumor suppressor (LATS) kinases [61]. Recent work highlights the role of HDAC2 in lung cancer cell migration upon TGFβ treatment. Further investigation revealed that HDAC2 interacts with YY1, and deacetylates Lysine 27 and Lysine9 of Histone 3 (H3K27ac and H3K9ac), at the promoters of CDH1 thereby reducing the transcriptional activity and promoting cell migration [62]. We observe an increase in expression profile of CDH1 upon both the treatment condition which correlates with decreased expression of HDAC2 upon NaB treatment and decreased expression of HDAC7,8 and 10 upon MS-275 treatment condition. Interestingly YY1 expression was also found to be downregulated with MS-275 inhibition, suggesting a crosstalk of different classes of HDAC with YY1 which in turns regulates CDH1 expression.

HDAC inhibition confers distinct antagonistic relationships between nuclear porins and lamins

In order to understand the correlation in gene expression between nuclear architecture, epigenetic factors and mechano signalling genes upon HDAC inhibition, we performed pair wise Spearman correlation amongst the commonly differentially expressed factors in each group.

We identified distinct antagonistic relations between nuclear porins and lamins (LMNA and LMNB2) upon individual treatment with NaB and MS-275 (R≤−0.8 and pvalue ≤0.05) (Fig. S2J and Fig. S2K), suggesting that HDAC inhibition distinctly regulates the expression profiles of nuclear lamins and nuclear porins. Furthermore, LMNA and LMNB2 were found to be positively regulated upon both the treatment conditions, suggesting that both the lamin isoforms are coexpressed upon pharmacological intervention with HDAC inhibitors.

Interestingly, we found nucleoporins including NUP155, NUP153, NDC1, NUP 205 to be anti-correlated with CDH1 upon both NaB and MS-275 treatment (R<−0.5 and p-value ≤0.05), while CDH1 was found to be positively correlated with lamins(Fig. S2J and S2K). Although direct relationship between nuclear architectural proteins and CDH1 has not been well investigated, studies have shown that NUPs are involved in metastatic progression in cancer and knockdown of NUP58 showed elevation in the level of CDH1 [63]. Furthermore, knockdown of LMNB1 correlated with increased cancer progression lowering the levels of CDH1 in lung cancer [64], suggesting a positive correlation in the expression of Lamins and CDH1. We found a similar significant positive correlation among Lamins, LMNA and LMNB2 and CDH1 upon MS-275 treatment, suggesting that differential expression of these nuclear architecture genes regulates metastatic progression through the expression of various epithelial markers. Furthermore, knockdown studies on NUP98 shows a downregulation of BUB1, a serine/threonine protein kinase involved in spindle assembly check point [65], suggesting a positive correlation between nuclear architectural proteins and spindle assembly checkpoint. We observed a similar correlation pattern between the nuclear architectural proteins and BUB1 upon HDAC inhibition. We performed qRT-PCR to validate the expression of LMNA and NUP155 upon both NaB and MS-275 treatment and observed higher expression of LMNA and lower expression of NUP155 upon both the treatment condition suggesting an antagonistic relation (Fig. 4C and D).

HDAC inhibition reduces transwell migration

Chromatin compaction and decompaction governs cell migration [66]. Furthermore, lamins promote invasion and cancer metastasis through alterations in their expression levels. It is known that tumours with low levels of Lamin acquire metastatic potential [67,68]. In our experiments, we observe an increase in the expression of Lamin A/C which might lead to reduced invasion capability. In order to understand the functional implications of the observed alterations in nuclear morphometry through increased nuclear area, nuclear volume and LMNA upon HDAC inhibitor treatment, we performed transwell migration assay. We observed that upon individual treatment with both sodium butyrate and MS-275 treatment there is a significant decrease in number of invaded cells (Fig. 4E and 4F). We therefore hypothesize that these HDAC inhibitors (NaB and MS-275) enhance nuclear stiffness of HeLa cells as observed through increased lamin A/C on the nuclear envelope, nuclear area and nuclear volume. The nuclear stiffness aided by enhanced decompaction of the chromatin we observe serves as an impediment to cell migration and invasion in cervical cancer cells.

HDAC inhibition influence non-histone substrates

Beyond deacetylating histone proteins, the HDACs also deacetylate non-histone proteins and regulate several biological processes [69,70]. Acetylation of non-histone proteins has been demonstrated to alter protein function by modulating their stability, cellular localization, and protein–nucleotide/protein–protein interactions. Acetylation of these non-histone proteins are crucial for tumorigenesis, cancer cell proliferation, cell death, and immune functions. Different class of HDAC inhibitors have been shown to activate CDKN1A [71] which in turn can inhibit various cyclins. This activation of cyclins is necessary for inducing G1 arrest.

In our experiments, we observed a similar increase in the expression profile of CDKN1A upon NaB treatment. In addition, ectopic expression of HDAC8 was found to increase the level of mutant p53 protein and transcript. Similar decrease in expression of the mutant p53 protein and transcripts was observed upon HDAC inhibitors or knockdown of HDAC8 [72]. Furthermore, it has been shown that HDAC1, HDAC2 and MYC directly bind to the TP53 gene and that MYC recruitment drops upon HDAC inhibitor treatment using both SAHA and MS-275, suggesting non histone substrates of these histone deacetylates on tumor suppressor genes [73]. Previous work from the lab has established that the growth inhibitory effect of the epigenetic drug (HDACi) is more specific to the status of p53 in colon cancer cells. Recovery upon HDAC inhibition depends on its p53 status which is critical for the cell growth as well as regulation of gene expression through histone modifications [74].

High resolution mass spectrometry to identify acetylation changes upon HDAC inhibition using SAHA and MS-275 have identified that lysine acetylation targets large multiplex complexes involved in diverse cellular processes, such as chromatin remodeling, cell cycle, splicing, nuclear transport, and actin nucleation, these include chromatin-remodeling complexes, such as SWI/SNF, NURD, INO80, and NURF [75]. We observed a downregulation of INO80C upon both the HDAC inhibitors, suggesting that HDAC inhibition regulates the expression of chromatin remodellers including INO80C.

Overexpression of NUP58 and reduced expression of LMNA are associated with poor prognosis in cervical cancer patients (TCGA-CESC cohort)

To investigate the translational and clinical relevance of the various epigenetic factors and nuclear architectural (INM, ONM, Nuclear Lamins and Nuclear pore genes) differentially regulated on HDAC inhibition, we attempted to validate them on human cervical cancer through TCGA. We identified RNA sequencing data of 148 cervical patients (with tumor purity ratio of > 0.6) and 19 solid tissue normals (N = 3 from TCGA, 16 from GTExPortal) (Fig. 6A) in the age group cohort of 40 years to 70 years. We analysed the RNA sequencing data from these cohorts to examine the gene expression profiles in these patients. We found striking and interesting observations in the expression profile of the cohorts in our study.

Fig. 6.

A mechanistic model of increase in nuclear area and nuclear volume on HDAC inhibition. Individual treatment with HDAC inhibitors Sodium Butyrate and MS-275 lead to chromatin decompaction with increased euchromatin and decreased heterochromatin as evidenced by the expression of histone marks. The increased levels of Lamin A induces nuclear stiffening over the 48-hour period and reduces cell invasion. HDAC inhibitors therefore reduce invasion and protect the tumour cells from metastatic spreading as observed in the invasion assay (Fig. 4E, F).

To understand the clinical relevance of nuclear architectural proteins we screened for differentially expressed INMs, ONMs and nuclear porins genes from the RNA sequencing data of the TCGA-CESC cohort (Fig. S3A, Fig. S3B, Fig. 5B). Interestingly, we observed 20 differentially expressed nuclear pore genes of which all of them were highly elevated (Fig. 5B).

Fig. 5.

Validation of the observed epigenetic and nuclear architecture signatures on cervical cancer patients from TCGA-CESC. High expression of NUP58 and SETD6 correlates with poor survivability in TCGA-CESC patients. A. Principal component analysis (PCA) plot representing clusters of normal cervical tissue(red)(N=19) and cervical tumors (blue) (N=148) B. Boxplot representing differential expression of nuclear porins in TCGA cohort with normal derived from GTEx with p value <0.05 and logFC|0.5| Tumor(red) and Normal(grey). C. High median expression values of NUP58 associates with poor survival in TCGA-CESC (n=292) patients [HR =2.4 and p value <=0.1]D. Low median expression values of LMNA associates with poor survival in TCGA-CESC (n=292) patients [HR =0.61 and pvalue <=0.1]E. Alteration in expression profiles of Lamins, epigenetic regulators (SETD6 and CBX3) and NUPs in normal and tumour cervical tissue obtained from Indian cohort as obtained by RT-qPCR. RT- qPCR analysis was performed to evaluate the expression of LMNA, SETD6 NUP58, NUP155 and CBX3. RT-qPCR data analysis was based on 2-∆∆CT and GAPDH was used as housekeeping gene for RT-qPCR data normalization. LMNA shows decrease in expression profile, while NUP58, NUP155 shows increase in expression profile in tumour tissue as compared to normal. Statistical significance is determined by unpaired t test (*p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001; ns p > 0.05), and error bars denote SEM.F. High median expression values of both NUP58/SETD6 associate with poor survival in TCGA-CESC (n=292) patients [HR =1.6 and p value <=0.1].

We observed an elevation of NUP107 expression which correlates with a similar observation in 30 cervical tumours [76]. Upon dividing CESC patients into high-risk and low-risk groups based on the model, the prognosis of patients with high levels of NUP58 were subjected to survival analysis. Kaplan-Meier survival analysis showed that patients in the high NUP58 gene expression score had significantly low survival as compared to patients with lower expression score (p = 0.066, Fig.5C) of NUP58. These findings strongly support the biological relevance of our findings in HeLa cells after HDAC inhibition. To further examine the prognostic value of LMNA, we defined a high and low expressing group using the median value of Z score of log normalized TPM counts. Patients who had tumors with low LMNA expression had a worse prognosis than those having tumors with high LMNA expression (p = 0.038, Fig. 5D).

Overexpression of SETD6 associates with poor prognosis in cervical cancer patients (TCGA-CESC cohort)

We screened for differentially expressed epigenetic factors that showed altered expression profiles upon HDAC inhibition. We identified CBX’s to be highly expressed in cervical tumors as compared to normal tissues (Fig. S3C). We identified CBX3 and CBX5 to be upregulated in cervical tumors as compared to normal. Chromobox protein homologs (CBX), part of heterochromatin protein (HP1) has been reported to be upregulated across various cancers and is known to be associated with poor prognosis [77]. Pan Cancer analysis has identified CBX3 as a prognostic, and immunological marker [78]. We also observed SETD6 to be upregulated in cervical tumors as compared to normal. SETD6 is a member of protein lysine methyl transferases (PKMTs), and is responsible for cellular proliferation. SETD6 has been reported to have an oncogenic role across various tumors including lung adenocarcinoma (LUAD) [79] and oral carcinoma [80], role of SETD6 in cervical cancer has not been well established. Here, we observed SETD6 to be upregulated across cervical tumors (Fig. S3C) and high expression correlates with lower survivability in cervical cancer (Fig. S3D).

Clinical validation of nucleoporins and epigenetic signatures

To explore the expression profiles of the identified lamins, nucleoporins and epigenetic signatures in cervical tumors we performed qRT-PCR from the RNA isolated from the five tumors and five normal tissues obtained from Indian cohort. The transcriptional expression of LMNA was downregulated in tumour tissues while expression profile of SETD6, NUP58, NUP155 and CBX3 were upregulated in cervical tumour tissues as compared to normals (Fig. 5E, Fig. S4A-E). Interestingly, we observed CBX3, CBX5 and SETD6 were found to be downregulated upon both NaB and MS-275 treatment in Hela cells suggesting that combinatorial treatment using HDACi might be useful in patients with high expressing CBX and SETD6.

In order to explore the clinical implications of the agonistic relationship between nuclear porins and SETD6, we performed survival analysis and observed that high NUP58/SETD6 expressing cervical tumors are associated with poor survival as compared to low expressing cervical tumors (Fig. 5F). These observations suggest that HDAC inhibitors and their modulation of the nuclear pore and epigenetic machinery can be employed as a strategy for potential therapeutic intervention in cervical cancer patients.

Discussion

Novel and interesting insights emerging from recent studies on histone deacetylases (HDACs) and HDAC inhibitors have unravelled the mechanistic underpinnings of their epigenetic functions in cancer cells, making them potential therapeutic targets against cancer progression. The transcriptional reprogramming circuitry triggered by HDAC inhibition is a vital regulator of key signalling processes that enhance the therapeutic benefits of these inhibitors. In this work, we have subjected cervical cancer cells (HeLa) to pharmacological intervention with two structurally diverse HDAC inhibitors - (NaB) and (MS-275) for 48 h and have attempted to understand the alterations in expression profiles of epigenetic factors, mechanosignalling, nuclear membrane and nuclear envelope genes. We have also validated the observations on cell lines, a cohort of 148 cervical cancer patients from the TCGA cohort (TCGA-CESC) and on cervical cancer tissues obtained from Indian cohorts through qRT-PCR.

Our observations from nuclear morphometric measurements upon HDAC inhibition show a significant increase in nuclear area and nuclear volume with unaltered circularity during individual treatment with each of the diverse HDAC inhibitors.

Changes in nuclear size and shape are frequently associated with metastatic spread in cancer and in ageing [81,82]. The size of the nuclei either increase or decrease depending on the type of tumour investigated. Aberrant nuclear morphologies could be caused due to alterations in grooves, fragmentation, contour thickening and dents in the nuclei [83,84].

The most important criteria governing the nuclear morphology is the mechanical balance between the cellular forces created on the nuclear surface, the key balance between mechanical stresses developed in the nuclear lamina and chromatin and due to mechanical softening of the nucleus [85,86]. This led us to further investigate the influence of HDAC inhibition on the lamin- chromatin network and on mechanosignalling which regulate nuclear size and chromatin function. Since most of these changes are mediated by epigenetic modifications on the cell nucleus, we profiled the expression of key epigenetic marks on the HeLa cells 48 h after HDAC inhibition. We observed an increase in the levels of active epigenetic modifications H3K4me3 and H4 acetylation besides an increase in levels of nuclear envelope proteins Lamin A/C. The heterochromatin repressive mark H3K9me3 is also downregulated with concomitant decrease in the levels of heterochromatin Protein 1 (HP1α) while the levels of the other key repressive mark H3K27me3 was found to increase with NaB treatment and decrease with MS-275 treatment.

In our work, we find that individual treatments with Histone Deacetylase (HDAC) inhibitor Sodium Butyrate and MS-275 have shown an increase in the levels of active histone marks H4ac and H3K4me3 by nearly 3 times (∼3X) and a decrease in levels of the repressive mark H3K9me3 and heterochromatin protein HP1α by 65 percent (∼0.6X). Besides these, we have also quantified the nuclear volume which is found to increase after HDACi treatment along with nuclear area. These findings point to enhanced decompaction of the chromatin upon HDAC inhibition.

We also find that the levels of lamin A/C are elevated (∼1X,3X) upon inhibition by both the inhibitors. This increase in Lamin levels is also accompanied by the perfect localization of the lamins on the nuclear periphery. It is known that cancer cells entering the EMT program gain invasive and migratory properties besides changes in nuclear morphometry by decreasing Lamin A/C to facilitate extravasation and metastasis [67,68].

Lamins promote invasion and cancer metastasis through alterations in their expression levels. It is known that tumours with low levels of Lamin acquire metastatic potential. In our experiments, we observe an increase in the expression of Lamin A/C which might lead to reduced invasion capability.

The increase in nuclear area and nuclear volume besides increase in lamin A/C we observe in our experiments lead us to believe that the treatment of cervical cancer cells with HDAC inhibitors results in enhanced chromatin decompaction as evidenced by the increase in the levels of H3K4me3 and H4ac and reduced heterochromatinisation through decrease in HP1α and H3K9me3 which promote increase in nuclear area and volume. Our high content imaging of HeLa cells treated with these two HDAC inhibitors also reveals a reduction in Heterochromatin/Euchromatin Area after 48 h treatment (Unpublished work from the lab).

We believe that the 48hr treatment of HeLa cells with HDAC inhibitors (NaB and MS-275) reported in our experiments enhances nuclear stiffness, nuclear area and nuclear volume besides recruiting more lamin A/C on the nuclear envelope. The nuclear stiffness aided by enhanced decompaction of the chromatin we observe serves as an impediment to cell migration and invasion in cervical cancer cells.

This also correlates with recent mechanobiology experiment on HDAC inhibition that has established a coupling between chromatin decondensation and nuclear stiffness with TSA treatment and observed nuclear stiffness in shorter time scales and nuclear softening in longer time scales [87].

We also wanted to validate if the functional significance of the mechanistic insight (increase in nuclear size) is related to cell migration and performed an invasion assay on HeLa cells treated with these two HDAC inhibitors. We establish a decrease in invasive behavior as evidenced by the decrease in number of invaded cells upon both the HDAC inhibition. We therefore propose that HDAC inhibition increases nuclear area and nuclear volume through decompaction of chromatin and increase in lamins. These alterations contribute functionally by decreasing in cell migration and invasion properties (Fig. 6).

Our pharmaco transcriptomic profiling of the cervical cancer cells treated individually with NaB and MS-275 highlights the downregulation of MYC and E2F pathways with NaB treatment and a downregulation of genes associated with EMT and interferon response pathways upon MS-275 treatment. The regulation by apical junction and apical surface pathways upon HDAC inhibition by both the small molecules aids the restoration of epithelial state in cervical cancer cells.

We also observed differential alterations in the expression of genes in the inner and outer nuclear membrane. Upregulation of NET37, SUN1 and downregulation of LAP1 and LAP2 proteins suggest an intricate network between histone deacetylation, mechano signalling and alterations in nuclear architecture. LAP2β is an intra-nuclear molecule that binds to Lamin B1. It is reported that LAP2β interacts with HDAC3 at the nuclear periphery and induces histone H4 deacetylation [49]. High expression of LAP2 is also seen in cervical cancer patients who show low survival rates. Microarray and RTqPCR based analysis have previously reported high expression of LAP2α in cervical cancer tissues as compared to healthy tissues. High expression of LAP2α correlates with increase in E2F activities and decrease in tumor suppressor p53 [88]. Downregulation of LAP2α upon HDAC inhibition thus suggests epigenetic regulation of genes involved in cancer progression, which makes HDACi to be a promising therapeutic strategy for cervical cancer patients. We also observed a very strong upregulation of outer nuclear membrane protein SYNE4 (log2FC =8.3). SYNE4 is a member of nespirin family of genes that encodes KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. Nesprins anchor the cytoskeleton to the nuclear membrane either by direct interaction with the cytoskeleton or via accessory proteins. These membrane proteins play an important role in mechanosignalling. Expression of Nesp4 is associated with dramatic changes in cellular organization involving relocation of the centrosome and Golgi apparatus relative to the nucleus [50]. The physical coupling between the nucleus and the cytoskeleton is a key parameter for cancer cell migration. Changes in nucleo-cytoplasmic transport through the nuclear pores have also been shown to cause alterations in nuclear size. Nesprins anchor the cytoskeleton to the nuclear membrane either by direct interaction with the cytoskeleton or via accessory proteins. We have observed in our experiments that SYNE4, a member of the Nesprin family of genes that encode KASH was upregulated upon inhibition with both the inhibitors while SYNE3, another member of the Nesprin family was upregulated upon inhibition with MS-275. This transport leads to a compromise in nucleo cyptoplasmic exchange leading to defects in trafficking and accumulation of various genes including tumour suppressors inside the nucleus. We also observe a reduction in XPO1 (CRM1), a key mediator of nucleo cytoplasmic transport which alters the localization of tumour suppressors and oncogenes. These observations suggest that HDAC inhibition leads to a significant alteration in nuclear architecture by differentially regulating the genes involved in nuclear membrane integrity.

The downregulation of expression of nucleoporins on HDAC inhibition as observed in our transcriptome profile implies a novel mechanism of controlling invasion and metastasis and hence Epithelial to Mesenchymal Transition (EMT) in cervical cancer cells through nuclear protein down regulation. Increased expression and higher numbers of NUPs suggest higher nucleocytoplasmic transport rates and are known to be associated particularly with multidrug resistance cells and cells from aggressive tumors [[89], [90], [91]].

Changes in nucleo-cytoplasmic transport through the nuclear pores have also been shown to cause alterations in nuclear size. The physical coupling between the nucleus and the cytoskeleton is a key parameter for cancer cell migration. The nuclear envelope anchors the nucleus within the cell and is a vital regulator of nuclear stability and shape inside the cell. Apart from gene regulation, the nuclear envelope contributes to a tissue specific 3D genome organization within the cell nucleus and provides the substrate and docking sites for chromatin changes within the nucleus. The nuclear envelope acts as a physical barrier between the cytoplasm and the nucleus and consists of inner and outer nuclear membranes and the nuclear lamina. The outer and inner nuclear membranes connect to the nuclear pore complexes and form a mesh or mechanical network of proteins regulating cell migration [92]. Nucleoporins are upregulated in ovarian, breast and colorectal cancer besides hematological malignancies [93].

Besides such alterations in biochemical signaling, the nucleus deforms due to mechanical forces resulting in changes in the structure and composition of the nuclear envelope [94,95]. Such changes in the structure are also accompanied by changes in chromatin organization and the epigenetic landscape [96,97]. The integrity of the nucleus, chromatin remodelling and cell reprogramming events are highly correlated to the cytoskeleton LINC complex and the lamins [98].

Recent work has shown that overexpression of nuclear porins NUP88 is associated with increased invasion and metastasis in HeLa cells [99]. shRNA mediated silencing of NUP58 has been shown to reduce the expression of EMT markers associated with GSK-3β/Snail pathways in lung cancer cells [63]. This suggests that HDAC inhibition via NaB and MS-275 decreases metastasis via downregulating nuclear pore genes. Doxycycline-inducible shRNAs mediated depletion of NUP160 and NUP93 resulted in inhibition of NPC assembly in cancer cells. The inhibition in NPC assembly strongly reduced the number of dividing cells without significantly affecting non-dividing/confluent cells suggesting NPC formation is key for cancer cell survival [85]. We observe a consistent downregulation of nuclear pore complexes upon HDAC inhibition in HeLa cells suggesting that HDAC inhibitors regulates NPC complex formation by downregulating the expression of nuclear pores. These nucleoporins are known to alter the nucleo cytoplasmic transport and in turn modulate the nuclear size. The disruption and dysregulation of nucleo cytoplasmic transport and the increase in acetylation due to HDAC inhibition act in concert and contribute to the increase in nuclear area we observe on HDAC inhibition. We propose that the change in size observed in our experiments is also mediated by the nucleocytoplasmic exchange through nucleoporins.

Our finding that individual treatment with NaB and MS-275 alters the mechanosignalling cascades and the epigenetic landscape of cervical cancer cells reveals an intricate crosstalk between epigenetic states regulated by the reader, writer and eraser machinery, mechanosignalling and cancer signalling pathways triggering progression. The observed increase in the levels of MEN1 (Multiple Endocrine Neoplasia Type1) upon HDAC inhibition correlates well with elevated levels of the active histone mark H3K4me3. This gains importance in the light of recent studies on MEN1 mutations which show that Menin mediated integration of repressive H3K9me3 [100] might be involved in tumour suppressor activity.

We also observed down regulation of methyl transferases SETD6, SETD7, CBX3 and CBX5. SET domain containing (SETD)6 methyltransferase methylates RelA which further methylates histone H3K9 by interacting with methyltransferase G9a-like protein (GLP) and leads to a transcriptionally repressed state of both chromatin and NF-κB response genes [101]. Furthermore, SETD6 has also been shown to associate with the NuRD complex subunits MTA2 and HDAC1, suggesting both activating and repressive roles of SETD6 [97]. We found SETD6 to be downregulated upon both the treatment conditions which correlates with decreased H3K9me3 and increased acetylation levels.

CBX3 and CBX5, the chromobox proteins were found downregulated upon both the treatment conditions and CBX1 was mildly upregulated upon MS-275 treatment only. These observations correlate with decrease in the level of HP1α and HP1γ under both the treatment conditions, suggesting a complex crosstalk of various histone modifications upon HDAC inhibition. Recent work reporting observations on ChIP sequencing of NUP98 in keratinocytes with or without HDAC inhibition via SAHA/romidepsin (Romidepsin) showed reduction in NUP98 ChIP-seq signals, suggesting that NUP98’s genomic binding to its target genes is dependent on HDAC activity. Furthermore, diminished NUP98 signal correlates with its decreased target expression of DNMT1 and EZH2 upon HDAC inhibition [65]. This observation correlates with our observation of reduced EZH2 expression upon MS-275 treatment in cervical cancer cells. We therefore hypothesize that reduction in histone deacetylase activity dysregulates nuclear porins activity in turn leading to alteration in expression profile of EZH2. Furthermore, increased expression of CBX3 and decreased expression of CBX7 associates with poor prognosis in cervical cancer [77,102], suggesting HDAC inhibition regulates the expression profile of these epigenetic factors and in turn affects the metastatic properties of cancer.

Interestingly, the transcriptomic profiling of TCGA-CESC cervical cohort of 148 patients showed an increase in the levels of 20 nuclear pore genes. Patients with high expression levels of NUP58 showed significantly lower survival in the cohort study establishing the vital role of NUPs in cancer. This has also been validated in cervical tumours from Indian cohort, where we observed an increase in expression profile of NUP58 and NUP155 and key epigenetic factors including CBX3 and SETD6.

This work reports for the first time, HDAC inhibition mediated downregulation of nucleoporins like NUP58, NUP153, NUP155, downregulation of INM genes like LAP1, LAP2α and upregulation of ONM genes like SYNE4 which in turn mediates nuclear architecture changes to suppress cervical cancer invasion. This is evidenced also by upregulation of epithelial factors like CDH1 and downregulation of several mesenchymal genes as observed in the pharmaco-transcriptomic profiling. The observed downregulation of SET domain methyl transferases like SETD6, SETD7 and Chromobox like CBX3 and CBX5 besides upregulation of genes involved in mechanosignalling like CDH1, AKT1, Keratins and MYH14 provides an intricate and robust framework for devising an epigenetic therapy based on the modulation of a mechano-epigenetic signalling cascade in cervical cancer cells.

This work highlights a possibility of designing novel epigenetic therapy through pharmacological targeting of the nuclear size and morphology through modulation of the expression of nucleoporins through HDAC inhibition in cervical cancer.

Data Availability

All datasets generated and analyzed during this study are included in this published article and its Supplementary Information files. Raw sequencing data has been deposited and is accessible under the BioProject accession number (PRJNA1017391) Additional data are available from the corresponding author on reasonable request.

CRediT authorship contribution statement

Harsha Rani: Writing – original draft, Investigation, Formal analysis, Data curation. Shabir Ahmad Ganai: Writing – original draft, Investigation, Formal analysis, Data curation, Conceptualization. Vijayalakshmi Mahadevan: Writing – original draft, Supervision, Methodology, Investigation, Funding acquisition, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.