Abstract
Background
Neonatal piglets possess lysosome-rich foetal-type enterocytes that facilitate uptake and intracellular processing of maternally provided nutrients. However, the role of lysosomes in early-life growth and intestinal maturation remains unclear. Therefore, this study was conducted to determine the role of lysosomes in the development of neonatal intestine in piglets. For 1-day-old neonatal piglets, a total of 12 piglets (Duroc × (Landrace × Large Yorkshire)) were divided into 2 groups using a split-litter design. To initiate malfunction in lysosomes, newborn piglets were subjected to oral gavage with imipramine (25 mg/kg bodyweight) once daily for 7 days. For 21-day-old piglets, a total of 12 piglets were divided into two groups, and each group received the same treatment as described above.
Results
Piglets receiving imipramine demonstrated significantly stunted growth at 7 days of age, but not at 27 days. By postnatal day 7, the foetal-type enterocytes of untreated piglets were restricted in the mid to upper ileal villus and contained several large lysosomal vacuoles. In contrast, marked changes in ileal morphological and histological structure were observed following imipramine treatment, as evidenced by reduced degree of vacuolation, decreased lysosomal count, as well as pronounced mitochondrial swelling; however, no vacuolated enterocytes were found in 27-day-old piglets. Furthermore, signaling pathways associated with lipid transport and metabolism were significantly enriched, and the related hub genes were identified by bioinformatic analysis after imipramine administration. These findings were further confirmed by biochemical analysis demonstrating that serum levels of total cholesterol (TC) and apolipoprotein A1 (ApoA1) were significantly increased while serum ApoB was decreased in 7-day-old piglets receiving imipramine treatment. Additionally, there was an opposite trend in levels of ApoA1and ApoB in ileal mucosa compared to serum.
Conclusions
These results demonstrate that lysosome dysfunction induced by imipramine resulted in significant growth retardation, pronounced morphological and ultrastructural alterations in ileal enterocytes, along with disrupted lipid metabolism in early postnatal piglets; however, no such effect was observed in 27-day-old piglets. These findings enhance understanding of lysosomal functions and intestinal maturation in neonatal piglets.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12917-025-05063-6.
Keywords: Lysosome, Imipramine, Foetal enterocyte, Lipid metabolism, Neonatal piglet
Background
The porcine small intestine exhibits profound morphological and functional maturation during the early postnatal period. In newborn piglets, there exists a population of foetal-type enterocytes, which are first observed in foetal small intestine during the second trimester of pregnancy [1]. After birth, these cells are progressively replaced by adult enterocytes as development proceeds. Contrary to the adult enterocytes, these immature foetal enterocytes possess an apical canalicular system with high endocytic activity, which facilitates the transepithelial translocation of colostral antibodies and other bioactive macromolecules [2, 3]. For neonatal suckling piglets, intact maternal antibodies are primarily transferred in the proximal intestine [4], and ceases following gut closure, usually 1 to 2 days after birth [5, 6]. By contrast, in the distal small intestine (ileum), luminal contents are internalized mainly for intracellular digestion and these endocytosis process continues until up to 21 days of postnatal life, when all foetal enterocytes from the villus surface are displaced by adult cells [7, 8]. Precocious induction of gut maturation might improve piglet adaptation to weaning [9], while other studies reported that aberrant replacement of foetal enterocytes was associated with severe growth retardation and increased neonatal mortality [10–12].
To facilitate efficient degradation of maternal nutrients within cells, these foetal enterocytes are richly endowed with specialized system of endosomes and lysosomes [1, 13]. Lysosomes are membrane-bound degradative organelles containing acidic hydrolytic enzymes which can breakdown most biomaterials, such as proteins, lipids, and membranes [14, 15]. There are more than 70 hydrolases confined in lysosome lumen, each targeting specific substrates for degradation [16]. Deficiency of specific enzymes may result in inefficient degradation and drive multiple lysosomal storage disorders (LSDs) with common features, such as altered ion homeostasis, defects in membrane trafficking, and lysosomal lipid accumulation [17]. Suckling mice lacking the cation channels residing in lysosomal membranes have been found to exhibit retarded growth accompanied by pathological vacuolation of enterocytes and reduced apical endocytosis [13]. Moreover, larval zebrafish with defective lysosome-rich enterocytes (foetal-type) have been shown to suffer impaired protein uptake, stunted growth and reduced survival [18]. Additionally, delayed disappearance of foetal enterocytes has been noted in intrauterine growth retarded (IUGR) piglets, implying a slowdown in intestinal development [19, 20]. Furthermore, these foetal enterocytes in IUGR neonates have been revealed to lack characteristic large size vacuoles, both of the transport and the digestive variety [21]. Therefore, it is of great significance to elucidate the contribution of lysosomes for growth performance and intestinal maturation in early neonatal piglets.
The present study was conducted to examine the functional significance of lysosomes in regulating postnatal growth and intestinal homeostasis in neonatal piglets. Experiment was performed using a split-litter design. Piglets at postnatal day 1 (P1, newborns) or day 21 (P21) were subjected to oral gavage with imipramine, an amphiphilic agent with lysomotropic properties that preferentially accumulates in lysosomes, for 7 consecutive days. Growth performance, histopathological evaluation, bioinformatic analysis, as well as biochemical examination was further performed. This study may provide insights for early postnatal nutritional interventions for newborn piglets.
Methods
Animals and experimental design
The present study was conducted at a commercial research facility (Shimen, China). For 1-day-old neonatal piglets (newborns), a total of 12 piglets (female, Duroc × (Landrace × Large Yorkshire)) from 3 different litters (4 piglets per litter) were used and reared under the same conditions. Experiment was performed in a split-litter manner. The newborn suckling piglets with similar birth weight were allocated into 2 groups within the litters (n = 6 per group), to spread out any potential genetic effect. Neonatal piglets in the treatment group received oral gavage of imipramine at 25 mg/kg body weight (Sigma-Aldrich, St. Louis, MO) once a day, while their littermates were orally administered with PBS alone as control. The dosage of imipramine was determined based on previous studies [22, 23]. Sows used in the study were from the same genetic line, had similar parity, similar body condition score, and were managed under identical conditions. All sows were fed with the same standard diet. As the intestine develops, vacuolated foetal enterocytes are no longer observable in the jejunum or ileum by postnatal day 21, being fully replaced by mature enterocytes [7, 8]. Therefore, in order to minimize the potential interference caused by imipramine through other pathways, 21-day-old piglets were included as developmental stage controls, focusing the observed effects on lysosomal function. For 21-day-old piglets, a total of 12 female piglets were divided into two groups, and each group (n = 6) received the same treatment as described above. Both experiments lasted for 7 days. At the end of the experiment, 7-day-old or 27-day-old piglets were euthanized by intravenous injection of pentobarbital sodium (100 mg/kg), and then tissues were harvested for further analysis. Body weight, suckling behavior, and stool consistency were monitored during the treatment. Relative organ weight was determined by dividing the absolute organ weight (g) by the body weight at sacrifice (kg), expressed as g/kg.
Histopathological evaluation
Small intestinal tissues were fixed in 10% formalin, embedded in paraffin wax, and then sectioned (4 μm). Slices were stained with hematoxylin and eosin (H&E) or with Alcian blue-periodic acid-Schiff (AB-PAS) staining solution kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s protocol. Images were viewed with CaseViewer2.0 provided by 3DHISTECH (Pannoramic 250/MIDI, Hungary). Villus height and crypt depth were measured in 80 well-oriented crypt-villus units for each group, and the appearance of vacuolated enterocytes in 80 villi per treatment condition were examined. Goblet cells were quantified by counting the numbers of PAS positive cells in 40 random microscopic fields of view for each group. Histological analysis was assessed in a blinded manner.
Transmission electron microscopy
Transmission electron microscopy (TEM) was performed on ileal samples (1 mm3) according to previously described procedure [13]. Briefly, tissues were rinsed with phosphate buffer, fixed with 2.5% glutaraldehyde at 4 °C for 4 h, and then postfixed with 1% osmium tetroxide for 2 h. After dehydration through a series of ethanol, tissues were embedded in SPI-PON 812 resin for 48 h at 60 °C. Ultrathin sections of 70 nm were cut on an ultramicrotome (Leica UC7, Germany), double stained with uranyl acetate and lead citrate, and then examined with a transmission electron microscope (HT7700, HITACHI, Japan) at 80 kV.
Lysosomal diameter determination
Measurement of lysosomal diameter was carried out using ImageJ. A total of 60 lysosomes were analyzed in each treatment condition and average lysosome diameter was calculated. All image analyses were performed by an investigator blind to the experimental conditions to avoid subjective bias.
DEGs identification and pathway enrichment analysis
Total RNA of the ileum of neonatal piglets was extracted with TRIzol reagents (Life technologies) according to instructions. RNA-sequencing (paired-end, 2 × 150 bp) was performed on Illumina NovaSeq6000 platform (Majorbio, Shanghai, China). Clean reads were mapped to swine reference genome (Sscrofa11.1) utilizing TopHat2 software, and the corresponding mapping ratios for control and imipramine-treated piglets were 95.83 and 95.63%, respectively. Differentially expressed genes (DEGs) were identified based on a cutoff threshold |log2FoldChange|≥1 and P < 0.05 and subjected to further analysis. Gene Ontology (GO) enrichment analysis was carried out by Goatools, and GO terms with Bonferroni-corrected P < 0.05 were recognized significantly enriched. Moreover, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was conducted by KOBAS 2.0 software with adjusted P-value cut-off at 0.05. DisGeNET, Reactome and Wikipathways analyses were performed by Metascape (v3.5.20240101) (https://metascape.org/, accessed on 7 April 2024) to expound pathways correlated with DEGs.
PPI network construction and hub gene selection
The PPI interaction network of DEGs was constructed by STRING database (http://string-db.org), and colored by cluster identity and P-value. The top 10 hub genes with the highest degree of connectivity were selected according to CytoHubba maximal clique centrality (MCC) scores. Heatmap was constructed by relative expression data of hub genes between imipramine-treated piglets and controls from RNA-sequencing by HIPLOT web tool (https://hiplot.com.cn/). Hub gene expression was validated by qRT-PCR analysis.
Quantitative real-time PCR analysis
Ileal tissues were homogenized and lysed with TRIzol reagent (Life technologies, Carlsbad, USA) following the manufacturer’s protocol. RNA purity and concentration were checked using Nanodrop 2000 (Thermo Scientific, Waltham, MA, USA). The RNA samples were then subjected to reverse transcription with the use of PrimeScript RT Master Mix (Takara, Dalian, China). Aliquots of cDNA were quantified by qRT-PCR. All qRT-PCR reactions were performed under the following conditions: 95 °C for 3 min; 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. The relative gene expression was calculated using the 2−ΔΔCT method. All primers were designed using NCBI Primer Blast and listed in Table 1.
Table 1.
Primer sequences used for qRT-PCR analysis
| Genes | Primers | Sequences (5’−3’) |
|---|---|---|
| SOD1 | Forward | GAGTCATGGCGACGAAGGC |
| Reverse | AACACTGTCTTCTCTCCCTTCAG | |
| SOD2 | Forward | GGACAAATCTGAGCCCTAACG |
| Reverse | CCTTGTTGAAACCGAGCC | |
| GPX1 | Forward | TGGGGAGATCCTGAATTG |
| Reverse | GATAAACTTGGGGTCGGT | |
| GPX4 | Forward | GATTCTGGCCTTCCCTTGC |
| Reverse | TCCCCTTGGGCTGGACTTT | |
| MAP1LC3B | Forward | CCGAACCTTCGAACAGAGAG |
| Reverse | AGGCTTGGTTAGCATTGAGC | |
| BECN1 | Forward | AGGAGCTGCCGTTGTACTGT |
| Reverse | CACTGCCTCCTGTGTCTTCA | |
| PINK1 | Forward | CTCTGGTCGACTACCCCGAT |
| Reverse | ATGACGAGGAAGAGTGTCCG | |
| PRKN | Forward | CCAAACCGGATGAGTGGTGA |
| Reverse | CTTGTCAGAGGTCGGGTGTG | |
| ABCG5 | Forward | TGGACAGAATTTCACTTGCAGC |
| Reverse | CCCAGGATGACAAGAGTTGGG | |
| APOA2 | Forward | ACCCTTGGTCAAGAAGGCTG |
| Reverse | CAGTGGTCTGGACACCTCAC | |
| LCAT | Forward | GCTGGAGCCCAGTTATATGC |
| Reverse | CCTGGGGTTGGCGTAGTAAG | |
| ABCG8 | Forward | AGACGCAATCCTCAATGCCA |
| Reverse | TCCTGTTCTCGGGTCATCCT | |
| FABP1 | Forward | AGGGGACATCGGAAATCGTG |
| Reverse | TCACACTCCTCTCCCAAGGT | |
| APOC4 | Forward | TGGTTCCGGGCAAGATGAAG |
| Reverse | GCTATGGGCCTTGTTCAGGA | |
| β-actin | Forward | CTGCGGCATCCACGAAACT |
| Reverse | AGGGCCGTGATCTCCTTCTG |
Abbreviations: SOD1 Superoxide Dismutase 1, SOD2 Superoxide Dismutase 2, GPX1 Glutathione Peroxidase 1, GPX4 Glutathione Peroxidase 4, MAP1LC3B Microtubule Associated Protein 1 Light Chain 3 Beta, BECN1 Beclin 1, PINK1 PTEN Induced Kinase 1, PRKN Parkin RBR E3 Ubiquitin Protein Ligase, ABCG5 ATP Binding Cassette Subfamily G Member 5, APOA2 Apolipoprotein A2, LCAT Lecithin-Cholesterol Acyltransferase, ABCG8 ATP Binding Cassette Subfamily G Member 8, FABP1 Fatty Acid Binding Protein 1, APOC4, Apolipoprotein C4
Biochemical parameters analysis
Blood was collected and centrifuged at 3000 rpm for 10 min to obtain the serum. Total cholesterol (TC), triglyceride (TG), low-density lipoprotein-cholesterol (LDL-C), high-density lipoprotein-cholesterol (HDL-C), and total bile acids (TBA) in serum were detected by an automatic biochemical analyzer AU5800 (Beckman Coulter, CA, USA).
ELISA assay
Ileal tissues were ground in liquid nitrogen and homogenized in ice-cold PBS. Protein concentration of the intestinal homogenates was measured using the BCA assay (Nanjing Jiancheng Bioengineering Institute, China). Concentrations of apolipoprotein A1 (ApoA1) and apolipoprotein B (ApoB) in serum and ileum of piglets were measured with commercially available ELISA kits from UpingBio (Hangzhou, China) according to the manufacturer’s instructions.
Statistical analysis
Data were presented as mean ± SEM. Statistical differences were discerned using unpaired Student’s t test with a GraphPad Prism 7.0 (San Diego, CA, USA). Statistical significance was set at P < 0.05, while the tendency was accepted at 0.05 < P < 0.10.
Results
Changes in body weight and relative organ weight of piglets with Imipramine treatment
As depicted in Fig. 1A, imipramine exposure caused a significant reduction in body weight of piglets at postnatal day 7. Moreover, there was an increasing trend in the relative organ weight of large intestine in 7-day-old neonatal piglets, while a decreasing trend was observed in the small intestine (Fig. 1B). However, imipramine treatment had no impact on the body weight or relative organ weight of piglets aged 24 or 27 days compared with controls (Fig. 1C and D). No piglets exhibited abnormal suckling behavior or diarrhea during treatment.
Fig. 1.
Changes in body weight and relative organ weight of piglets with imipramine treatment. A Body weight of neonatal piglets at 1, 4, and 7 days postnatal (*, P < 0.05). B Relative organ weight of piglets at 7 days postnatal. C Body weight of piglets at 21, 24, and 27 days postnatal. D Relative organ weight of piglets at 27 days postnatal. Relative organ weight = absolute organ weight (g)/body weight at sacrifice (kg)
Morphological changes in the ileum of neonatal piglets challenged with Imipramine
The basic morphological and histological structure of small intestine in 7-day-old neonatal suckling piglets was assessed by HE staining. As shown in Fig. 2A, the ileal villi of the control group were relatively intact, long, and orderly arranged, while the intestinal villi became shorter and deformed in piglets with imipramine exposure (P = 0.019) (Fig. 2C and G). Notably, two distinctive types of enterocytes along the crypt-villus axis were observed. The adult enterocytes had a generally columnar shape and their cytoplasmic components were stained pink, while the cytoplasm of foetal enterocytes was not obviously stained and therefore exhibited a vacuolated appearance. Further microscopic examination of an individual villus from the control neonatal piglets revealed that foetal enterocytes were mostly confined to the upper regions of villus, while a small proportion of foetal cells existed in the mid-villus region, surrounded by non-vacuolated enterocytes. At the bottom of the villus, only adult enterocytes but not foetal cells were found (Fig. 2B). Similarly, these two types of epithelial cells were also observed in ileal villus of piglets with oral gavage of imipramine, while the vacuolated foetal enterocytes were much less numerous compared with controls (P < 0.001) (Fig. 2C, D and H). By contrast, no significant morphological changes were observed in the duodenum or jejunum of piglets at postnatal day 7 between imipramine and control groups (Fig. S1). Moreover, villi in the duodenum, jejunum, and also those overlying lymphoid tissue in the ileum, exhibited a clearly low degree of vacuolation in both group (Fig. S1 and S2). Furthermore, the morphology of the small intestine in piglets aged 27 days remained largely unchanged regardless of imipramine treatment, and no vacuolated enterocytes were found in the villi of 27-day-old piglets in either group (Fig. S3).
Fig. 2.
Morphological evaluation of the ileum of neonatal suckling piglets with imipramine treatment at postnatal day 7. HE staining images of (A) ileal tissues and (B) individual ileal villus of control piglets. HE staining of (C) ileal tissues and (D) individual ileal villus of imipramine-treated piglets. Ileal villi analyzed in the current study were not overlying lymphoid tissue unless specified. The non-vacuolated adult enterocytes were marked by filled arrows while vacuolated foetal enterocytes were indicated by the empty arrows. Goblet cells were labeled by asterisks. PAS staining of ileal sections of (E) control and (F) imipramine-treated piglets. Scale bars: 100 μm for A, C, E and F; 50 μm for B and D. G Ratio of villus height and crypt depth in the ileum of piglets (*, P < 0.05). The length of ileal villi and the depth of crypts in each animal (80 well-oriented crypt-villus units per group) were measured. H Measurement of vacuolated enterocytes appearing in the ileum of piglets (***, P < 0.001). The numbers of vacuolated enterocytes in 80 villi per treatment condition were counted and the average number of vacuolated cells per villus were calculated. I Measurement of PAS positive goblet cells per field of view in the ileum of piglets. PAS positive goblet cells were enumerated in 40 random microscopic fields of view per group
In addition, mucus-secreting goblet cells were also vacuolated following HE staining, with spherical shape and non-stained cytoplasm. AB-PAS staining further revealed a similar cell number and normal distribution of scattered goblet cells amidst the ileal enterocytes in both control and imipramine-treated groups by postnatal day 7 (Fig. 2E, F and I). In contrast, the vacuolated foetal enterocytes were not labeled by AB-PAS staining.
Ultrastructural alterations in ileal enterocytes due to Imipramine exposure
For a more detailed analysis, the ultrastructure of ileal enterocytes in the upper regions of villus was observed under high resolution TEM. As illustrated in Fig. 3A, the ileal enterocytes in control group presented normal nuclear structure and well-aligned microvilli, while some enterocyte microvilli became sparsely distributed, disorganized and distorted after imipramine exposure by postnatal day 7 (Fig. 3C). In addition, impaired apical endocytic machinery was observed in imipramine-treated group, as evidenced by less tubules and vesicles (endocytic-like membrane invaginations) locating beneath the microvillar membrane compared with controls (Fig. 3A and C). A closer ultrastructural examination revealed that the ileal enterocytes of control piglets had several large lysosomes partially filled with electron dense material or granular material by postnatal day 7 (Fig. 3A and B). In contrast, the ileal enterocytes of piglets with imipramine exposure lacked these large lysosomes and instead had considerably smaller and fewer lysosomes (Fig. 3C and D). Furthermore, the number and diameter of lysosomes was both measured and found to be significantly reduced in imipramine-treated group compared with controls (P < 0.001) (Fig. 3E and F). Additionally, imipramine treatment markedly lowered both LAMP1 (a lysosomal membrane marker; Fig. S4) and lysosomal acid phosphatase activity (a key indicator of lysosomal integrity and function; Fig. S5). Interestingly, some regions of the ileal enterocytes in 7-day-old piglets treated with imipramine contained extensive multilamellar membranous whorls (orange arrows on Fig. 3D), which was not found in controls. In consequence of postnatal development, these characteristic large lysosomes were no longer detectable in 27-day-old piglet enterocytes with or without imipramine exposure (Fig. S6).
Fig. 3.
Ultrastructural alterations in ileal enterocytes of neonatal piglets with imipramine treatment at postnatal day 7. Representative TEM images of ileal enterocytes of neonatal piglets from (A and B) control group and (C and D) imipramine-treated group. TEM images were taken in the upper part of the villus. N = Cell nucleus; Mv = Microvilli; L = Lysosomes; M = Mitochondria; GC = Goblet cells. Multilamellar structures were indicated by orange arrows. Scale bars: 5 μm for A and C; 2 μm for B and D. E Measurement of lysosome numbers. The number of lysosomes were counted in 30 enterocytes per group and the mean number of lysosomes per enterocyte was computed. ***, P < 0.001. F Measurement of average lysosome diameter. A total of 60 lysosomes were analyzed in each treatment condition. ***, P < 0.001
As demonstrated in Fig. 4A, high-resolution TEM showed that mitochondria in ileal enterocytes of control piglets displayed healthy membranous structure and well-arranged cristae. By contrast, mitochondria became strongly distended and irregular in shape following imipramine treatment by postnatal day 7, together with disrupted cristae structure, reduced matrix density and severe vacuolization. Compared with controls, the number of swollen mitochondria was significantly increased (P = 0.024) (Fig. 4B) while the relative mtDNA content was down-regulated in imipramine-treated piglets (P = 0.018) (Fig. 4C). Furthermore, the expression levels of antioxidant-related gene SOD1, and the mitophagy-related genes PINK1 and PRKN in ileal tissues of neonatal piglets aged 7 days were significantly up-regulated following imipramine administration (P < 0.05) (Fig. 4D and E). In contrast, substantially fewer distended mitochondria were observed in TEM micrographs of 27-day-old piglets regardless of imipramine exposure (Fig. S6).
Fig. 4.
Enterocyte mitochondrial damage of neonatal piglets with imipramine treatment at postnatal day 7. A Representative TEM images of mitochondrial morphology in ileal enterocytes of neonatal piglets. L = Lysosomes. Mitochondria were marked by blue asterisks. Scale bars: 2 μm. B Measurement of swollen mitochondria. The number of swollen mitochondria were counted in 30 enterocytes per group and the average number of swollen mitochondria per enterocyte was calculated. *, P < 0.05. C Relative mtDNA content in ileal tissues of piglets. *, P < 0.05. D Relative gene expression of SOD1, SOD2, GPX1, and GPX4 in ileal tissues of piglets. *, P < 0.05. E Relative gene expression of MAP1LC3B, BECN1, PINK1, and PRKN in ileal tissues of piglets. *, P < 0.05
Identification of key pathways in neonatal piglets with Imipramine treatment
Differentially expressed genes (DEGs) between 7-day-old imipramine-treated piglets and control piglets were visualized by volcano plot (Fig. 5A) and scatter plot (Fig. 5B). A total of 173 genes with altered expression profile were identified, including 81 up-regulated and 92 down-regulated genes. The top 20 enriched GO terms were determined, most of which (16/20) were found to be related to lipid transport, lipid absorption, cholesterol and lipid homeostasis, as well as lipid metabolic process (Fig. 5C). Subsequent KEGG enrichment analysis also revealed that these DEGs were highly enriched in pathways associated with lipid metabolism, particularly in bile secretion, fat digestion and absorption, and in cholesterol metabolism (Fig. 5D). Using DisGeNET analysis, diseases closely related to lipid metabolism disorders were enriched, such as premature coronary artery atherosclerosis, insulin resistance syndrome, hyperlipidemia, and hypercholesterolemia (Fig. 5E).
Fig. 5.
Identification of GO and KEGG pathways in the ileum of neonatal piglets with imipramine treatment at postnatal day 7. DEGs between imipramine-treated and control piglets were visualized by (A) volcano plot and (B) scatter plot. C Bar graph of the top 20 significant enriched GO terms. D KEGG enrichment analysis of the DEGs. Dot size indicated the number of DEGs, while the color represented the P values for the enrichment. E DEGs associated-diseases collecting from DisGeNET database
Reactome and Wikipathways analysis was further performed and the top enriched pathways were presented in bar graph (Fig. 6A and D). Additionally, network of these enriched pathways was integrated by cluster (Fig. 6B and E) and P-value (Fig. 6C and F). As illustrated in Fig. 6, the identified DEGs were primarily enriched in metabolism of lipids (R-556833), cholesterol transport and efflux (R-9029569), as well as cholesterol metabolism (WP-5304).
Fig. 6.
Reactome and Wikipathways analysis of neonatal piglets with imipramine treatment at postnatal day 7. A Bar graph of the top 5 enriched Reactome terms. B Interaction network of enriched terms integrated by cluster identity. Node size was proportional to the number of genes that fell into that term and nodes sharing the same cluster identity were usually close to each other. C Network of enriched terms colored by P-value. Discrete color scale represented statistical significance. D Bar graph of the top 6 enriched Wikipathways terms. E Network of enriched terms integrated by cluster identity. Node size represented the number of DEGs and node color indicated the identity of the cluster to which it belonged. F Network of enriched terms colored by P-value. Darker colors indicated higher enrichment significance
Hub gene selection in neonatal piglets receiving Imipramine treatment
As depicted in Fig. 7A, a total of 33 nodes and 34 edges were mapped in PPI network, and the top 10 nodes with the highest degrees, including ABCG5, APOA2, LCAT, ABCG8, FABP1, APOC4, PLB1, ABCB11, SLC15A1, and FABP2, were selected as potential hub genes (Fig. 7B). Subsequently, these 10 hub genes were clustered by normalized expression levels and presented as a heatmap (Fig. 7C). As illustrated, the transcript levels of these hub genes were significantly upregulated in piglets following imipramine administration compared with controls (Fig. 7C). RT-PCR analysis further confirmed that the expression levels of ABCG5, APOA2, LCAT, ABCG8, FABP1, and APOC4 were significantly elevated in imipramine-treated group (Fig. 7D).
Fig. 7.
PPI network construction and hub gene identification. A Construction of PPI network of DEGs by STRING database. A total of 33 nodes and 34 edges constituted the network. Interactions were represented by lines with different colors (cyan: from curated databases; deeppink: experimentally determined; blue: gene co-occurrence; yellowgreen: textmining; black: co-expression; lightblue: protein homology). B Selection of hub gene. The top 10 genes with the highest degree of connectivity were selected as potential hub genes by CytoHubba, a plugin of Cytoscape software. Darker color indicated higher degree score. C Heatmap depicting the relative expression of potential hub genes was drawn based on the RNA-Seq data. Red and blue indicated up-regulated and down-regulated expression, respectively. D Validation of hub genes expression by qRT-PCR. The expression levels of ABCG5, APOA2, LCAT, ABCG8, FABP1, and APOC4 in ileal tissues were detected. *, P < 0.05; **, P < 0.01; ***, P < 0.001
Alterations in lipid and lipoprotein levels in response to Imipramine treatment
As shown in Fig. 8A, imipramine exposure significantly increased serum concentration of TC as compared to controls by postnatal day 7 (P = 0.016). However, no significant changes were observed for TG, LDL-C, HDL-C or TBA in serum of piglets (Fig. 8A and B). ELISA assay further revealed that oral gavage of imipramine caused a significant increase in serum ApoA1 concentration (P = 0.003) (Fig. 8C) while in ileal mucosa, a marked reduction in ApoA1 was observed (P = 0.049) (Fig. 8D). By contrast, a notable decline in serum ApoB was noted (P = 0.005) while the level of ApoB in ileal tissues was significantly increased after imipramine treatment (P = 0.001) (Fig. 8E and F).
Fig. 8.
Biochemical analysis of lipids and lipoproteins of neonatal piglets with imipramine treatment at postnatal day 7. Measurement of serum (A) TC, TG, LDL-C, HDL-C, and (B) TBA concentrations by automatic biochemical analyzer. Levels of ApoA1 in (C) serum and (D) ileal mucosal tissues detected by ELISA. Levels of ApoB in (E) serum and (F) ileal mucosal tissues determined by ELISA. *, P < 0.05; **, P < 0.01
Discussion
The current study demonstrated that two distinctive types of enterocytes along the crypt-villus axis were present in the ileum of 7-day-old neonatal suckling piglets, while absent in 27-day-old piglets. This morphological distinction reflects functional adaptation: foetal-type enterocytes specialize in nutrient absorption (particularly maternal macromolecule uptake), whereas adult-type enterocytes prioritize digestive efficiency and barrier function. Further examination revealed that the vacuolated foetal enterocytes were mainly restricted to the upper regions of ileal villus while adult type cells were located at the bottom by postnatal day 7. This cellular distribution pattern was consistent with earlier work showing that for piglets 8 days old, nearly all of the foetal epithelial cells distributed in the upper fifth of villus and none in the bottom fifth [24]. Moreover, a mixed cell population was observed in the middle three-fifths of the villus, indicating an irregular replacement of foetal cells during the neonatal period [24]. Additionally, compared with the vacuolated adjacent villi, those villi overlying lymphoid tissues in the ileum exhibited a significant low degree of vacuolation, confirming the findings of previous research [7]. In the current study, single giant supranuclear vacuole was not observed in ileal enterocytes, in line with a previous report demonstrating that the single giant vacuole in enterocytes disappeared within the first 2 ~ 3 days after birth [1]. Another study [7] also revealed that from postnatal day 4, the foetal epithelium began to demonstrate a more variable, diffuse, multiple vacuolation, compatible with our observation. These immature foetal enterocytes have been reported to be richly endowed with endosomes and lysosomes, and progressively replaced by mature enterocytes containing fewer and smaller lysosomes scattered in the cytoplasm [13]. Higher levels of lysosomal marker Lamp 2 and larger lysosomal vacuoles have been identified both in the immature enterocytes of larval zebrafish and suckling mice [18]. Consistently, our ultrastructural analysis revealed that in piglets of 7 days-old without treatment, the ileal enterocytes also contained several large lysosomes partially filled with electron dense material. Resulting from postnatal development, these characteristic lysosomes were no longer detectable in 27-day-old piglet enterocytes regardless of imipramine exposure.
Imipramine is a U.S Food and Drug Administration approved tricyclic antidepressant drug [23] and it has arisen as a potential multifunctional tissue protective agent. Exposure to imipramine has been reported to improve pulmonary function in a newborn piglet lavage model [25], and to attenuate the inflammatory response in an LPS-induced acute lung injury model [22]. Imipramine has also been shown to have powerful lysosomotropic properties [26]. Once protonated inside the acidic lysosome lumen, imipramine could induce a significant increase of lysosomal pH [27], thereby affecting the normal functioning of lysosomes. In the current study, imipramine exposure led to a significant decrease in the body weight of piglets at postnatal day 7; however, this effect was not seen in piglets at 27 days old. Consistently, mice with lysosomal abnormalities experienced a growth delay starting after birth and persisting throughout the suckling period, but recovered after weaning [13], suggesting a pivotal nutritional role of lysosomes in intracellular digestion of maternally-provided nutrients during the early neonatal period. Moreover, imipramine exposure markedly changed the ileal morphological structure and significantly reduced the degree of vacuolation by postnatal day 7. Further examination revealed that both the number and size of lysosomes, along with acid phosphatase levels, were significantly decreased in ileal enterocytes, suggesting lysosomal dysfunction following imipramine administration. A previous study has reported that young suckling piglets receiving lectin treatment exhibited precocious gut maturation, reflected in decreased villus height, fewer vacuolated enterocytes per villus and smaller vacuoles in the small intestine [9]. Similarly, those piglets also demonstrated a depressed growth rate [9]. The formation of these large lysosomes in neonatal ileal enterocytes was postulated to arise from the fusion of multiple apical lysosomes [28], and therefore imipramine treatment might have the potential to interfere with this fusion process. However, our findings were inconsistent with an earlier report, which showed that enterocytes of neonatal mice with lysosomal defects exhibited markedly enlarged empty pathological vacuoles [13]. In another study, the enlargement of lysosomes was also observed as a primary change in cells with lysosomal acid lipase deficiency [29]. The discrepancies with prior research might require further investigation to clarify the underlying mechanisms. As a consequence, increased multilamellar structures were noted in the cytoplasm of ileal enterocytes by postnatal day 7 after imipramine treatment, in line with a previous study which showed that scattered multilamellar membranous whorls were presented in neonatal enterocytes with defective lysosomes [13]. Additionally, following lysosome dysfunction was an increase of swollen mitochondria, which consequently induced elevated oxidative stress and mitophagy, as evidenced by upregulation of SOD1, PINK1 and PRKN expression. In turn, the induced oxidative stress and impaired mitochondria would further aggravate lysosomal impairment and malfunction [30]. Compared to normal neonatal piglets, swollen mitochondria were also present in IUGR piglets, along with small vacuoles in foetal enterocytes with impaired intracellular digestive capacity [21].
To further investigate the molecular alterations, RNA sequencing was employed for an in-depth and detailed exploration. A total of 173 DEGs were identified in neonatal piglets with imipramine treatment and most of these DEGs were found to be predominantly associated with lipid transport and absorption, lipid metabolism, cholesterol transport and efflux, as well as cholesterol and lipid homeostasis by GO, KEGG, Reactome and Wikipathways analysis. Moreover, diseases closely related to lipid metabolism disorders were also enriched by DisGeNET analysis. These findings were further confirmed by the biochemical analysis demonstrating that serum concentrations of total cholesterol (TC) were significantly increased in piglets receiving imipramine treatment. Lysosomes play a crucial role in maintaining cholesterol homeostasis, and their dysfunction may induce disruptions in lipid metabolism [31]. Such lipid metabolism disturbance might hamper the maturational processes and growth of neonatal piglets given that porcine milk fat was the main energy source for the newborn piglets [32]. Another possible explanation for these observations might be due to the inhibitory effect of imipramine on the activity of acid sphingomyelinase (ASM), a lysosomal glycoprotein catalyzing the hydrolysis of membrane-bound sphingomyelin to generate ceramide and phosphocholine [33, 34]. A deficiency of ASM might lead to Niemann-Pick disease, a lysosomal lipid storage disorder, characterized by cellular aggregation of sphingomyelin, cholesterol, and other lipids within the endo-lysosomal compartment [34, 35]. The abnormal lysosomal lipids accumulation might further lead to inhibition of Ca2+-dependent lysosomal trafficking that in turn, would amplify pathological lysosomal storage and cause secondary defects [17, 36]. Moreover, dysfunctional lipid-laden lysosomes have also been implicated in atherosclerosis progression and metabolic disorders [15]. In a recent study, imipramine treatment has been reported to have broad impacts on lysosome lipid metabolism via inhibiting multiple pH-sensitive enzymes in lysosomes [27]. Consistent with our findings, another study also revealed that imipramine could significantly reduce cholesterol trafficking from lysosomes and promote endo-lysosomal cholesterol accumulation [37]. These results revealed that the enriched signaling pathways after imipramine treatment were mainly related to cholesterol-centric lipid metabolic pathways, highlighting a vital role for lysosomes in maintaining enterocyte lipid homeostasis.
Furthermore, related hub genes have been identified and confirmed by RT-PCR. The ATP binding cassette (ABC) transporters ABCG5 and ABCG8 are located on the apical membrane of enterocytes and hepatocytes, and responsible for excretion of cholesterol and phytosterols into the intestinal lumen when their contents exceed the cellular demands [38, 39]. In the current study, the gene expression levels of ABCG5 and ABCG8 were significantly up-regulated after imipramine treatment, implying an abnormal deposition of cholesterol in enterocytes. The expression levels of LCAT, an enzyme contributing to cholesterol efflux from peripheral tissues via extracellular cholesterol esterification [40], as well as FABP1, an intracellular fatty acid carrier regulating lipid assimilation and transport [41], were also up-regulated after imipramine treatment. Consistently, disrupted lipid homeostasis was also observed in IUGR piglets with abnormal retention of foetal enterocytes, characterized by elevated TC and LDL-C levels, reduced TG concentration, along with suppressed FABP2 and FABP4 expression [42, 43]. The observed up-regulation of hub genes in our study might be a consequence of intracellular cholesterol accumulation arising from impaired lysosomal function. Nevertheless, the precise mechanisms driving these alterations require further investigation. Apolipoproteins (Apo), specialized protein components of plasma lipoproteins, play important roles in lipoprotein metabolism and lipid transport [44]. They are classified into various classes, such as ApoA, ApoB, ApoC and ApoE, each of which has different functions. ApoA1 is synthesized in the liver and intestine, and constitutes 70% of HDL apolipoproteins which are crucial for reverse cholesterol transport [45], while ApoA2 accounts for 20% of HDL protein. There are two circulating forms of ApoB, intestinal ApoB48 and hepatic ApoB100. ApoB48 forms the backbone of chylomicrons while ApoB100 is the major structural component of VLDL, IDL and LDL [44]. In the present study, the expression levels of APOA2 and APOC4 have been significantly up-regulated following imipramine treatment. Our ELISA assay further revealed a dramatic increase in serum ApoA1 concentration and a remarkable reduction of serum ApoB in piglets with imipramine administration, indicating an imbalance between ApoA1 and ApoB in piglets. Moreover, there was an opposite trend in levels of these two apolipoproteins in ileal mucosa compared to serum. One possible explanation for this observation is that lysosomal dysfunction induced by imipramine disrupts cholesterol metabolism in ileal enterocytes, elevating ApoB secretion from the ileum. This could result in systemic remnant accumulation, which in turn triggers a compensatory rise in hepatic ApoA1 synthesis, thereby generating the opposing serum-to-mucosal ratio pattern. Moreover, gut microbiota has recently been reported to reduce the endocytic rate and to down-regulate the expression of lysosomal protease genes in lysosome-rich enterocytes of zebrafish larvae. In turn, this impaired enterocyte function reshaped the microbiota [46]. Given imipramine’s in vitro antimicrobial activity [47], either the drug itself or the induced lysosomal dysfunction in foetal enterocytes, may shift the gut microbiota, thereby contributing to lipid metabolic disturbances observed in our study. Therefore, future work is warranted to elucidate how lysosomal-microbiota crosstalk regulates intestinal lipid homeostasis, and how lysosomal dysfunction alters metabolism, using rescue assays or isolated enterocytes. These findings suggest that abnormalities in foetal-type enterocytes triggered by imipramine might further induce dysregulated lipid transport and metabolism in neonatal piglets during early life. Given the potential off-target or systemic effects of imipramine, its impact on other tissues, particularly the nervous and immune systems, remains to be determined.
Conclusions
Taken together, these results demonstrate that lysosome-enriched foetal enterocytes were present in the ileum of 7-day-old neonatal piglets, but absent in 27-day-old piglets. Moreover, lysosome dysfunction induced by imipramine resulted in significant growth retardation, accompanied by pronounced morphological and ultrastructural alterations in ileal enterocytes, and disrupted lipid metabolism at postnatal day 7; however, no such effect was observed in 27-day-old piglets, suggesting a critical time window for lysosomal function in early life. These findings may advance our understanding of the essential role of lysosomes in neonatal intestinal maturation and nutrient processing, with potential implications for neonatal management strategies. Subsequent experiments involving different sexes, larger sample sizes, and various lysosomal inhibitors will be conducted to validate mechanistic specificity.
Supplementary Information
Acknowledgements
Not applicable.
Abbreviations
- ABCG5
ATP binding cassette subfamily g member 5
- ABCG8
ATP binding cassette subfamily g member 8
- AB-PAS
Alcian blue-periodic acid-Schiff
- ApoA1
Apolipoprotein A1
- APOA2
Apolipoprotein A2
- ApoB
Apolipoprotein B
- APOC4
Apolipoprotein C4
- ASM
Acid sphingomyelinase
- BECN1
Beclin 1
- DEG
Differentially expressed gene
- FABP1
Fatty acid binding protein 1
- GO
Gene ontology
- GPX1
Glutathione peroxidase 1
- GPX4
Glutathione peroxidase 4
- H&E
Hematoxylin and eosin
- HDL-C
High-density lipoprotein-cholesterol
- IUGR
Intrauterine growth retarded
- KEGG
Kyoto encyclopedia of genes and genomes
- LCAT
Lecithin-cholesterol acyltransferase
- LDL-C
Low-density lipoprotein-cholesterol
- LSD
Lysosomal storage disorder
- MAP1LC3B
Microtubule associated protein 1 light chain 3 beta
- PINK1
PTEN induced kinase 1
- PRKN
Parkin RBR E3 ubiquitin protein ligase
- SOD1
Superoxide dismutase 1
- SOD2
Superoxide dismutase 2
- TBA
Total bile acid
- TC
Total cholesterol
- TEM
Transmission electron microscopy
- TG
Triglyceride
Authors’ contributions
HW and WL performed the experimental work and analyzed results. YT and RZ wrote the first draft of the manuscript. YL and HY designed the project and revised the manuscript. All authors read and approved the final manuscript.
Funding
This work was supported by the Hunan Provincial Natural Science Foundation (2024JJ5257) and the Hunan Education Department (24B0056).
Data availability
All data will be available upon reasonable request from the corresponding author, and the datasets analyzed during the current study are available from https://figshare.com/articles/dataset/DEGs_FOR_PIGLETS/29279180?file=55263683.
Declarations
Ethics approval and consent to participate
All animal procedures used in the current study were approved by the Hunan Normal University Animal Care and Use Committee (2023 − 440), and carried out in accordance with the ARRIVE 2.0 standards. Since the animals were commercially purchased for research purposes, informed consent from owners was not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Yali Li, Email: yalili@hunnu.edu.cn.
Huansheng Yang, Email: yhs@hunnu.edu.cn.
References
- 1.Skrzypek T, Szymańczyk S, Ferenc K, Kazimierczak W, Szczepaniak K, Zabielski R. The contribution of vacuolated foetal-type enterocytes in the process of maturation of the small intestine in piglets. J Anim Feed Sci. 2018;27:187–201. [Google Scholar]
- 2.Weström B, Arévalo Sureda E, Pierzynowska K, Pierzynowski SG, Pérez-Cano FJ. The immature gut barrier and its importance in Establishing immunity in newborn mammals. Front Immunol. 2020;11:1153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Deluco B, Wilson HL. Assessment of intestinal macromolecular absorption in young piglets to pave the way to oral vaccination: preliminary results. Vet Res Commun. 2022;46(1):79–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Baintner K. Transmission of antibodies from mother to young: evolutionary strategies in a proteolytic environment. Vet Immunol Immunop. 2007;117(3–4):153–61. [DOI] [PubMed] [Google Scholar]
- 5.Weström BR, Ohlsson BG, Svendsen J, Tagesson C, Karlsson BW. Intestinal transmission of macromolecules (BSA and FITC-dextran) in the neonatal pig: enhancing effect of colostrum, proteins and proteinase inhibitors. Biol Neonate. 1985;47(6):359–66. [DOI] [PubMed] [Google Scholar]
- 6.Sangild PT, Trahair JF, Loftager MK, Fowden AL. Intestinal macromolecule absorption in the fetal pig after infusion of colostrum in utero. Pediatr Res. 1999;45:595–602. [DOI] [PubMed] [Google Scholar]
- 7.Clarke RM, Hardy RN. Histological changes in the small intestine of the young pig and their relation to macromolecular uptake. J Anat. 1971;108:63–77. [PMC free article] [PubMed] [Google Scholar]
- 8.Skrzypek T, Valverde Piedra JL, Skrzypek H, Kazimierczak W, Biernat M, Zabielski R. Gradual disappearance of vacuolated enterocytes in the small intestine of neonatal piglets. J Physiol Pharmacol. 2007;58(Suppl 3):87–95. [PubMed] [Google Scholar]
- 9.Rådberg K, Biernat M, Linderoth A, Zabielski R, Pierzynowski SG, Weström BR. Enteral exposure to crude red kidney bean lectin induces maturation of the gut in suckling pigs. J Anim Sci. 2001;79(10):2669–78. [DOI] [PubMed] [Google Scholar]
- 10.Harper J, Mould A, Andrews RM, Bikoff EK, Robertson EJ. The transcriptional repressor Blimp1/Prdm1 regulates postnatal reprogramming of intestinal enterocytes. P Natl Acad Sci USA. 2011;108(26):10585–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Muncan V, Heijmans J, Krasinski SD, Buller NV, Wildenberg ME, Meisner S, et al. Blimp1 regulates the transition of neonatal to adult intestinal epithelium. Nat Commun. 2011;2:452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Rodriguez-Fraticelli AE, Bagwell J, Bosch-Fortea M, Boncompain G, Reglero-Real N, Garcia-Leon MJ, et al. Developmental regulation of apical endocytosis controls epithelial patterning in vertebrate tubular organs. Nat Cell Biol. 2015;17(3):241–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Remis NN, Wiwatpanit T, Castiglioni AJ, Flores EN, Cantu JA, Garcia-Anoveros J. Mucolipin co-deficiency causes accelerated endolysosomal vacuolation of enterocytes and failure-to-thrive from birth to weaning. PLoS Genet. 2014;10(12):e1004833. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.de Duve C. The lysosome turns Fifty. Nat Cell Biol. 2005;7(9):847–9. [DOI] [PubMed] [Google Scholar]
- 15.Marques ARA, Ramos C, Machado-Oliveira G, Vieira OV. Lysosome (Dys)function in atherosclerosis-a big weight on the shoulders of a small organelle. Front Cell Dev Biol. 2021;9:658995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Weiss N. Cross-talk between TRPML1 channel, lipids and lysosomal storage diseases. Commun Integr Biol. 2012;5(2):111–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Shen D, Wang X, Li X, Zhang X, Yao Z, Dibble S, et al. Lipid storage disorders block lysosomal trafficking by inhibiting a TRP channel and lysosomal calcium release. Nat Commun. 2012;3:731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Park J, Levic DS, Sumigray KD, Bagwell J, Eroglu O, Block CL, et al. Lysosome-rich enterocytes mediate protein absorption in the vertebrate gut. Dev Cell. 2019;51(1):7–20. e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Mickiewicz M, Zabielski R, Grenier B, Le Normand L, Savary G, Holst JJ, et al. Structural and functional development of small intestine in intrauterine growth retarded Porcine offspring born to gilts fed diets with differing protein ratios throughout pregnancy. J Physiol Pharmacol. 2012;63(3):225–39. [PubMed] [Google Scholar]
- 20.Ferenc K, Pietrzak P, Godlewski MM, Piwowarski J, Kiliańczyk R, Guilloteau P, et al. Intrauterine growth retarded piglet as a model for humans-studies on the perinatal development of the gut structure and function. Reprod Biol. 2014;14(1):51–60. [DOI] [PubMed] [Google Scholar]
- 21.Ferenc K, Pilzys T, Skrzypek T, Garbicz D, Marcinkowski M, Dylewska M et al. Structure and function of enterocyte in intrauterine growth retarded pig neonates. Dis Markers. 2017; 5238134. [DOI] [PMC free article] [PubMed]
- 22.Yang J, Qu JM, Summah H, Zhang J, Zhu YG, Jiang HN. Protective effects of Imipramine in murine endotoxin-induced acute lung injury. Eur J Pharmacol. 2010;638(1–3):128–33. [DOI] [PubMed] [Google Scholar]
- 23.Biswas R, Trout KL, Jessop F, Harkema JR, Holian A. Imipramine blocks acute silicosis in a mouse model. Part Fibre Toxicol. 2017;14(1):36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Smith MW, Peacock MA. Anomalous replacement of foetal enterocytes in the neonatal pig. Proc R Soc Lond B Biol Sci. 1980;206(1165):411–20. [DOI] [PubMed] [Google Scholar]
- 25.von Bismarck P, Wistädt CF, Klemm K, Winoto-Morbach S, Uhlig U, Schütze S, et al. Improved pulmonary function by acid Sphingomyelinase Inhibition in a newborn piglet lavage model. Am J Respir Crit Care Med. 2008;177(11):1233–41. [DOI] [PubMed] [Google Scholar]
- 26.Funk RS, Krise JP. Cationic amphiphilic drugs cause a marked expansion of apparent lysosomal volume: implications for an intracellular distribution-based drug interaction. Mol Pharm. 2012;9(5):1384–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Albright JM, Sydor MJ, Shannahan J, Ferreira CR, Holian A. Imipramine treatment alters sphingomyelin, cholesterol, and glycerophospholipid metabolism in isolated macrophage lysosomes. Biomolecules. 2023; 13(12). [DOI] [PMC free article] [PubMed]
- 28.Zhang X, Gao N. Formation of giant lysosome in neonatal ileal enterocytes requires endotubin. Cell Mol Gastroenterol Hepatol. 2017;5(2):167–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Moriwaki T, Terawaki S, Otomo T. Impaired lysosomal acidity maintenance in acid lipase-deficient cells leads to defective autophagy. J Biol Chem. 2024;300(3):105743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Stepien KM, Cufflin N, Donald A, Jones S, Church H, Hargreaves IP. Secondary mitochondrial dysfunction as a cause of neurodegenerative dysfunction in lysosomal storage diseases and an overview of potential therapies. Int J Mol Sci. 2022;23(18):10573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Thelen AM, Zoncu R. Emerging roles for the lysosome in lipid metabolism. Trends Cell Biol. 2017;27(11):833–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Metzler-Zebeli BU. The role of dietary and microbial fatty acids in the control of inflammation in neonatal piglets. Animals. 2021; 11(10). [DOI] [PMC free article] [PubMed]
- 33.Linke T, Wilkening G, Lansmann S, Moczall H, Bartelsen O, Weisgerber J, et al. Stimulation of acid Sphingomyelinase activity by lysosomal lipids and sphingolipid activator proteins. Biol Chem. 2001;382(2):283–90. [DOI] [PubMed] [Google Scholar]
- 34.Sandhoff K. Metabolic and cellular bases of sphingolipidoses. Biochem Soc Trans. 2013;41(6):1562–8. [DOI] [PubMed] [Google Scholar]
- 35.Jenkins RW, Canals D, Hannun YA. Roles and regulation of secretory and lysosomal acid Sphingomyelinase. Cell Signal. 2009;21(6):836–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Devlin C, Pipalia NH, Liao X, Schuchman EH, Maxfield FR, Tabas I. Improvement in lipid and protein trafficking in Niemann-Pick C1 cells by correction of a secondary enzyme defect. Traffic. 2010;11(5):601–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Kendall RL, Holian A. Cholesterol-dependent molecular mechanisms contribute to cationic amphiphilic drugs’ prevention of silica-induced inflammation. Eur J Cell Biol. 2023;102(2):151310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yu XH, Qian K, Jiang N, Zheng XL, Cayabyab FS, Tang CK. ABCG5/ABCG8 in cholesterol excretion and atherosclerosis. Clin Chim Acta. 2014;428:82–8. [DOI] [PubMed] [Google Scholar]
- 39.Huang B, Song BL, Xu C. Cholesterol metabolism in cancer: mechanisms and therapeutic opportunities. Nat Metab. 2020;2(2):132–41. [DOI] [PubMed] [Google Scholar]
- 40.Kessler EC, Gross JJ, Bruckmaier RM, Albrecht C. Cholesterol metabolism, transport, and hepatic regulation in dairy cows during transition and early lactation. J Dairy Sci. 2014;97(9):5481–90. [DOI] [PubMed] [Google Scholar]
- 41.Huang X, Zhou Y, Sun Y, Wang Q. Intestinal fatty acid binding protein: A rising therapeutic target in lipid metabolism. Prog Lipid Res. 2022;87:101178. [DOI] [PubMed] [Google Scholar]
- 42.Huang S, Wu Z, Li T, Liu C, Han D, Tao S, et al. Perturbation of the lipid metabolism and intestinal inflammation in growing pigs with low birth weight is associated with the alterations of gut microbiota. Sci Total Environ. 2020;719:137382. [DOI] [PubMed] [Google Scholar]
- 43.Huang S, Wu Z, Yuan X, Li N, Li T, Wang J, et al. Transcriptome differences suggest novel mechanisms for intrauterine growth restriction mediated dysfunction in small intestine of neonatal piglets. Front Physiol. 2020;11:561. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Mehta A, Shapiro MD. Apolipoproteins in vascular biology and atherosclerotic disease. Nat Rev Cardiol. 2022;19(3):168–79. [DOI] [PubMed] [Google Scholar]
- 45.Bhale AS, Venkataraman K. Leveraging knowledge of HDLs major protein ApoA1: Structure, function, mutations, and potential therapeutics. Biomed Pharmacother. 2022;154:113634. [DOI] [PubMed] [Google Scholar]
- 46.Childers L, Park J, Wang S, Liu R, Barry R, Watts SA, et al. Protein absorption in the zebrafish gut is regulated by interactions between lysosome rich enterocytes and the Microbiome. Elife. 2025;13:RP100611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Csiszar K, Molnar J. Mechanism of action of tricyclic drugs on Escherichia coli and Yersinia Enterocolitica plasmid maintenance and replication. Anticancer Res. 1992;12(6B):2267–72. [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data will be available upon reasonable request from the corresponding author, and the datasets analyzed during the current study are available from https://figshare.com/articles/dataset/DEGs_FOR_PIGLETS/29279180?file=55263683.








