Abstract
Background
Porphyromonas gingivalis lipopolysaccharide (P.g-LPS), a key virulence factor in periodontitis, contributes to systemic vascular diseases, notably atherosclerosis. MicroRNA-21 (miR-21), a critical post-transcriptional regulator, influences inflammation and vascular pathology, but its role in endothelial responses to P.g-LPS remains unclear.
Methods
Gingival biopsies from eight patients with periodontitis and eight healthy controls were analyzed using immunofluorescence co-labeling for Cluster of Differentiation 31 (CD31) with TUNEL or Interleukin-6 (IL-6) to assess endothelial apoptosis and inflammation. MiR-21 levels were quantified using quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR). Human umbilical vein endothelial cells (HUVECs) were treated with P.g-LPS and transfected with miR-21 mimics or inhibitors. Apoptosis, proliferation, and migration were evaluated by flow cytometry, Cell Counting Kit-8 (CCK-8) assay, and wound healing analysis, respectively. Western blotting and Enzyme-Linked Immunosorbent Assay(ELISA) measured inflammatory and apoptotic markers. Luciferase reporter assays confirmed that PDCD4 was a direct target of miR-21, and the effects of Programmed Cell Death 4(PDCD4) knockdown on Nuclear Factor kappa B (NF-κB)/Inducible Nitric Oxide Synthase (iNOS)/Nitric Oxide (NO) signaling were examined.
Results
Endothelial cells from patients with periodontitis exhibited increased apoptosis and inflammation. P.g-LPS significantly reduced miR-21 expression in HUVECs. MiR-21 inhibition exacerbated apoptosis and inflammatory mediator expression, while suppressing proliferation and migration.MiR-21 overexpression mitigated these effects. PDCD4 was validated as a direct miR-21 target. Suppression of miR-21 enhanced NF-κB/iNOS/NO activation, and PDCD4 knockdown attenuated this pathway, indicating a regulatory mechanism.
Conclusion
MiR-21 acts as a protective regulator against P.g-LPS-induced endothelial injury by targeting PDCD4 and modulating the NF-κB/iNOS/NO pathway, thereby reducing inflammation and apoptosis. These findings indicate that miR-21 is a potential therapeutic target for vascular complications associated with chronic inflammatory diseases like periodontitis.
Keywords: MiR-21, P.g-LPS, HUVECs, Apoptosis, Inflammation, NF-κB, PDCD4
1. Introduction
Periodontitis is a chronic, multifactorial inflammatory disorder that results in progressive destruction of the supporting structures of the teeth. It is initiated by microbial biofilms and is perpetuated by dysregulated host immune responses. While its local effects on dental health are well-recognized, accumulating research has established its far-reaching impact on systemic conditions, especially cardiovascular diseases. One such link is atherosclerosis (AS), a chronic inflammatory condition of the arterial wall characterized by endothelial dysfunction, lipid accumulation, and immune cell infiltration [1,2].
Porphyromonas gingivalis has emerged as a keystone organism among the microbial pathogens associated with periodontal disease. Porphyromonas gingivalis lipopolysaccharide (P.g-LPS) is known to cross compromised epithelial barriers and enter the systemic circulation, contributing to vascular inflammation and endothelial activation [3,4]. Studies have shown that P.g-LPS can stimulate Toll-like receptor (TLR)-mediated signaling in vascular cells, upregulating proinflammatory cytokines, adhesion molecules, and oxidative stress pathways [[5], [6], [7]]. In murine models, continuous infusion of P.g-LPS accelerates atheromatous plaque formation, particularly in genetically susceptible mice such as those lacking apolipoprotein E (ApoE−/−), highlighting its systemic impact [5]. At the molecular level, the endothelium is a key site for the atherogenic processes. Vascular endothelial cells (VECs), which form the innermost lining of the blood vessels, are highly sensitive to oxidative and inflammatory stimuli. Apoptosis and dysfunction of these cells disrupt vascular homeostasis, enhance permeability, and facilitate monocyte adhesion, which are the early hallmarks of atherogenesis.
MicroRNAs (miRNAs) are small (∼22 nucleotides), non-coding RNAs that fine-tune gene expression by binding to complementary sequences in target mRNAs, resulting in translational repression or degradation [8]. These regulatory molecules are involved in virtually every biological process, including immune modulation, angiogenesis, oxidative stress, and apoptosis [[9], [10], [11], [12]]. Among these, microRNA-21 (miR-21) has garnered particular attention for its dual roles in promoting cell survival and regulating inflammatory responses. Aberrant expression of miR-21 has been documented in a variety of pathological contexts, ranging from cancer to fibrotic and cardiovascular diseases [13]. MiR-21 is abundantly expressed in endothelial and smooth muscle cells. It has been reported to protect against endothelial apoptosis, enhance nitric oxide production, and modulate inflammation by targeting multiple genes, including Phosphatase and Tensin Homolog (PTEN), Sprouty RTK Signaling Antagonist 1 (SPRY1), and Programmed Cell Death 4 (PDCD4) [[14], [15], [16]]. In models of vascular injury and ischemia-reperfusion, miR-21 has demonstrated anti-apoptotic and pro-survival effects. Conversely, loss of miR-21 in macrophages exacerbates inflammation and accelerates atherosclerotic lesion development, reinforcing its cardioprotective function.
The Nuclear Factor kappa B (NF-κB)/Inducible Nitric Oxide Synthase (iNOS)/Nitric Oxide (NO) signaling axis is of particular interest in atherosclerosis research. NF-κB is the master regulator of inflammatory gene expression, whereas iNOS promotes NO overproduction in response to inflammatory stimuli. Although NO is vasodilatory and protective at the physiological level, its dysregulation contributes to oxidative stress and endothelial damage during chronic inflammation. Targeting this pathway represents a strategic approach to mitigating vascular injury during atherogenesis. Yang et al. further showed that miR-21 overexpression modulates the Dimethylarginine Dimethylaminohydrolase1 (DDAH1)/Asymmetric Dimethylarginine (ADMA)/Endothelial Nitric Oxide Synthase (eNOS)/NO axis, increasing endothelial NO output and reducing oxidative stress. These findings align with the broader paradigm that miR-21 maintains vascular homeostasis under stress. However, the specific regulatory role of miR-21 in P.g-LPS-induced endothelial dysfunction remains largely unknown, and a recent meta-analysis of endothelial transcriptomic datasets further emphasized the pervasive role of miRNAs in vascular pathophysiology. Among these, miR-21 has emerged as a hub regulator influencing a broad network of inflammatory and apoptotic pathways. This supports its candidacy as a potential target for intervention in systemic inflammation-associated vascular disorders.
To address this knowledge gap, we designed a study to investigate the function of miR-21 in endothelial inflammation and apoptosis induced by P.g-LPS. Using both patient-derived gingival tissues and cultured human umbilical vein endothelial cells (HUVECs), we assessed the expression patterns of miR-21 and characterized its downstream effects on apoptosis, inflammation, and key regulatory targets, including PDCD4 and the NF-κB/iNOS/NO signaling pathway. Our central hypothesis posits that miR-21 acts as a negative regulator of P.g-LPS-induced vascular injury by directly targeting PDCD4 and suppressing the proinflammatory and pro-apoptotic pathways.
2. Materials and methods
2.1. Participant selection and tissue procurement
This study enrolled adult participants from the Department of Stomatology, First Affiliated Hospital of Sun Yat-sen University between January and June 2020. The participants were grouped based on their periodontal health status. The periodontitis group included individuals diagnosed with Stage III or IV disease according to the 2018 classification (interdental clinical attachment loss ≥5 mm and radiographic bone loss extending to or beyond one-third of the root), whereas healthy controls exhibited intact or stable periodontia with probing depths of ≤3 mm and minimal bleeding on probing (<10 %). Each group consisted of eight participants, matched by age and gender distribution (periodontitis: 4 males, 4 females, ages 37–58; controls: 5 males, 3 females, ages 29–47). Gingival tissues were collected during the scheduled oral surgery, periodontal flap surgery, or third molar extraction. Participants with systemic diseases (e.g., cardiovascular or autoimmune conditions), recent infections, or antibiotic or anti-inflammatory medication use within three months were excluded. The study procedures received ethical approval (IEC Ref: 2020306) and informed consent was obtained from all subjects prior to sampling.
2.2. Double immunofluorescence staining
Tissue sections were initially blocked with 10 % goat serum for 30 min at ambient temperature to prevent nonspecific binding. Subsequently, cells were permeabilized with a solution of 0.1 % Triton X-100 combined with 0.3 % Tween-20 for another 30 min. Following this, the sections were incubated overnight at 4 °C with primary antibodies, including anti-Cluster of Differentiation 31 (CD31) (Abcam, 1:1000) and anti-Interleukin-6 (IL-6) (PTG, 1:200). After rinsing with TBST, Alexa Fluor®-conjugated secondary antibodies (Thermo Fisher Scientific; donkey anti-rabbit IgG Alexa 594, A21207, 1:600; and donkey anti-mouse IgG Alexa 488, A21202, 1:400) were applied for 1 h at room temperature. Nuclear staining was performed using 4′,6-Diamidino-2-Phenylindole (DAPI) (Solarbio, C0065, 1:500) before image capture using a BX53 fluorescence microscope (Olympus, Japan). The coverslips with cells were incubated with goat anti-human Zonula Occludens-1 (ZO-1) primary antibody (Proteintech, 21773-1-AP, 1:200) overnight at 4 °C. Subsequently, the coverslips were washed and incubated with a donkey anti-goat IgG FITC-conjugated secondary antibody (1:500) for 2 h at room temperature away from light. The cells were washed, incubated with DAPI for 5 min at room temperature, and washed again. Finally, the coverslips were mounted with aqueous anti-fade mounting medium on microscope slides, and the edges of the coverslips were sealed with colorless nail polish.
For the Terminal Deoxynucleotidyl Transferase dUTP Nick-End Labeling (TUNEL) assay, sections were processed using the One-Step TUNEL Apoptosis Assay Kit (Beyotime, C1086) according to the manufacturer's guidelines.
2.3. Cell culture and transfection
HUVECs obtained from American Type Culture Collection (ATCC) were maintained in an endothelial cell medium supplemented with 10 % fetal bovine serum at 37 °C in a humidified atmosphere containing 5 % CO2 and 95 % air. All assays were performed using cells between passages three and six. HUVECs at 70–80 % confluence were exposed to P.g-LPS at concentrations of 0, 0.01, 0.1, or 1 μg/mL for 12, 24, or 32 h. HEK-293T cells were grown in Dulbecco's modified Eagle's medium (DMEM) with 10 % FBS.
HUVECs at ∼60 % confluence were transfected using Lipofectamine 2000 with the following reagents: miR-21 inhibitor, negative control inhibitor (inhibitor NC), miR-21 mimic, negative control mimic (mimic NC), PDCD4-targeting siRNA (si-PDCD4), or si-PDCD4 negative control (si-PDCD4 NC). After 6 h, the transfection medium was replaced with fresh culture medium and the cells were prepared for subsequent experiments.
2.4. Dual-luciferase reporter assay
To investigate the regulatory relationship between miR-21 and PDCD4, putative binding sites of miR-21 on the 3′-untranslated region (3′-UTR) of PDCD4 were identified using the TargetScan (https://www.targetscan.org) prediction tool. The wild-type (PDCD4-wt) and mutant (PDCD4-mut) 3′-UTR sequences of PDCD4 were amplified and subcloned into the psiCHECK™-2 luciferase reporter vector (Promega, C8021).
Human embryonic kidney cells (HEK-293T) were then co-transfected with these luciferase reporter constructs along with either miR-21 mimic, miR-21 inhibitor, or a negative control using Lipofectamine® 2000 reagent. After 48 h, luciferase activity was measured using the Dual-Luciferase® Reporter Assay System (Promega, E1910) and quantified using a GloMax® 96 Microplate Luminometer (Promega).
Relative luciferase activity normalized to Renilla luciferase was used to assess the direct interaction between miR-21 and the PDCD4 3′-UTR. Mutation of miR-21 binding sites confirmed the specificity of this regulatory interaction.
2.5. Viability, migration, and apoptosis assays
Cell viability was assessed using the Cell Counting Kit-8 (Dojindo, CK04-13) according to the standard protocol. For scratch assays, a straight wound line was introduced using a 200 μL pipette tip. After washing with PBS, the cells were cultured in serum-free medium and imaged at 0 h and 12 h (Olympus CKX53×, 100 × magnification). Flow cytometric detection of apoptosis was performed using the Annexin V-FITC/PI Apoptosis Detection Kit (BD Biosciences, 556547). The cells were harvested, stained, and analyzed using CytoFLEX S (Beckman Coulter).
2.6. Annexin V/propidium iodide (PI) double staining assay
Cell apoptosis was detected using an Annexin Vascular Fluorescein Isothiocyanate (V-FITC)/PI Apoptosis Detection Kit (BD Pharmingen, USA). Briefly, after stimulation, cells were collected and washed with PBS. The cell pellet was resuspended in binding buffer and Annexin V-FITC and propidium iodide (PI) were used. Flow cytometry analysis was performed using FACScan (CytoFLEX S, Beckman Coulter, USA). The apoptosis ratio was calculated as the number of apoptotic cells (right upper quadrant plus right lower quadrant)/total number of cells.
2.7. TUNEL assay
For the detection of DNA fragmentation, tissue sections were first blocked with 10 % goat serum for 30 min at room temperature, followed by permeabilization using 0.1 % Triton X-100 at 37 °C for 8 min. After thorough washing with TBS, the slides were incubated with the TUNEL reaction mixture in a humid chamber at 37 °C for 1 h, then rinsed again with TBS. DAPI was used to counterstain the nuclei. Images were obtained using a Leica TCS SP5 confocal microscope (Leica, Wetzlar, Germany). To assess apoptosis, cells from the experimental groups were fixed with 4 % paraformaldehyde, and TUNEL staining was performed using the One Step TUNEL Apoptosis Assay Kit (Beyotime Biotechnology, China) following the manufacturer's protocol.
2.8. Western blot analysis
Total protein was extracted from HUVECs using RIPA lysis buffer (Beyotime Biotechnology, China) and quantified using a BCA protein assay kit (Thermo, USA). Equivalent amounts of protein were loaded onto SDS-PAGE gels, separated electrophoretically, and transferred to PVDF membranes (Roche, Indianapolis, IN, USA) at room temperature. The membranes were probed with primary antibodies against NF-κB (1:1000, Cell Signaling Technology, Danvers, MA, USA), iNOS (1:1000, Cell Signaling Technology), PDCD4 (1:1000, Cell Signaling Technology), Bcl-2-associated X protein (Bax) (1:1000, Cell Signaling Technology), and cleaved caspase-3 (1:1000, Cell Signaling Technology). After incubation with HRP-conjugated anti-rabbit IgG secondary antibodies, the protein bands were visualized using an ECL chemiluminescence detection system (Amersham Imager 600, General Electric Company, USA). Densitometric analysis was performed using ImageJ software.
2.9. Quantitative real-time PCR
RNA was extracted using TRIzol™ reagent (Invitrogen, 15596026) and purity was assessed by measuring the absorbance ratios (A260/A280) using a NanoDrop 2000 spectrophotometer. RNA integrity was confirmed using agarose gel electrophoresis to confirm the presence of distinct 28S and 18S rRNA bands before downstream cDNA synthesis. Reverse transcription was performed using a Color Reverse Transcription Kit (A0010; EZBioscience) with integrated genomic DNA removal. Negative controls lacking reverse transcriptase were used to monitor genomic DNA contamination. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR) was performed on a Bio-Rad CFX96 system using SYBR Green Master Mix (TaKaRa Bio). Primer sequences: miR-21 (forward: TAGCTTATCAGACTGATGTTGA), U6 (forward: GCTTCGGCAGCACATATACTAAAAT), PDCD4, and GAPDH. miRNA expression was normalized to U6, and mRNA expression was normalized to GAPDH using the 2^−ΔΔCt method.
2.10. Flow cytometry for nitric oxide detection
To quantify NO production, HUVECs were incubated with 5 μM DAF-FM DA (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Beyotime, S0019) in serum-free medium at 37 °C for 20 min in the dark. Following incubation, the cells were washed twice with PBS to remove excess dye and harvested for flow cytometric analysis using a CytoFLEX S flow cytometer (Beckman Coulter). The fluorescence intensity corresponding to intracellular NO levels was measured at excitation/emission wavelengths of 495/515 nm, and the mean fluorescence intensity (MFI) was used as a quantitative indicator.
2.11. Enzyme-Linked Immunosorbent Assay (ELISA)
Culture supernatants were collected post-treatment to evaluate secreted cytokines. Quantification of IL-6, tumor necrosis factor-alpha (TNF-α), and interleukin-1 beta (IL-1β) was performed using commercially available ELISA kits (R&D Systems), according to the manufacturer's protocols. Standard curves were generated from serial dilutions of known concentrations. The absorbance was measured at 450 nm using a microplate spectrophotometer (Bio-Rad). Cytokine concentrations were determined using a curve-fitting software based on a four-parameter logistic regression model.
2.12. Statistical analysis
All experiments were independently repeated in triplicate, unless otherwise stated. Technical replicates (n = 3) were included for quantitative assays such as qRT-PCR, ELISA, and Cell Counting Kit-8 (CCK-8) assays. All data were inspected for distribution normality using the Shapiro-Wilk test. Inter-group comparisons were conducted using Student's t-test or one-way Analysis of Variance (ANOVA) followed by Tukey's post hoc test, as appropriate. Results are expressed as the mean ± standard deviation (SD), and statistical significance was defined as P < 0.05.
3. Results
3.1. Elevated apoptotic markers and proinflammatory cytokines in gingival endothelium of periodontitis patients
To determine whether endothelial injury was prominent in gingival tissues from periodontitis patients, immunofluorescence colocalization analyses were performed using antibodies targeting the endothelial marker CD31 along with TUNEL for apoptosis or IL-6 for inflammation. In patients diagnosed with periodontitis, vascular structures revealed intense double-positive signals for CD31 and TUNEL, suggesting a significant increase in apoptotic activity within endothelial cells compared to healthy individuals, who exhibited only background fluorescence (Fig. 1a). A similar pattern was observed while probing for inflammatory changes. Co-staining of CD31 with IL-6 revealed elevated cytokine expression in the vascular compartment of periodontitis samples, with a signal largely absent in normal controls (Fig. 1b). These findings confirmed that chronic periodontitis is associated with heightened endothelial apoptosis and an inflammatory microenvironment, implicating local vascular dysfunction as a pathological feature of the disease.
Fig. 1.
Detection of apoptosis and inflammatory markers in the gingival vascular endothelium of patients with periodontitis and healthy controls. (a) Representative immunofluorescence images showing co-staining of the endothelial marker CD31 (red) with the apoptotic marker TUNEL (green) in gingival tissue sections. Intense green fluorescence in CD31-positive vessels indicates apoptotic endothelial cells in periodontitis specimens. (b) Colocalization of CD31 (red) and IL-6 (green) highlights the expression of inflammatory cytokines. Abbreviations: CD31 = Cluster of Differentiation 31 (endothelial cell marker); TUNEL = Terminal deoxynucleotidyl transferase dUTP nick end labeling; IL-6 = Interleukin-6.
3.2. P. gingivalis LPS impairs viability and induces apoptosis in cultured HUVECs
To mimic the inflammatory conditions associated with periodontal disease in vitro, HUVECs were challenged with various concentrations of P.g-LPS. Cell viability was measured using the CCK-8 assay at 12, 24, and 32 h post-exposure. A progressive reduction in cell survival was observed with increasing doses and durations, with statistically significant decreases noted at 0.1 and 1 μg/mL after 24 h (Fig. 2a). Consequently, the 24-h exposure window was selected for all subsequent mechanistic assays. ELISA revealed that treatment with 1 μg/mL P.g-LPS significantly upregulated IL-6 and TNF-α levels in the culture supernatants (Fig. 2b and c). Concurrently, immunoblotting demonstrated a marked elevation in the expression of the apoptosis-related proteins Bax and cleaved caspase-3 in HUVECs treated under these conditions (Fig. 2d and e). Analysis of the localization of tight junction proteins ZO-1 in HUVECs by immunofluorescence assay. Quantitative analysis of immunofluorescence revealed that ncrease in P.g-LPS and a decrease in the expression of tight junction protein ZO-1 (Fig. 2f and g). Collectively, these findings confirmed that exposure to pathogenic LPS compromises endothelial integrity through both inflammatory and apoptotic pathways.
Fig. 2.
Dose-and time-dependent induction of inflammation and apoptosis in HUVECs following P.g-LPS exposure. (a) CCK-8 assay demonstrating decreased cell viability after 12, 24, and 32-h incubation with P.g-LPS at concentrations ranging from 0 μg/mL to 1 μg/mL. (b–c) ELISA quantification of IL-6 and TNF-α in supernatants. (d–e) Western blot analysis showing increased expression of apoptotic markers Bax and cleaved caspase-3. β-actin was used as a loading control. (f–g) Immunofluorescence showed an increase in P.g-LPS and a decrease in the expression of tight junction protein ZO-1. All data are presented as the mean ± SD. ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001; ∗∗∗∗P < 0.0001.
Abbreviations: HUVECs = Human umbilical vein endothelial cells; P.g-LPS = Porphyromonas gingivalis lipopolysaccharide; CCK-8 = Cell Counting Kit-8; IL-6 = Interleukin-6; TNF-α = Tumor necrosis factor-alpha; ZO-1 = Zonula Occludens-1; SD = Standard deviation.
3.3. MiR-21 overexpression mitigates P.g-LPS-induced cellular dysfunction
To investigate whether miR-21 is involved in regulating endothelial responses to bacterial insults, quantitative PCR was performed to evaluate its expression in P.g-LPS-treated HUVECs. Dose-dependent suppression of miR-21 was evident, with maximal downregulation observed at 1 μg/mL (Fig. 3a). The cells were transfected with miR-21 mimics or inhibitors to directly test their roles. RT-qPCR validated the modulation of miR-21 expression (Fig. 3b). Functionally, miR-21 overexpression significantly restored cell viability, suppressed IL-6 and TNF-α production, and reduced apoptotic indices, as evidenced by TUNEL staining and flow cytometry (Fig. 3c–i). In contrast, miR-21 inhibition aggravated inflammatory cytokine release, leading to elevated apoptosis. Migration capacity, assessed by a wound healing assay, was also diminished by miR-21 silencing and partially restored by mimic transfection (Fig. 3j and k). These data suggest a protective role for miR-21 in preserving endothelial cell function under inflammatory stress.
Fig. 3.
Impact of miR-21 modulation on cell proliferation, apoptosis, cytokine secretion, and migration in P.g-LPS-treated HUVECs. (a) miR-21 levels were assessed by qRT-PCR after P.g-LPS treatment. (b) qRT-PCR results validating successful overexpression or knockdown of miR-21 following transfection with a mimic or inhibitor. (c–e) Cell viability and cytokine (IL-6 and TNF-α) secretion under different conditions. (f–g) Quantification of apoptosis using Annexin V/PI staining. (h, i) TUNEL staining was performed to quantify the proportion of apoptotic cells. (j, k) Wound healing assays were conducted to evaluate cell migration under different treatment conditions. Data are presented as mean ± standard deviation (n = 3). ∗P < 0.05. Results are representative of three independent experiments. Abbreviations: inhibitor NC = negative control for miR-21 inhibitor; inhibitor = miR-21 inhibitor; mimic NC = negative control for miR-21 mimic; mimic = miR-21 mimic.
3.4. PDCD4 is a functional target of miR-21 in endothelial cells
To dissect the downstream mechanisms by which miR-21 influences endothelial cell fate under inflammatory stress, we first performed an in silico analysis using TargetScan, which identified PDCD4 as a potential target. PDCD4 is a tumor suppressor that plays a pivotal role in modulating cellular apoptosis, proliferation, and inflammatory responses, and its dysregulation has been implicated in various cardiovascular- and immune-related pathologies.
We used a dual-luciferase reporter system in HUVECs to validate the predicted interactions. Constructs harboring either the wild-type or mutant 3′-untranslated region (UTR) of PDCD4 were co-transfected with miR-21 inhibitors. Cells transfected with the wild-type PDCD4 reporter showed a significant increase in luciferase activity upon miR-21 inhibition, consistent with relief from miRNA-mediated repression (Fig. 4b). In contrast, this effect was abrogated in cells transfected with the mutant PDCD4 3′-UTR construct, confirming the specificity of the binding site and the functional interaction between miR-21 and PDCD4 (Fig. 4a and b).
Fig. 4.
Validation of PDCD4 as a direct target of miR-21. (a) Sequence alignment of miR-21 and its complementary sites in the 3′-UTR of PDCD4. (b) Dual-luciferase reporter assay showing decreased luciferase activity in cells co-transfected with miR-21 mimic and the PDCD4 wild-type reporter. No changes were observed in the mutant reporters. (c) qRT-PCR analysis showing elevated PDCD4 mRNA expression after miR-21 inhibition. All experiments were performed in triplicates and analyzed for statistical significance. ∗P < 0.05.Abbreviations: miR-21 = microRNA-21; PDCD4 = Programmed Cell Death 4; 3′-UTR = 3′ untranslated region; WT = wild-type; MUT = mutant; qRT-PCR = quantitative Reverse Transcription Polymerase Chain Reaction.
Further validation was performed using qRT-PCR to assess endogenous PDCD4 expression in HUVECs. Consistent with the reporter assay results, transfection with miR-21 inhibitors led to a marked elevation in PDCD4 mRNA levels, whereas miR-21 mimics suppressed its expression (Fig. 4c). These findings demonstrated that miR-21 targets the PDCD4 transcript for post-transcriptional silencing in human endothelial cells.
These results substantiate the regulatory axis through which miR-21 negatively regulates PDCD4 expression. The upregulation of PDCD4 following miR-21 inhibition implicates this interaction as a crucial mechanism underlying the observed effects on apoptosis and inflammation in P.g-LPS-treated HUVECs. These results provided the basis for subsequent rescue experiments to determine whether PDCD4 silencing could mitigate the detrimental impact of miR-21 downregulation during inflammatory endothelial injury.
3.5. PDCD4 knockdown mitigates pathological effects of miR-21 inhibition
To explore the functional consequences of PDCD4 suppression, we employed siRNA-mediated knockdown strategies in HUVECs subjected to P.g-LPS stress. As expected, silencing of PDCD4 markedly decreased mRNA expression (Fig. 5a). Downregulation of PDCD4 rescued the inhibitory effects on cell viability and migration induced by the miR-21 inhibitor in P. g-LPS-treated HUVECs (Fig. 5b–i). In addition, PDCD4 inhibition undermined the increase in proinflammatory cytokine levels (Fig. 5c and d). Moreover, apoptosis was notably attenuated by PDCD4 knockdown, as demonstrated by decreased staining in TUNEL assays and lower apoptotic fractions in Annexin V/PI flow cytometry (Fig. 5e–h). These findings reinforce the notion that PDCD4 is a key mediator of miR-21-dependent protective responses, and suggest that its downregulation may buffer endothelial cells against inflammatory insults.
Fig. 5.
Functional rescue experiments confirmed that PDCD4 is a downstream effector of miR-21 in P.g-LPS-challenged HUVECs. (a) Validation of the PDCD4 knockdown efficiency using siRNA and qRT-PCR. (b–d) Cell viability and proinflammatory cytokine measurements showing recovery in PDCD4-silenced cells co-treated with miR-21 inhibitors. (e–h) Apoptosis was assessed by flow cytometry and TUNEL staining. (i–j) Wound healing assays illustrate the reversal of migration impairment caused by miR-21 inhibition of PDCD4 expression. Data are presented as mean ± standard deviation (n = 3). ∗P < 0.05. Abbreviations: HUVECs = human umbilical vein endothelial cells; P.g-LPS = Porphyromonas gingivalis lipopolysaccharide; qRT-PCR = quantitative reverse transcription polymerase chain reaction; siRNA = small interfering RNA; TUNEL = terminal deoxynucleotidyl transferase dUTP nick end labeling; PDCD4 = programmed cell death protein 4; miR-21 = microRNA-21.
3.6. NF-κB/iNOS/NO axis is a downstream target of the mir-21–PDCD4 pathway
To delineate the signaling mechanisms downstream of PDCD4, we examined the NF-κB/iNOS/NO pathway, which is known to govern inflammatory gene expression and endothelial homeostasis. Inhibition of miR-21 led to marked upregulation of NF-κB expression and enhanced transcription of iNOS, accompanied by elevated NO accumulation (Fig. 6a–e). Conversely, miR-21 overexpression showed an opposite trend, suggesting that miR-21 suppresses the expression of NF-κB and iNOS, as well as the activation of the NF-κB/iNOS/NO pathway.Furthermore, downregulation of miR-21 significantly promote the expression levels of pro-apoptotic proteins Bax and cleaved caspase-3 (Fig. 6f).
Fig. 6.
PDCD4 links miR-21 with NF-κB/iNOS/NO signaling and apoptotic pathways. (a–d) Expression of NF-κB and iNOS proteins in HUVECs treated with miR-21 inhibitors or mimics. (e) Quantitative analysis of intracellular NO levels using the DAF-FM DA probe. (f–g) Western blot results showing Bax and cleaved caspase-3 expression with and without PDCD4 silencing. (h) Restoration of NO levels following PDCD4 knockdown. All values represent mean ± SD of three independent experiments. ∗P < 0.05. Abbreviations: miR-21 = microRNA-21; PDCD4 = programmed cell death 4; NF-κB = nuclear factor kappa B; iNOS = inducible nitric oxide synthase; NO = nitric oxide; DAF-FM DA = 4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Bax = Bcl-2-associated X protein.
Notably, co-silencing of PDCD4 in the context of miR-21 knockdown reversed the overactivation of this proinflammatory cascade, resulting in decreased expression of NF-κB, iNOS, and reduced NO levels (Fig. 6f–h). These data established that the miR-21–PDCD4 axis modulates inflammatory signaling through this canonical pathway and underscores its potential as a therapeutic target in vascular inflammation.
4. Discussion
Atherosclerosis (AS) is associated with multiple vascular pathologies at anatomical sites [17]. Endothelial cell injury is a pivotal event in AS [18]. Endothelial dysfunction, which is characterized by increased endothelial cell proliferation, inflammation, and apoptosis, is widely accepted as an independent predictor of AS progression [12,[19], [20], [21]]. Epidemiological evidence supports a robust link between periodontitis and an elevated risk of AS [2]. We postulated that periodontitis-associated endothelial cell damage mediates this relationship. Our results indicated a marked increase in endothelial apoptosis and inflammatory responses in HUVECs from patients with periodontitis compared to those from healthy individuals. P.g-LPS, an important proinflammatory factor, can infiltrate the systemic circulation through compromised periodontal tissues, potentially contributing to AS pathogenesis [22]. Our study demonstrated that P.g-LPS significantly suppressed HUVECs proliferation. A 24-h exposure to P.g-LPS was identified as optimal based on the proliferative response and was therefore adopted for subsequent analyses. We observed enhanced apoptosis and inflammatory responses in HUVECs following 24-h exposure to P.g-LPS, suggesting a plausible mechanistic link between periodontitis and AS.
MicroRNA-21 (miR-21) has been implicated in various cellular processes, including apoptosis, cell invasion, and drug resistance [23,24]. Previous research has shown that reduced miRNA-21 levels inhibit HUVECs proliferation and angiogenic capacity [23]. Furthermore, miR-21 enhances endothelial function by elevating nitric oxide (NO) production and reducing apoptosis [25]. MiR-21 also plays an integral role in the regulation of inflammation. Elevated miRNA-21 expression decreases TNF-α production, whereas reduced miR-21 expression leads to higher TNF-α and IL-6 levels [26]. Notably, miRNA-21 expression is elevated in patients with periodontitis and mouse models of experimentally induced periodontitis. Increased miR-21 levels suppress proinflammatory cytokine release from macrophages, whereas miR-21 deficiency promotes cytokine secretion, underscoring its anti-inflammatory function both in vitro and in vivo [27]. Interestingly, our experiments revealed decreased miR-21 expression in HUVECs treated with P.g-LPS. Transfection of cells with miR-21 inhibitors reduced cell viability and migration, accompanied by elevated IL-6 and TNF-α production and increased apoptosis. Conversely, introducing miR-21 mimics reversed these effects, indicating a regulatory role for miR-21 in endothelial cell functionality and homeostasis.
Programmed cell death protein 4 (PDCD4) is known for its tumor suppressor activity and ability to induce apoptosis, thereby influencing cell growth and survival [28]. Accumulating evidence indicates that miR-21 modulates cellular behaviors primarily through direct or indirect interactions with PDCD4 [28,29]. It has been demonstrated that miR-21 promotes cell proliferation and inhibits apoptosis in neuroblastoma cells by reducing PDCD4 expression [30]. Feng et al. also reported that miR-21 overexpression effectively decreased PDCD4 mRNA and protein levels, highlighting its regulatory role in SH-SY5Y cell apoptosis [31]. We confirmed that PDCD4 is a direct miR-21 target, which is in line with previous research. It has been reported that miR-21 promotes invasiveness and angiogenesis in renal cell carcinoma cells through the PDCD4/c-Jun (AP-1) signaling pathway, which indirectly confirms that PDCD4 is a target of miR-21 [32]. Moreover, Zhang et al. knocked down miR-21 in exosomes in a mouse model of lupus nephritis induced by pristane, and observed that exosomes from Bone Marrow Mesenchymal Stromal Cells (BMMSCs) that were depleted of microRNA-16 (miR-16) and microRNA-21 (miR-21) failed to downregulate PDCD4 and PTEN in macrophages, respectively [33]. In our study,down-regulation of PDCD4 partially reversed the inhibitory effects of the miR-21 inhibitor on proliferation, apoptosis, and inflammation in P.g-LPS-treated HUVECs, reinforcing the hypothesis that miR-21 modulates endothelial cell biology by PDCD4 targeting.
While our data clearly highlight PDCD4 as a primary mediator of miR-21's effects in our specific experimental setting, we recognize that neglecting the potential contributions of PTEN, SPRY1, and their associated pathways would oversimplify the complexity of miR-21's regulatory network. For instance, Zhu et al. demonstrated that miR-21 directly targets PTEN, which in turn drives the anti-inflammatory polarization of macrophages—providing direct evidence for PTEN's role in miR-21-mediated immune regulation [34]. Additionally, other studies have shown that miR-21 can promote glycogen synthesis in hepatic stellate cells by targeting SPRY1 and Smad7, a mechanism that also mediates AngII-induced NOD-like receptor pyrin domain-containing 3 (NLRP3) inflammasome activation [35]. Collectively, these findings underscore that a comprehensive understanding of miR-21's multifaceted biological roles requires an integrative model, one that accounts for its context-dependent regulation of these diverse downstream targets across different cell types and pathological scenarios.
The NF-κB/iNOS/NO signaling pathway critically regulates vascular endothelial cell function and dysfunction. NF-κB is an essential transcriptional regulator that orchestrates numerous biological responses, including inflammatory and immune processes. MiR-21 has been shown to interact closely with NF-κB signaling [36]. For instance, miR-21 upregulation in LPS-induced human dental pulp cells (hDPCs) was linked to NF-κB suppression and decreased proinflammatory cytokine levels [37]. MiR-21-mediated PDCD4 targeting has also been linked to NF-κB downregulation [38]. Furthermore, miR-21 inhibition promotes NF-κB activation after LPS exposure, which correlates with increased proinflammatory cytokine production [27]. NF-κB activation, in turn, upregulates genes related to inflammation and immunity, notably inducible iNOS, leading to excessive NO production [39,40]. Under physiological conditions, endothelial NO production via eNOS phosphorylation exerts protective and anti-inflammatory effects. Conversely, excessive NO synthesis via iNOS under pathological conditions can induce apoptosis [41]. We found that miR-21 knockdown led to increased expression of NF-κB, iNOS, and NO. Further exploration revealed that PDCD4 downregulation mitigated the stimulatory effect of miR-21 inhibitors on the NF-κB/iNOS/NO pathway (Fig. 7). These results suggest that blocking NF-κB/iNOS/NO pathway activation may be therapeutically valuable for reducing endothelial inflammation and apoptosis.
Fig. 7.
Proposed working model summarizing the molecular mechanism by which miR-21 modulates inflammatory injury in P.g-LPS-stimulated HUVECs. Downregulation of miR-21 upregulates PDCD4, which activates NF-κB/iNOS/NO signaling, resulting in increased apoptosis and inflammation. In contrast, miR-21 overexpression inhibits this axis, restoring endothelial function and reducing proinflammatory responses. Abbreviations: miR-21 = microRNA-21; PDCD4 = Programmed Cell Death Protein 4; NF-κB = Nuclear Factor kappa-light-chain-enhancer of activated B cells; iNOS = inducible Nitric Oxide Synthase; NO = Nitric Oxide; P.g-LPS = Porphyromonas gingivalis lipopolysaccharide; HUVECs = Human Umbilical Vein Endothelial Cells.
This study has inherent limitations. Firstly, the relatively small sample size (n = 8) in current gingival sample collection may affect the statistical power and reliability of the results. Additionally, our research primarily demonstrates how miR-21 regulates P.g-LPS-triggered apoptosis and inflammatory response in HUVECs by targeting PDCD4 through the NF-κB/iNOS/NO pathway. However, the secretion mechanisms of miR-21 in endothelial cells, among other aspects, require further investigation in the future.
5. Conclusion
Our results revealed that miR-21 functions as a protective regulator in endothelial cells challenged with P.g-LPS, primarily through the suppression of PDCD4 and the downstream NF-κB/iNOS/NO inflammatory pathway. These insights enhance our understanding of the molecular mechanisms linking periodontal inflammation to vascular pathology, and identify miR-21 as a promising therapeutic target for limiting endothelial injury in chronic inflammatory diseases. Future translational efforts to modulate this pathway may yield novel interventions for improving oral and systemic vascular health.
CRediT authorship contribution statement
Jing Ren: Writing – original draft, Funding acquisition, Conceptualization. Huiqiong Zou: Writing – original draft, Conceptualization. Siyu Sun: Writing – original draft, Conceptualization. Shan Chen: Investigation, Data curation. Rui He: Investigation. Qianbing Zhou: Resources, Data curation. Jun Tao: Writing – review & editing, Supervision. Junying Yang: Writing – review & editing, Supervision, Funding acquisition.
Ethical approval
The procedure was approved by the IEC for Clinical Research and Animal Trials of the First Affiliated Hospital of Sun Yat-sen University, China (No. 2020306).
Funding
This work was supported by the project funded by the Natural Science Foundation of Guangdong Province, China (2020A1515010307), Guangzhou Municipal Science and Technology Project (2025A04J4077), and Project of Administration of Traditional Chinese Medicine of Guangdong Province of China (20251056).
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Footnotes
Peer review under the responsibility of Editorial Board of Non-coding RNA Research.
Supplementary data to this article can be found online at https://doi.org/10.1016/j.ncrna.2025.10.001.
Contributor Information
Jun Tao, Email: taojungz123@163.com.
Junying Yang, Email: yangjuny@mail.sysu.edu.cn.
Appendix A. Supplementary data
The following is the Supplementary data to this article:
Data availability
The data supporting the findings of this study are available from the corresponding author upon reasonable request.
References
- 1.Schenkein H.A., Papapanou P.N., Genco R., Sanz M. Mechanisms underlying the association between periodontitis and atherosclerotic disease. Periodontol. 2000. 2020;83:90–106. doi: 10.1111/prd.12304. [DOI] [PubMed] [Google Scholar]
- 2.Carra M.C., Rangé H., Caligiuri G., Bouchard P. Periodontitis and atherosclerotic cardiovascular disease: a critical appraisal. Periodontol. 2000. 2023:1–34. doi: 10.1111/prd.12528. [DOI] [PubMed] [Google Scholar]
- 3.Xu W., Zhou W., Wang H., Liang S. Roles of Porphyromonas gingivalis and its virulence factors in periodontitis. Adv. Protein Chem. Struct. Biol. 2020;120:45–84. doi: 10.1016/bs.apcsb.2019.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Pavlic V., Peric D., Kalezic I.S., Madi M., Bhat S.G., Brkic Z., Staletovic D. Identification of periopathogens in atheromatous plaques obtained from carotid and coronary arteries. BioMed Res. Int. 2021 doi: 10.1155/2021/9986375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Gitlin J.M., Loftin C.D. Cyclooxygenase-2 inhibition increases lipopolysaccharide-induced atherosclerosis in mice. Cardiovasc. Res. 2009;81:400–407. doi: 10.1093/cvr/cvn286. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Andrukhov O., Steiner I., Liu S., Bantleon H.P., Moritz A., Rausch-Fan X. Different effects of Porphyromonas gingivalis lipopolysaccharide and TLR2 agonist Pam3CSK4 on the adhesion molecules expression in endothelial cells. Odontology. 2015;103:19–26. doi: 10.1007/s10266-013-0146-x. [DOI] [PubMed] [Google Scholar]
- 7.Viafara-García S.M., Morantes S.J., Chacon-Quintero Y., Castillo D.M., Lafaurie G.I., Buitrago D.M. Repeated Porphyromonas gingivalis W83 exposure leads to release pro-inflammatory cytokynes and angiotensin II in coronary artery endothelial cells. Sci. Rep. 2019;9 doi: 10.1038/s41598-019-54259-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Naeli P., Winter T., Hackett A.P., Alboushi L., Jafarnejad S.M. The intricate balance between microRNA-induced mRNA decay and translational repression. FEBS J. 2023;290:2508–2524. doi: 10.1111/febs.16422. [DOI] [PubMed] [Google Scholar]
- 9.Wang D., Atanasov A.G. The microRNAs regulating vascular smooth muscle cell proliferation: a minireview. Int. J. Mol. Sci. 2019;20:324. doi: 10.3390/ijms20020324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Luo R., Yan Z., Yang Q., Huang X., Gao X., Wang P., Wang W., Xie K., Gun S. Inhibition of ssc-microRNA-140-5p ameliorates the Clostridium perfringens beta2 toxin-induced inflammatory response in IPEC-J2 cells via the ERK1/2 and JNK pathways by targeting VEGFA. Mol. Immunol. 2020;127:12–20. doi: 10.1016/j.molimm.2020.08.017. [DOI] [PubMed] [Google Scholar]
- 11.Akhlaghipour I., Taghehchian N., Zangouei A.S., Maharati A., Mahmoudian R.A., Saburi E., Moghbeli M. MicroRNA-377: a therapeutic and diagnostic tumor marker. Int. J. Biol. Macromol. 2023;226:1226–1235. doi: 10.1016/j.ijbiomac.2022.11.236. [DOI] [PubMed] [Google Scholar]
- 12.Li Y., Yang N., Dong B., Yang J., Kou L., Qin Q. MicroRNA-122 promotes endothelial cell apoptosis by targeting XIAP: therapeutic implication for atherosclerosis. Life Sci. 2019;232 doi: 10.1016/j.lfs.2019.116590. [DOI] [PubMed] [Google Scholar]
- 13.Sheedy F.J. Turning 21: induction of miR-21 as a key switch in the inflammatory response. Front. immunol. 2015;6:1–9. doi: 10.3389/fimmu.2015.00019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Feng J., Li A., Deng J., Yang Y., Dang L., Ye Y., Li Y., Zhang W. miR-21 attenuates lipopolysaccharide-induced lipid accumulation and inflammatory response: potential role in cerebrovascular disease. Lipids Health Dis. 2014;13:27. doi: 10.1186/1476-511x-13-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Krzywińska O., Bracha M., Jeanniere C., Recchia E., Kędziora Kornatowska K., Kozakiewicz M. Meta-analysis of the potential role of miRNA-21 in cardiovascular system function monitoring. BioMed Res. Int. 2020 doi: 10.1155/2020/4525410. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zheng S., Liao J., Sun M., Liu R., Lv J. Extracellular shuttling miR-21 contributes to esophageal cancers and human umbilical vein endothelial cell communication in the tumor microenvironment and promotes tumor angiogenesis by targeting phosphatase and tensinhomolog. Thorac. Cancer. 2023;14:3119–3132. doi: 10.1111/1759-7714.15103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Libby P. The changing landscape of atherosclerosis. Nature. 2021;592:524–533. doi: 10.1038/s41586-021-03392-8. [DOI] [PubMed] [Google Scholar]
- 18.Papapanou P.N., Sanz M., Buduneli N., Dietrich T., Feres M., Fine D.H., Flemmig T.F., Garcia R., Giannobile W.V., Graziani F., Greenwell H., Herrera D., Kao R.T., Kebschull M., Kinane D.F., Kirkwood K.L., Kocher T., Kornman K.S., Kumar P.S., Loos B.G., Machtei E., Meng H., Mombelli A., Needleman I., Offenbacher S., Seymour G.J., Teles R., Tonetti M.S. Periodontitis: consensus report of workgroup 2 of the 2017 world workshop on the classification of periodontal and peri-implant diseases and conditions. J. Clin. Periodontol. 2018;45:S162–s170. doi: 10.1111/jcpe.12946. [DOI] [PubMed] [Google Scholar]
- 19.Berezin A., Zulli A., Kerrigan S., Petrovic D., Kruzliak P. Predictive role of circulating endothelial-derived microparticles in cardiovascular diseases. Clin. Biochem. 2015;48:562–568. doi: 10.1016/j.clinbiochem.2015.02.003. [DOI] [PubMed] [Google Scholar]
- 20.Gallo S., Sala V., Gatti S., Crepaldi T. Cellular and molecular mechanisms of HGF/Met in the cardiovascular system. Clin. Sci. 2015;129:1173–1193. doi: 10.1042/cs20150502. [DOI] [PubMed] [Google Scholar]
- 21.Ivanova E.A., Parolari A., Myasoedova V., Melnichenko A.A., Bobryshev Y.V., Orekhov A.N. Peroxisome proliferator-activated receptor (PPAR) gamma in cardiovascular disorders and cardiovascular surgery. J. Cardiol. 2015;66:271–278. doi: 10.1016/j.jjcc.2015.05.004. [DOI] [PubMed] [Google Scholar]
- 22.Suh J.S., Kim S., Boström K.I., Wang C.Y., Kim R.H., Park N.H. Periodontitis-induced systemic inflammation exacerbates atherosclerosis partly via endothelial-mesenchymal transition in mice. Int. J. Oral Sci. 2019;11:21. doi: 10.1038/s41368-019-0054-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Bourguignon L.Y. Matrix hyaluronan promotes specific MicroRNA upregulation leading to drug resistance and tumor progression. Int. J. Mol. Sci. 2016;17:517. doi: 10.3390/ijms17040517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mohr A.M., Mott J.L. Overview of microRNA biology. Semin. Liver Dis. 2015;35:3–11. doi: 10.1055/s-0034-1397344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Weber M., Baker M.B., Moore J.P., Searles C.D. MiR-21 is induced in endothelial cells by shear stress and modulates apoptosis and eNOS activity. Biochem. Biophys. Res. Commun. 2010;393:643–648. doi: 10.1016/j.bbrc.2010.02.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Barnett R.E., Conklin D.J., Ryan L., Keskey R.C., Ramjee V., Sepulveda E.A., Srivastava S., Bhatnagar A., Cheadle W.G. Anti-inflammatory effects of miR-21 in the macrophage response to peritonitis. J. Leukoc. Biol. 2016;99:361–371. doi: 10.1189/jlb.4a1014-489r. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zhou W., Su L., Duan X., Chen X., Hays A., Upadhyayula S., Shivde J., Wang H., Li Y., Huang D., Liang S. MicroRNA-21 down-regulates inflammation and inhibits periodontitis. Mol. Immunol. 2018;101:608–614. doi: 10.1016/j.molimm.2018.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang Q., Yang H.S. The role of Pdcd4 in tumour suppression and protein translation. Biol. Cell. 2018;110:169–177. doi: 10.1111/boc.201800014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Matsuhashi S., Manirujjaman M., Hamajima H., Ozaki I. Control mechanisms of the tumor suppressor PDCD4: expression and functions. Int. J. Mol. Sci. 2019;20 doi: 10.3390/ijms20092304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Wang Z., Yao W., Li K., Zheng N., Zheng C., Zhao X., Zheng S. Reduction of miR-21 induces SK-N-SH cell apoptosis and inhibits proliferation via PTEN/PDCD4. Oncol. Lett. 2017;13:4727–4733. doi: 10.3892/ol.2017.6052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Feng M.G., Liu C.F., Chen L., Feng W.B., Liu M., Hai H., Lu J.M. MiR-21 attenuates apoptosis-triggered by amyloid-β via modulating PDCD4/PI3K/AKT/GSK-3β pathway in SH-SY5Y cells. Biomed. Pharmacother. 2018;101:1003–1007. doi: 10.1016/j.biopha.2018.02.043. [DOI] [PubMed] [Google Scholar]
- 32.Fan B., Jin Y., Zhang H., Zhao R., Sun M., Sun M., Yuan X., Wang W., Wang X., Chen Z., Liu W., Yu N., Wang Q., Liu T., Li X. MicroRNA-21 contributes to renal cell carcinoma cell invasiveness and angiogenesis via the PDCD4/c-Jun (AP-1) signalling pathway. Int. J. Oncol. 2020;56:178–192. doi: 10.3892/ijo.2019.4928. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhang M., Johnson-Stephenson T.K., Wang W., Wang Y., Li J., Li L., Zen K., Chen X., Zhu D. Mesenchymal stem cell-derived exosome-educated macrophages alleviate systemic lupus erythematosus by promoting efferocytosis and recruitment of IL-17+ regulatory T cell. Stem Cell Res. Ther. 2022;13:484. doi: 10.1186/s13287-022-03174-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhu D., Johnson T.K., Wang Y., Thomas M., Huynh K., Yang Q., Bond V.C., Chen Y.E., Liu D. Macrophage M2 polarization induced by exosomes from adipose-derived stem cells contributes to the exosomal proangiogenic effect on mouse ischemic hindlimb. Stem Cell Res. Ther. 2020;11:162. doi: 10.1186/s13287-020-01669-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ning Z.W., Luo X.Y., Wang G.Z., Li Y., Pan M.X., Yang R.Q., Ling X.G., Huang S., Ma X.X., Jin S.Y., Wang D., Li X. MicroRNA-21 mediates angiotensin II-Induced liver fibrosis by activating NLRP3 Inflammasome/IL-1β axis via targeting Smad7 and Spry1. Antioxid. Redox Signal. 2017;27:1–20. doi: 10.1089/ars.2016.6669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Kura B., Szeiffova Bacova B., Kalocayova B., Sykora M., Slezak J. Oxidative stress-responsive MicroRNAs in heart injury. Int. J. Mol. Sci. 2020;21 doi: 10.3390/ijms21010358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Nara K., Kawashima N., Noda S., Fujii M., Hashimoto K., Tazawa K., Okiji T. Anti-inflammatory roles of microRNA 21 in lipopolysaccharide-stimulated human dental pulp cells. J. Cell. Physiol. 2019;234:21331–21341. doi: 10.1002/jcp.28737. [DOI] [PubMed] [Google Scholar]
- 38.Allgayer H. Pdcd4, a colon cancer prognostic that is regulated by a microRNA. Crit. Rev. Oncol. Hematol. 2010;73:185–191. doi: 10.1016/j.critrevonc.2009.09.001. [DOI] [PubMed] [Google Scholar]
- 39.Hua R., Zhang X., Li W., Lian W., Liu Q., Gao D., Wang Y., Lei M. Ssc-miR-21-5p regulates endometrial epithelial cell proliferation, apoptosis and migration via the PDCD4/AKT pathway. J. Cell Sci. 2020;133 doi: 10.1242/jcs.248898. [DOI] [PubMed] [Google Scholar]
- 40.Jiang M., Wang H., Liu Z., Lin L., Wang L., Xie M., Li D., Zhang J., Zhang R. Endoplasmic reticulum stress-dependent activation of iNOS/NO-NF-κB signaling and NLRP3 inflammasome contributes to endothelial inflammation and apoptosis associated with microgravity. FASEB J. 2020;34:10835–10849. doi: 10.1096/fj.202000734R. [DOI] [PubMed] [Google Scholar]
- 41.Roy R., Wilcox J., Webb A.J., O'Gallagher K. Dysfunctional and dysregulated nitric oxide synthases in cardiovascular disease: mechanisms and therapeutic potential. Int. J. Mol. Sci. 2023;24 doi: 10.3390/ijms242015200. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data supporting the findings of this study are available from the corresponding author upon reasonable request.







