Skip to main content
Springer logoLink to Springer
. 2025 Nov 27;124(11):145. doi: 10.1007/s00436-025-08599-6

Preliminary investigation of heat shock protein 90 gene diversity in Echinococcus granulosus sensu lato: a potential nuclear marker for species identification

Zemzemi Lamia 1,#, Oudni-M’rad Myriam 1,#, Châabane-Banaoues Raja 1, Kamoun Ines 1, Gérald Umhang 2, Abdelghani Mohamed Hedi 1, Sayadi Taoufik 3, Messaoud Marwa 4, Sahnoun Lassaad 4, Franck Boué 2, Babba Hamouda 1,5, M’rad Selim 1,
PMCID: PMC12660321  PMID: 41310205

Abstract

Cystic echinococcosis (CE), caused by the larval stage of Echinococcus granulosus sensu lato (s.l.), remains a significant zoonotic parasitic infection worldwide. This study provides a preliminary investigation of the nuclear Hsp90 gene diversity within the E. granulosus s.l. complex to evaluate its potential use for species identification. Forty-nine DNA samples of the G1 genotype from human and animal CE cysts, two G3 genotype samples, one of Echinococcus ortleppi, four of Echinococcus canadensis (G7), and four samples of other Taenia species (Echinococcus multilocularis, Taenia hydatigena, Taenia pisiformis, and Taenia ovis) were analyzed. Four primer pairs were designed to amplify the Hsp90 gene, followed by PCR amplification, DNA sequencing, and phylogenetic analysis. Successful amplification and sequencing of nearly the entire Hsp90 gene revealed a single nucleotide polymorphism (SNP) at position 222 conserved across all genotypes. Notably, significant genetic variations were observed between E. ortleppi (G5 genotype) and E. canadensis (G7 genotype) compared to E. granulosus sensu stricto (G1 and G3 genotypes). Phylogenetic analysis confirmed clustering consistent with established taxonomic relationships, with G1 and G3 forming a cluster, and G5 and G7 forming a distinct group. The findings suggest that the nuclear Hsp90 gene could be used as an additional marker for species-level differentiation within the E. granulosus s.l. complex.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00436-025-08599-6.

Keywords: Echinococcus granulosus sensu lato, Cystic echinococcosis, Heat shock protein, Hsp90, Genetic diversity, Genotyping

Introduction

Cystic echinococcosis (CE), previously known as hydatidosis, is a zoonotic parasitic infection caused by the larval stage of the cestode Echinococcus granulosus sensu lato (s.l.). This disease has a worldwide distribution and is considered by the World Health Organization to be one of the neglected tropical diseases of major public health importance (Hogea et al. 2024). With a mean annual surgical incidence of 12.6 per 100,000 inhabitants, Tunisia is considered the most endemic area in the Mediterranean region (Abdelghani et al. 2025; Chahed et al. 2015). Echinococcus granulosus s.l. has a heteroxenous life cycle, involving various canids, mainly dogs, as definitive hosts for the adult form and intermediate hosts such as sheep, cattle, and camels for the larval form. Humans represent accidental dead-end intermediate hosts (Tamarozzi et al. 2020).

Echinococcus granulosus s.l. is recognized as a complex of five cryptic species, which displays significant variability in morphology, development, host range, pathogenicity and infectivity to humans (Alvarez Rojas et al. 2014; Romig et al. 2015). Molecular analysis based on mitochondrial genes have previously divided E. granulosus s.l. into ten different genotypes (G1 to G10) (Bowles et al. 1992; Bowles and McManus 1993; Huttner et al. 2008; Nakao et al. 2007, 2010; Romig et al. 2015). According to the current classification, the genus Echinococcus comprises five recognized species: E. granulosus s.l., E. multilocularis, E. oligarthrus, E. vogeli, and E. shiquicus. The E. granulosus s.l. complex includes E. granulosus sensu stricto (G1/G3), E. equinus (G4), E. ortleppi (G5), E. canadensis (G6, G7 and G8–G10), and E. felidis (Lymbery 2017; Nakao et al. 2013; Vuitton et al. 2020). The G1 genotype of E. granulosus s.s. is the most frequently involved in human CE worldwide. It has the widest cosmopolitan distribution and is commonly associated with transmission via sheep as intermediate hosts (Alvarez Rojas et al. 2014).

Heat shock proteins (HSPs) are conserved and immunogenic proteins found in a wide range of mammalian and microbial species. They are classified into distinct families based on their molecular weight including small HSPs, HSP40, HSP60, HSP70, HSP90, and large HSPs (Finlayson-Trick et al. 2018). The heat shock protein 90 (HSP90) family consists of highly conserved molecular chaperone proteins. With the exception of archaea, all organisms possess one or more genes encoding HSP90 proteins (Taipale et al. 2010). Several studies have highlighted the importance of this protein and its involvement in various physiological processes essential for cellular survival as well as pathological conditions. In addition to its role in the maturation and folding of proteins known as “HSP90 client proteins”, HSP90 is involved in cellular survival and development, cell cycle control, hormonal signaling, apoptosis mechanism, DNA repair, modulation of innate and adaptive immune response, signal transduction, and intracellular transport (Abaza 2014; Biebl and Buchner 2019; Hoter et al. 2018; Zininga et al. 2018). However, overexpression of HSP90 contributes to the development and progression of cancers, neurodegenerative diseases, and infectious diseases (Banerjee et al. 2021; Faya et al. 2015).

The HSP90 protein has been subject to limited research for E. granulosus s.l. and it has been suggested that HSP90 may have a role in strobilization in E. granulosus adult worm (Zheng et al. 2013). Recently, a proteomic analysis of proteins expressed in the three consecutive stages of E. granulosus, oncosphere, adult, and protoscolex, showed that the expression level of HSP90 is significantly higher in the oncosphere than in the adult or protoscolex (Li et al. 2021). A study performed by (Chauhan et al. 2023) suggested that HSP90 is a promising marker for the diagnosis of E. granulosus s.l. especially in terms of specificity.

This study aims to assess the genetic diversity of the Hsp90 gene within selected genotypes of the E. granulosus s.l. complex, and to evaluate its potential as a nuclear marker species differentiation.

Materials and methods

Parasite DNA samples

Forty-nine DNA samples of the G1 genotype, obtained from 22 human CE cysts and 27 animal (sheep and bovine) CE cysts, and two DNA samples of the G3 genotype (from bovine and human lung CE cysts) of Tunisian isolates (retrieved from a pre-existing collection at the laboratory of medical and molecular parasitology-mycology, LP3M, Tunisia) were analyzed. Additionally, four DNA samples of E. canadensis (G7 genotype) and one of E. ortleppi (G5 genotype) collected at the slaughterhouse in France (Umhang et al. 2020), along with four DNA samples of other Taeniidae species (E. multilocularis, T. hydatigena, T. pisiformis, and T. ovis) provided by ANSES LRFSN (National Reference Laboratory for Echinococcus spp., Malzeville, France) were also included in the study. The G1 genotype samples were identified by PCR amplification using the Egss1 primer pair (Dinkel et al. 2004). The G3, G5, and G7 genotype samples, as well as the E. multilocularis and other Taeniidae samples, were identified by sequencing the cox1 gene (M’rad et al. 2010; Umhang et al. 2020).

Primer design and amplification of the Hsp90 gene

An in silico analysis was performed to design primers that specifically target the sequence of the Hsp90 gene. Four primer pairs, named Hsp90_0, Hsp90_1, Hsp90_2, and Hsp90_3, were designed using “Primer Blast” (Ye et al. 2012) based on the reference sequence of Hsp90 (XM_024499809.1) (Zheng et al. 2013) available in the GenBank database. The four primer pairs target four consecutive overlapping sequences (Table 1). The specificity of the primers was tested in silico by BLAST analysis (http://blast.ncbi.nlm.gov/Blast.cgi).

Table 1.

Characteristic of the four primer pairs used to amplify the Hsp90 gene sequence

Primers Sequences Target length (bp) Position on the Hsp90 reference sequence (XM_024499809.1) Thermal cycling conditions
Hsp90_0 F 5’ CCC TTC GAC CTA TTT GAG AAC A3’ 700 1054–1753

Denaturation : 94 °C–1 min

Annealing : 52 °C–1 min

Extension : 72 °C–1 min

R 5’ TGC CCA AGA TGT CCT TGA TT 3’
Hsp90_1 F 5’ GCC TTC CAG GCA GAG ATT G 3’ 757 55–811

Denaturation : 94 °C–1 min

Annealing : 57 °C–1 min

Extension : 72 °C–1 min

R 5’ CAC TTC CTT CAC CAC CTT CC 3’
Hsp90_2 F 5’ TGA GGA GGAGGA AGT CAA GG 3’ 776 693–1468
R 5’ CCT TCA TGC GAG ACA CGT AA 3’
Hsp90_3 F 5’ TGCGCTACTATTCCTCGCAA 3’ 675 1400–2074

Denaturation : 94 °C–1 min

Annealing : 56 °C–1 min

Extension : 72 °C–1 min

R 5’ TATTGGCGTGAGCTTTCGGA 3’

F: forward, R: reverse

All samples from G1, G3, G5, and G7 genotypes of E. granulosus s.l. were tested by PCR using the four primer pairs. The primer specificity to E. granulosus s.l. complex was checked by amplification of E. multilocularis, T. hydatigena, T. pisiformis, and T. ovis DNA samples. Amplification was performed in a final volume of 50 µl, containing 2 mM MgCl2, 200 µM of each dNTP, 20 pmol of each primer, and 2.5 units of Taq polymerase (Dream Taq, Thermo Fisher scientific, USA) with its concentrated 1X buffer, along with 3 µl of DNA template. Thermal cycling conditions included an initial denaturation at 94 °C for 7 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing (with temperatures varying according to the primer pairs), and extension at 72 °C for 1 min, with a final extension at 68 °C for 10 min (Table 1). PCR products were observed after migration on agarose gel electrophoresis 1.5%. For each set of PCR reaction, negative (no DNA) and positive control (G1 sequenced DNA, LP3M laboratory, Tunisia) were included.

DNA sequencing and phylogenetic analysis

For all four primer pairs, the PCR products of E. granulosus s.s. isolates (Five samples of the G1 genotype and two samples of the G3 genotype), one of E. ortleppi (G5 genotype), and four samples of E. canadensis (G7 genotype) samples were sequenced (Genoscreen, France). The Characteristic of these sequenced samples are detailed in Table 2. The Hsp90 sequence of E. granulosus s.l. available in Genbank (NW_020170614.1), was used as the reference sequence (Zheng et al. 2013). The consensus sequences were then generated using BioEdit V7.2 software. Multiple sequence alignments were performed using the ClustalW method in the same software, and the results were compared with the reference sequence. Amino acid sequences were inferred from the nucleotide sequences using the standard genetic code in order to identify potential mutations (MEGA v.12 software).

Table 2.

Characteristics of Echinococcus granulosus s.l. Isolates sequenced for the Hsp90 gene

Samples Origin Genotype GenBank accession number
FM587 Sheep Liver G1 PQ310116
KH55 Human lungs G1 PQ310117
FB107.5 Bovine liver G1 PX400197
KH733 Human lungs G1 PX400198
PM122 Sheep lungs G1 PX400199
KH59 Human lungs G3 PQ310118
PB30 Bovine lungs G3 PQ310119
G5 Bovine lungs G5 PQ310120
G7 (4655) Pig liver G7 PQ310121
G7 (4190) Pig liver G7 PX400200
G7 (4643) Pig liver G7 PX400201
G7 (4656) Pig liver G7 PX400202

The phylogenetic relationships between the Hsp90 reference sequence (NW_020170614.1) and the twelve consensus sequences obtained from E. granulosus s.l. samples were established with an outgroup T. asiatica (EF201877.1). The evolutionary distances were computed using the p-distance method via MEGA v.12 software, and a phylogenetic tree was constructed using the Maximum Likelihood method and Kimura (1980) 2-parameter model.

Haplotypes were identified based on sequence similarity using DnaSP software (version 6.12.03) (Rozas et al. 2017) and the haplotype network was constructed using PopArt software (version 1.7) based on TCS criteria (Leigh and Bryant 2015).

Results

Forty samples of G1 genotype, two of G3 genotype, one of E. ortleppi (G5 genotype), and four of E. canadensis (G7 genotype) were successfully amplified using the four primer pairs, giving bands of 700 bp, 757 bp, 776 bp, and 675 bp corresponding to the in silico predicted sizes (supplementary data S1). No amplification was detected for E. multilocularis, T. hydatigena, T. pisiformis, and T. ovis samples.

A 2,033 bp long sequence, representing almost the complete Hsp90 gene (2,289 bp) (Zheng et al. 2013), was successfully reconstructed for the twelve sequenced isolates, including E. granulosus s.s. (G1 and G3 genotypes), E. ortleppi (G5 genotype) and E. canadensis (G7 genotype). The sequences were added to the GenBank database under accession numbers (PQ310116 to PQ310121) (Table 2). The sequence alignment is provided in supplementary data S2.

No difference was observed between human and animal samples of the G1 genotype, nor with the samples of the G3 genotype.

Sequence alignment against the reference sequence (NW_020170614.1) revealed genotype-specific single nucleotide polymorphisms (SNPs) within the E. granulosus s.l. complex. Specifically, E. granulosus s.s. (G1 and G3 genotypes) exhibited one SNP, while E. ortleppi (G5 genotype) and E. canadensis (G7 genotype) displayed 25 and 29 SNPs, respectively. A notable G222C SNP was conserved across all examined genotypes. Further analysis, compared to the coding sequence (XM_024499809.1), highlighted additional variations. E. ortleppi showed 19 SNPs in its coding sequence, and E. canadensis presented 23 SNPs within its coding region. The different mutations and their positions are listed in Table 3. The derived amino acid sequences are the same for all analyzed samples and with the reference sequence, showing that all SNPs are synonymous mutations.

Table 3.

Nucleotide variations in Hsp90 across E. granulosus s.s (G1, G3), E. ortleppi, and E. canadensis (G7) compared to the reference sequence (XM_024499809.1, Zheng et al. 2013)

Species Genotype Mutations
E. granulosus s.s G1/G3 C222G
E. ortleppi G5 C222G; A339G; C731T; G750A; C939T; G942A; T1245A; A1338G; G1416C; T1425C; A1446G; T1515C; G1719A; A1767G; C1998T; A2001G; G2037T; C642T; G720A; A1671G
E. canadensis G7 C222G; A339G; C731T; G750A; C939T; G942A; T1245A; A1338G; G1416C; T1425C; A1446G; T1515C; G1719A; A1767G; C1998T; A2001G; G2037T; T108C; C159G; A429G; T951C; A993G; G1731A; A1890G

SNP in itallic is present in all tested samples. Mutations in bold were observed in both G5 and G7 genotypes. The remaining mutations are specific to each genotype.

A 72 bp intronic sequence was identified at position 232 within the genomic reference sequence (NW_020170614.1). This intronic sequence was identical among E. granulosus s.s. (G1 and G3 genotypes) and the reference sequence. In contrast, E. ortleppi and E. canadensis shared an identical intronic sequence that differed from the G1/G3 genotypes by five single nucleotide substitutions: A250T, T256C, T264G, C285T, and G290A (here the indicated positions are relative to the complete NW_020170614.1 sequence).

Phylogenetic analysis of the Hsp90 gene sequences of the E. granulosus s.l. isolates, using the Maximum Likelihood method, provides important and significant insights into their evolutionary relationships (Fig. 1). The phylogram, rooted with T. asiatica as outgroup, highlights that the G1 isolates cluster together with the G3 isolates and the reference sequence (NW_020170614.1) Additionally, E. ortleppi (G5) and E. canadensis (G7) form a distinct cluster, with a bootstrap value of 81%, within which the G7 isolates are strongly grouped together with a bootstrap value of 100%.

Fig. 1.

Fig. 1

Phylogenetic relationships of E. granulosus s.1 inferred from the sequence of the Hsp90 gene from twelve samples analyzed: E. granulosus sensu stricto (G1 and G3), E. ortleppi (G5), and E. canadensis (G7), with Taenia asiatica as the outgroup. ( ): GenBank accession number; *: reference sequence; **: Outgroup

The network haplotype revealed three clearly distinct haplotypes corresponding to E. granulosus s.s.(G1/G3 genotypes) (GB accession number: PQ310116, PQ310117, PX400197, PX400198, PX400199, PQ310118, PQ310119), E. ortleppi (G5 genotype) (PQ310120), and E. canadensis (G7 genotype) (PQ310121, PX400200, PX400201, PX400202), separated by multiple mutational steps, indicating marked genetic divergence among lineages (Fig. 2; Table 3).

Fig. 2.

Fig. 2

Haplotype network of Echinococcus granulosus sensu lato genotypes (G1/G3, G5 and G7 ). Bar marks indicate the number of mutations

Discussion

HSP90 proteins are molecular chaperones involved in numerous physiological and pathological processes such as homeostasis, cell cycle regulation, cancer and neurodegeneration (Hu et al. 2022) and may also play a role in the strobilization of E. granulosus s.l. adult worms (Zheng et al. 2013). To the best of our knowledge, this is the first study to investigate the genetic variability of the nuclear Hsp90 gene within the E. granulosus s.l. complex.

The alignment of the consensus Hsp90 sequences revealed nucleotide variations among E. granulosus s.s. (G1 and G3), E. ortleppi (G5), and E. canadensis (G7), with several synonymous SNPs and intronic sequence differences identified. No variation was found within G1 or G3 sequences, regardless of host origin (human or animal). Although several studies have reported distinctions between the G1 and G3 genotypes based on mitochondrial markers (Bonelli et al. 2021; Bowles et al. 1992; Kinkar et al. 2018a), our findings align with those of (Kinkar et al. 2017), who demonstrated using a nearly complete mitogenome and three nuclear genes (cal, tgf, ef1) that nuclear markers do not differentiate G1 from G3. Similarly, (Umhang et al. 2018) showed that nuclear non-coding microsatellites (EgSca6 and EgSca11) displayed high intra-specific polymorphism within E. granulosus s.s. but did not distinguish G1 and G3 genotypes. Additionally, a recent whole genome study analyzing 111 E. granulosus s.s. samples confirmed that G1 and G3 genotypes represent distinct mitochondrial lineages but are indistinguishable at the nuclear genomic level (Wu et al. 2025). These genotypes should therefore be regarded as distinct only in the context of mitochondrial data.

The detection of a shared SNP (position 222) across all genotypes, together with specific synonymous mutations, is consistent with the well-known conservation of HSP90 proteins. This conservation underscores their fundamental cellular role, while also indicating that such markers may be useful for phylogenetic studies when combined with other loci. Notably, variations in intronic regions distinguished the G1/G3 cluster from the G5 and G7 genotypes, suggesting that non-coding sequences may hold phylogenetic relevance, a pattern comparable to what was observed with non-coding microsatellites (Umhang et al. 2018). Although these intronic differences do not affect the protein structure, they could serve as complementary markers for inter-species differentiation and epidemiological tracking.

Phylogenetic analysis and haplotype network based on Hsp90 sequences produced clusters reflecting known taxonomic relationships between E. granulosus s.l. genotypes: G1 and G3 grouped together, while G5 and G7 formed a distinct cluster. These results are consistent with previous phylogenetic analyses based on mitochondrial (Cox1, nad1, cob and atp6) and nuclear (ITS1, rpb2, pepck, pold, ef1, tgf) genes (Knapp et al. 2011; Nakao et al. 2013; Romig et al. 2015; Saarma et al. 2009). These findings provide preliminary support for the use of Hsp90 as a complementary marker in phylogenetic studies, particularly at the species level.This study presents the first investigation of the Hsp90 gene as a molecular marker within the E. granulosus s.l. complex. However, it has limitations that warrant cautious interpretation of the findings. Firstly, the primers were designed based on a single annotated G1 genomic sequence (XM_024499809.1). Secondly, the analysis was restricted to four genotypes, with a limited number of samples available for G3 and G5, mainly due to the rarity of these genotypes.

In conclusion, this study provides preliminary evidence supporting the use of the nuclear Hsp90 gene to explore genetic variation within the E. granulosus s.l. complex. Our results demonstrate consistent clustering of E. granulosus s.s. genotypes (G1 and G3) and distinct Hsp90 profiles for E. ortleppi (G5) and E. canadensis (G7), notably through SNPs and intronic variations. The observed sequence conservation and intronic divergence suggest that Hsp90 gene could serve as a valuable complementary marker in phylogenetic and epidemiological studies.

Further investigations involving additional genotypes, broader geographic sampling, and larger number of isolates per genotype are needed to validate these observations and to explore the functional significance of the identified polymorphisms.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

All the authors of this manuscript contributed substantially with the following activities/Zemzemi Lamia, Oudni-M’rad Myriam, Babba Hamouda, Châabane-Banaoues Raja, M’rad Selim: conceived and designed the studyZemzemi Lamia, Oudni-M’rad Myriam, M’rad Selim: realised experimental methodologyZemzemi Lamia, Oudni-M’rad Myriam, Gérald Umhang, Abdelghani Mohamed Hedi, Sayadi Taoufik, Messaoud Marwa, Sahnoun Lassaad, Franck Boué, M’rad Selim: conducted data gathering, analysis and interpretationZemzemi Lamia, Oudni-M’rad Myriam, Kamoun Ines, M’rad Selim: performed manuscript writing and literature reviewBabba Hamouda, Châabane-Banaoues Raja, Gérald Umhang, Franck Boué: reviewed the manuscriptAll authors read and approved the final manuscript.

Funding

This research received no specific grant from any funding agency, commercial or not-for-profit sectors. However, the work was supported by the institutional funding provided to the Laboratory of Medical and Molecular Parasitology-Mycology LR 12ES08 by the Tunisian Ministry of Higher Education and Scientific Research. The Ministry, as a general institutional funder, had no involvement in the study design, data collection, analysis, interpretation, or the decision to submit the article for publication.

Data availability

Sequence data that support the findings of this study have been deposited in the GenBank database under accession numbers PQ310116 to PQ310121.

Declarations

Ethical approval

Ethical guidelines for human and animal experimentation were followed, with approval granted by the Ethics Committee for Life and Health Sciences at the Higher Institute of Biotechnology of Monastir, Tunisia (approval number: CER-SVS-002/2020).

Consent to participate

Written informed consent was obtained from the parents.

Consent to publish

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Zemzemi Lamia and Oudni-M’rad Myriam contributed equally to this work.

References

  1. Abaza S (2014) Heat shock proteins and parasitic diseases: Part 1: helminths. Parasitol United J. 10.4103/1687-7942.149556 [Google Scholar]
  2. Abdelghani MH et al (2025) Zoonotic threat of cystic echinococcosis in Tunisia: insights into livestock prevalence and identification of the G1 genotype. Front Vet Sci 12:1536368. 10.3389/fvets.2025.1536368 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alvarez Rojas CA, Romig T, Lightowlers MW (2014) Echinococcus granulosus sensu lato genotypes infecting humans–review of current knowledge. Int J Parasitol 44(1):9–18. 10.1016/j.ijpara.2013.08.008 [DOI] [PubMed] [Google Scholar]
  4. Banerjee M, Hatial I, Keegan BM, Blagg BSJ (2021) Assay design and development strategies for finding Hsp90 inhibitors and their role in human diseases. Pharmacol Ther 221:107747. 10.1016/j.pharmthera.2020.107747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Biebl MM, Buchner J (2019) Structure, function, and regulation of the Hsp90 machinery. Cold Spring Harb Perspect Biol. 10.1101/cshperspect.a034017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bonelli P et al (2021) Identification of Echinococcus granulosus genotypes G1 and G3 by SNPs genotyping assays. Pathogens. 10.3390/pathogens10020125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bowles J, McManus D (1993) NADH dehydrogenase 1 gene sequences compared for species and strains of the genus Echinococcus. Int J Parasitol 23(7):969–972 [DOI] [PubMed] [Google Scholar]
  8. Bowles J, Blair D, McManus DP (1992) Genetic variants within the genus Echinococcus identified by mitochondrial DNA sequencing. Mol Biochem Parasitol 54(2):165–173 [DOI] [PubMed] [Google Scholar]
  9. Chahed MK, Bellali H, Alaya NB, Aoun K, Zouari B (2015) Identification des zones à risque élevé pour l’échinococcose-hydatidose En Tunisie. Tunis Med 93(01)
  10. Chauhan V, Khan A, Farooq U (2023) In silico study to predict promiscuous peptides for immunodiagnosis of cystic echinococcosis. Trop Parasitol 13(1):54–62. 10.4103/tp.tp_70_22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dinkel A et al (2004) A PCR system for detection of species and genotypes of the Echinococcus granulosus-complex, with reference to the epidemiological situation in eastern Africa. Int J Parasitol 34(5):645–53. 10.1016/j.ijpara.2003.12.013 [DOI] [PubMed] [Google Scholar]
  12. Faya N, Penkler DL, Tastan Bishop O (2015) Human, vector and parasite Hsp90 proteins: a comparative bioinformatics analysis. FEBS Open Bio 5:916–927. 10.1016/j.fob.2015.11.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Finlayson-Trick E, Connors J, Stadnyk A, Van Limbergen J (2018) Regulation of antimicrobial pathways by endogenous heat shock proteins in gastrointestinal disorders. Gastrointest Disord 1(1):39–56. 10.3390/gidisord1010005 [Google Scholar]
  14. Hogea MO, Ciomaga BF, Muntean MM, Muntean AA, Popa MI, Popa GL (2024) Cystic echinococcosis in the early 2020s: a review. Trop Med Infect Dis. 10.3390/tropicalmed9020036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hoter A, El-Sabban ME, Naim HY (2018) The HSP90 family: structure, regulation, function, and implications in health and disease. Int J Mol Sci. 10.3390/ijms19092560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hu C et al (2022) Heat shock proteins: biological functions, pathological roles, and therapeutic opportunities. MedComm 3(3):e161 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Huttner M et al (2008) Genetic characterization and phylogenetic position of Echinococcus felidis (Cestoda: Taeniidae) from the African lion. Int J Parasitol 38(7):861–8. 10.1016/j.ijpara.2007.10.013 [DOI] [PubMed] [Google Scholar]
  18. Kinkar L et al (2017) New mitogenome and nuclear evidence on the phylogeny and taxonomy of the highly zoonotic tapeworm Echinococcus granulosussensu stricto. Infect Genet Evol 52:52–58. 10.1016/j.meegid.2017.04.023 [DOI] [PubMed] [Google Scholar]
  19. Kinkar L et al (2018a) Distinguishing Echinococcus granulosussensu stricto genotypes G1 and G3 with confidence: a practical guide. Infect Genet Evol 64:178–184. 10.1016/j.meegid.2018.06.026; 10.1016/j.ijpara.2018.03.006
  20. Knapp J et al (2011) Phylogenetic relationships within Echinococcus and Taenia tapeworms (Cestoda: Taeniidae): an inference from nuclear protein-coding genes. Mol Phylogenet Evol 61(3):628–638 [DOI] [PubMed] [Google Scholar]
  21. Leigh JW, Bryant D (2015) Popart: full-feature software for haplotype network construction. Methods Ecol Evol 6:1110–1116 [Google Scholar]
  22. Li X, Jiang S, Wang X, Hui W, Jia B (2021) iTRAQ-based comparative proteomic analysis in different developmental stages of Echinococcus granulosus. Parasite 28:15. 10.1051/parasite/2021012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lymbery AJ (2017) Phylogenetic pattern, evolutionary processes and species delimitation in the genus Echinococcus. Adv Parasitol 95:111–145. 10.1016/bs.apar.2016.07.002 [DOI] [PubMed] [Google Scholar]
  24. M’rad S et al (2010) Molecular identification of Echinococcus granulosus in tunisia: first record of the Buffalo strain (G3) in human and bovine in the country. Open Vet Sci J 4:27–30 [Google Scholar]
  25. Nakao M, McManus DP, Schantz PM, Craig PS, Ito A (2007) A molecular phylogeny of the genus Echinococcus inferred from complete mitochondrial genomes. Parasitology 134(Pt 5):713–722. 10.1017/S0031182006001934 [DOI] [PubMed] [Google Scholar]
  26. Nakao M et al (2010) State-of-the-art Echinococcus and Taenia: phylogenetic taxonomy of human-pathogenic tapeworms and its application to molecular diagnosis. Infect Genet Evol 10(4):444–452 [DOI] [PubMed] [Google Scholar]
  27. Nakao M, Lavikainen A, Yanagida T, Ito A (2013) Phylogenetic systematics of the genus Echinococcus (Cestoda: Taeniidae). Int J Parasitol 43(12–13):1017–1029. 10.1016/j.ijpara.2013.06.002 [DOI] [PubMed] [Google Scholar]
  28. Romig T, Ebi D, Wassermann M (2015) Taxonomy and molecular epidemiology of Echinococcus granulosus sensu Lato. Vet Parasitol 213(3–4):76–84. 10.1016/j.vetpar.2015.07.035 [DOI] [PubMed] [Google Scholar]
  29. Rozas J, Ferrer-Mata A, S´anchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos- Onsins SE, S´anchez-Gracia A (2017) DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol Biol Evol 34:3299–3302 [DOI] [PubMed] [Google Scholar]
  30. Saarma U et al (2009) A novel phylogeny for the genus Echinococcus, based on nuclear data, challenges relationships based on mitochondrial evidence. Parasitology 136(3):317–28. 10.1017/S0031182008005453; 10.1016/j.actatropica.2016.03.002
  31. Taipale M, Jarosz DF, Lindquist S (2010) HSP90 at the hub of protein homeostasis: emerging mechanistic insights. Nat Rev Mol Cell Biol 11(7):515–528. 10.1038/nrm2918 [DOI] [PubMed] [Google Scholar]
  32. Tamarozzi F, Deplazes P, Casulli A (2020) Reinventing the wheel of Echinococcus granulosus sensu lato transmission to humans. Trends Parasitol 36(5):427–434. 10.1016/j.pt.2020.02.004 [DOI] [PubMed] [Google Scholar]
  33. Umhang G et al (2018) Investigating the genetic diversity of Echinococcus granulosus sensu stricto with new microsatellites. Parasitol Res 117(9):2743–2755 [DOI] [PubMed] [Google Scholar]
  34. Umhang G et al (2020) National survey and molecular diagnosis of Echinococcus granulosus sensu lato in livestock in France, 2012. Parasitology 147(6):667–672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Vuitton DA et al (2020) International consensus on terminology to be used in the field of echinococcoses. Parasite 27:41. 10.1051/parasite/2020024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wu Y-D et al (2025) Whole-genomic comparison reveals complex population dynamics and parasitic adaptation of Echinococcus granulosus sensu stricto. mBio 16(5):e03256–e03224 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13(1):134. 10.1186/1471-2105-13-134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zheng H et al (2013) The genome of the hydatid tapeworm Echinococcus granulosus. Nat Genet 45(10):1168–1175. 10.1038/ng.2757 [DOI] [PubMed] [Google Scholar]
  39. Zininga T, Ramatsui L, Shonhai A (2018) Heat shock proteins as immunomodulants. Molecules. 10.3390/molecules23112846 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Sequence data that support the findings of this study have been deposited in the GenBank database under accession numbers PQ310116 to PQ310121.


Articles from Parasitology Research are provided here courtesy of Springer

RESOURCES