Impact of Limosilactobacillus reuteri cell-free culture supernatant on stress-resistant Salmonella Typhimurium in seawater: antioxidant, anti-infective, and anti-adhesion effects

Abstract

Salmonellosis linked to fish consumption is a significant public health concern. Salmonella often contaminates fish through polluted water or improper handling, with increasing antibiotic-resistant strains in aquaculture. This study evaluated the antimicrobial, antioxidant, and anti-biofilm activities of the cell-free culture supernatant (CFCS) of Limosilactobacillus reuteri against normal and stressed Salmonella Typhimurium in seawater microcosms over four years. The CFCS exhibited minimum inhibitory concentrations (MIC) ranging from 16.66% to 30% under acidic conditions, whereas stressed strains showed increased resistance, with MIC reaching up to 60% at neutral pH. Antioxidant activity reached 38% (DPPH assay), and CFCS significantly reduced biofilm formation and bacterial adhesion by up to 52% on the fish cell line (SAF-1). Additionally, L. reuteri CFCS modulated the expression of genes related to oxidative stress (cat, sod, gr) and immune response (il1b, il6, il8). These findings highlight the potential of L. reuteri CFCS as a natural antimicrobial and anti-virulence agent in marine aquaculture, helping to address antibiotic resistance issues.

Graphical abstract

Introduction

The rapid growth of the aquaculture industry has made it a major contributor to global food production. According to the Food and Agriculture Organization (FAO), aquaculture production is expanding faster than other animal food sectors [1]. As fish consumption increases, ensuring the safety of seafood becomes essential, since fish can be contaminated by pathogens such as Salmonella [2]. Although Salmonella is commonly linked to poultry and eggs, it can also be found in seafood, including fish [3]. Importantly, Salmonella is not naturally present in fish but is introduced mainly through contaminated water or poor handling, processing, and storage practices [4]. Untreated or insufficiently treated sewage is a primary source of such contamination [5].

Salmonella can survive for extended periods in soil and water despite environmental stresses like UV radiation, nutrient scarcity, pH changes, and temperature fluctuations [6, 7]. This resilience is largely due to the bacterium’s ability to adjust its gene expression in response to stress, enabling it to persist in harsh conditions [8]. The bacterium's ability to form biofilm aggregates of cells that adhere to surfaces enhances its persistence and survival [9]. This biofilm formation is linked to the bacterium's capacity to colonize and thrive within the intestines of various host species [10].

Ensuring the safety of fish products requires strict sanitary measures throughout the supply chain. Methods such as heat treatments, ionizing radiation, antibiotics, and natural antimicrobials have been used to control foodborne pathogens. Among these, probiotics have emerged as promising alternatives [11]. The World Health Organization defines probiotics as “live microorganisms which, when administered in adequate amounts, confer a health benefit on the host” [12].

Probiotics are increasingly recognized for their antimicrobial effects in inhibiting the growth and spread of foodborne pathogens such as Salmonella [13]. They exert their effects through multiple mechanisms, including the production of compounds such as organic acids, reuterin, and bacteriocins [14, 15], as well as through competition for adhesion sites and modulation of host immune responses [16, 17]. These combined actions contribute to their beneficial role in various systems, including human health, livestock, and aquaculture [18, 19].

Limosilactobacillus reuteri has shown promising antimicrobial properties in several recent studies. For example, Buddhasiri et al. (2021) reported that the strain KUB-AC5 significantly reduced inflammation and Salmonella burden in a murine model of intestinal inflammation [20]. Similarly, strains PF20-3 and PF30-3, isolated from piglet feces, displayed notable inhibitory effects against E. coli and Salmonella [21]. A more recent review by Lima et al. (2025) highlighted the capacity of L. reuteri to produce compounds such as lactic acid, acetic acid, and reuterin, which are effective even against multidrug-resistant Salmonella strains [22].

However, most of these studies have been conducted in mammalian models and primarily address intestinal colonization. Our study proposes a different approach by focusing on fish-derived epithelial cells to explore the potential of L. reuteri in limiting Salmonella contamination during post-harvest stages such as handling, processing, and storage. This aspect remains critical in aquaculture, especially when sanitary conditions are suboptimal.

In this context, the objective of our study is to assess the antimicrobial, antioxidant, and antibiofilm effects of Limosilactobacillus reuteri (OL468126.1), previously isolated from sheep dry sausage, against both normal and stressed Salmonella Typhimurium. Additionally, we examined the anti-adhesion properties and gene expression related to oxidative stress (cat, sod, gr) and immune response (il6, il8, il1b) in the SAF-1 fish cell line following exposure to L. reuteri CFCS.

Materials and methods

Bacterial strains and growth conditions

The reference strains used in this study were Salmonella enterica serovar Typhimurium ATCC 14028 and LT2 DT104. Both strains were preserved in Luria–Bertani (LB) broth supplemented with 15% sterile glycerol and stored at −80 °C to maintain their viability.

Seawater microcosms

To simulate marine environments, Salmonella enterica serovar Typhimurium cultures in the logarithmic phase were centrifuged at 13,000 × g for 15 min, then re-suspended in 10 mL of sterile seawater. The microcosms, consisting of 100 mL of natural seawater collected from the Tunisian coast of Mahdia (salinity 4%, pH 8), were filtered through 0.22 µm membrane filters (Millipore, Bedford, MA) and autoclaved at 121 °C for 20 min to eliminate indigenous microorganisms. The bacterial suspension was introduced into these microcosms at a concentration of 10⁸ CFU/mL and incubated at room temperature (~ 22 °C) without agitation in 250 mL Erlenmeyer flasks to mimic natural marine conditions. The incubation was maintained for an extended period of four years to investigate the long-term survival and adaptation of Salmonella in a marine-like environment. Each experiment was conducted in triplicate, and a microcosm without bacteria served as a negative control [23]. This approach allows for a realistic assessment of Salmonella persistence and behavior under simulated marine stress conditions.

Probiotic bacteria

The Limosilactobacillus reuteri strain (OL468126.1), originally isolated from traditional Tunisian sheep dry sausage on January 10, 2017, was identified and characterized as previously described [24]. Various in vitro tests assessed the isolate's physiological properties, including biochemical identification, 16S rRNA gene sequencing, acid and bile salt tolerance, antimicrobial activity, adherence capability, and antiproliferative effects. The strain exhibited promising probiotic characteristics.

Preparation of cell-free culture supernatant (CFCS)

The L. reuteri strain was cultured in MRS broth under anaerobic conditions at 37 °C for 24 h. Following incubation, the cultures were centrifuged at 10,000 × g at 4 °C for 10 min, and the supernatants were sterilized by filtration through a 0.22 μm filter (Millex GS Millipore) [25]. For antimicrobial screening, the CFCS was used in its original acidic form or neutralized to pH 7.0 ± 0.2 using 1 M NaOH, and was also tested after boiling at 100 °C for 1 h [26].

Antimicrobial assay

Minimum inhibitory concentration (MIC) determination

The MIC of L. reuteri CFCS was determined using the broth microdilution method as per the Clinical and Laboratory Standards Institute guidelines. Serial dilutions of the CFCS in Muller Hinton (MH) broth were prepared to obtain final concentrations ranging from 5 to 90%. Each well was inoculated with 10 µL of S. Typhimurium (10⁸ CFU/mL) under normal and stressed conditions. Control wells included sterility checks (no inoculum) and viability checks (no extract). The plates were incubated at 37 °C for 24 h, and MIC was defined as the lowest concentration of extract where no visible bacterial growth was observed. Each experiment was conducted in triplicate [27, 28].

Minimum bactericidal concentration (MBC) determination

To determine the MBC, 10 µL from each well showing no visible growth was plated on MH agar. After 24 h of incubation at 37 °C, the number of colonies was counted. The MBC was identified as the lowest concentration at which 99% of the bacteria were killed. Each experiment was repeated three times [29].

Antioxidant activity assay

The antioxidant activity of L. reuteri cells and CFCS was evaluated using the 2,2-diphenyl-1-picryl-hydrazyl (DPPH) radical scavenging assay with minor modifications [30, 31]. 120 µL of live L. reuteri cells (10⁸ CFU/mL) or CFCS was mixed with 120 µL of a 400 µM DPPH solution [32]. The mixture was incubated in the dark at 37 °C for 30 min. Absorbance was measured at 517 nm using a spectrophotometer. The percentage of DPPH radical scavenging was calculated using the formula:

$$\text{DPPH radical scavenging activity}(\text{\%})=({\text{OD}}_{\text{Control}}-{\text{OD}}_{\text{Sample}}/{\text{OD}}_{\text{Control}})\times 100$$

Anti-biofilm activity of L. reuteri CFCS

Inhibition of biofilm formation

The anti-biofilm activity of both pH non-neutralized and pH neutralized CFCS was evaluated using a crystal violet assay with modifications [33]. S. Typhimurium was grown in TSB broth with 2% glucose for 24 h. To initiate biofilm formation, 100 μL of sterile TSB broth, 100 μL of CFCS (1/2 × MIC and MIC), and 20 μL of overnight S. Typhimurium culture (10⁸ CFU/mL) were added to each well of a 96-well polystyrene plate. Controls included TSB/glucose alone. The plate was incubated at 37 °C for 24 h, then washed to remove non-adherent cells. Biofilms were fixed with methanol, stained with 1% crystal violet, and the excess dye was removed. Biofilm biomass was quantified by measuring absorbance at 570 nm after extracting the stain with 33% glacial acetic acid. Biofilm inhibition was calculated as:

$$\text{Biofilm inhibition rate}(\text{\%})=(1-({\text{OD}}_{\text{treatment}}/{\text{OD}}_{\text{initial}}))\text{x}100$$

Biofilm eradication assay

Biofilms were allowed to form for 24 h before treatment with CFCS. Following biofilm formation, the plates were incubated with 100 μL of L. reuteri extract (1/2 × MIC and MIC) for 24 h at 37°C. Non-treated biofilms served as controls. The assay was performed as described previously.

Cell lines and culture medium

The SAF-1 fish cell line, derived from gilthead seabream (Sparus auratus L.) (ECACC 00122301, Public Health England) [34], was maintained in 25 cm² tissue culture flasks (Nunc) with L-15 Leibowitz medium (Life Technologies) supplemented with 10% FCS, 2 mM L-glutamine, 100 IU/mL penicillin, and 100 mg/mL streptomycin. Cells were cultured at 25 °C in a humidified incubator. Cells were detached using trypsin (0.25% in PBS, pH 7.2–7.4) for subculturing [35].

Effect of pre-exposure to L. reuteri on S. Typhimurium adhesion to SAF-1 cells

The impact of L. reuteri on S. Typhimurium adhesion was assessed as described by G. Wang et al. (2014), with modifications [36]. SAF-1 cell monolayers were washed with PBS, treated with 1 mL of L. reuteri CFCS (1/2 MIC) or antibiotic-free medium for 2 h, and then exposed to 1 mL of S. Typhimurium (10⁷ CFU/mL). After incubation for 2 h, the wells were washed, lysed with Triton X-100, and bacteria were quantified on Xylose Lysine Deoxycholate (XLD) and De Man, Rogosa, Sharpe (MRS) agar.

Quantitative real-time PCR

To assess mRNA expression levels in SAF-1 cells exposed to Limosilactobacillus reuteri extract following S. Typhimurium adhesion, quantitative real-time PCR was performed. RNA was extracted from the cells using TRIzol Reagent (Invitrogen), quantified, and its purity was checked using a spectrophotometer (Nanodrop). To eliminate any residual genomic DNA, the RNA was treated with DNase I (Promega). Complementary DNA (cDNA) was synthesized from 1 μg of RNA using SuperScriptIII reverse transcriptase (Invitrogen, Spain) with an oligo-dT18 primer.

Gene expression analysis was carried out using an ABI PRISM 7500 real-time PCR system (Applied Biosystems) with SYBR Green PCR Core Reagents (Applied Biosystems). Each reaction mixture contained 10 μL of 2 × SYBR Green supermix, 5 μL of primers (0.6 μM each), and 5 μL of cDNA template. The PCR conditions included an initial denaturation at 95 °C for 10 min, followed by 40 cycles of 15 s at 95 °C, 1 min at 60 °C, and a final cycle of 15 s at 95 °C, 1 min at 60 °C, and 15 s at 95 °C. Gene expression levels were normalized to the elongation factor 1α (ef1α) content. All experiments were conducted in triplicate, and primer sequences are listed in Table 1.

Table 1.

Primers used for real-time PCR analysis

Target gene	Forward primer (5′–3′)	Reverse primer (5′–3′)	GenBank no
ef1α	TGTCATCAAGGCTGTTGAGC	GCACACTTCTTGTTGCTGGA	AF184170
il-1β	GGGCTGAACAACAGCACTCTC	TTAACACTCTCCACCCTCCA	AJ277166
il-6	AGGCAGGAGTTTGAAGCTGA	ATGCTGAAGTTGGTGGAAGG	AM749958
il-8	GCCACTCTGAAGAGGACAGG	TTTGGTTGTCTTTGGTCGAA	AM765841
sod	CCATGGTAAGAATCATGGCGG	CGTGGATCACCATGGTTCTG	AJ937872
cat	TTCCCGTCCTTCATTCACTC	CTCCAGAAGTCCCACACCAT	FG264808
gr	CAAAGCGCAGTGTGATTGTGG	CCACTCCGGAGTTTTGCATTTC	AJ937873

ef1α elongation factor 1α, il-1β interleukin-1β, il-6 interleukin-6, il-8 interleukin-8, sod Cu Zn-superoxide dismutase, cat catalase, gr glutathione reductase

Statistical analysis

Data are presented as mean ± SEM. Statistical significance between groups was assessed using one-way analysis of variance (ANOVA), followed by Tukey’s post-hoc test for multiple comparisons. All statistical analyses were performed using the Statistical Package for Social Sciences (SPSS, version 19.0, USA). A p-value of less than 0.05 was considered statistically significant.

Results

In vitro anti-bacterial activity of L. reuteri CFCS

The effectiveness of L. reuteri CFCS, both unprocessed and after pH neutralization, was assessed against both normal and stressed Salmonella Typhimurium in seawater microcosms over a four-year period. The extracts demonstrated varying levels of antimicrobial activity under different conditions. In acidic environments, the minimum inhibitory concentration (MIC) ranged from 16.66% ± 1 to 30% ± 1.9, while the minimum bactericidal concentration (MBC) ranged from 35% ± 2 to 40.33% ± 1.05. However, after adjusting the pH to neutral, most extracts lost their antimicrobial efficacy. Notably, stressed S. Typhimurium (S2) exhibited greater resistance to the extracts, with an MIC of 60% ± 1.2 and an MBC greater than 90% (Table 2).

Table 2.

Minimum inhibitory and minimum bactericidal concentrations of Cell-Free Culture Supernatant against normal and stressed Salmonella Typhimurium

Strains	Antimicrobial susceptibility
	CFCS (%) (pH = 4.2 ± 0.2)		CFCS (%) (pH = 7.0 ± 0.2)
	MIC	MBC	MIC	MBC
Unstressed (S1)	18.33 ± 2.5Cb	35.66 ± 0.76Cb	60 ± 1.03Ba	80.33 ± 0.78Ab
Stressed (S1)	16.66 ± 1Cc	35 ± 2Bb	50.66 ± 0.65Ab	65.66 ± 2.1Ac
Unstressed (S2)	30 ± 1.9Ca	40.33 ± 1.05Ba	55.3 ± 0.8Ba	80 ± 0.92Ab
Stressed (S2)	20.33 ± 1.05Cb	35.33 ± 0.9Cb	60 ± 1.2Ba	> 90Aa

Cell-Free Culture Supernatant: CFCS; MIC: Minimum inhibitory concentration; MBC: Minimum bactericidal concentration;

(S1): Salmonella Typhimurium 14028; (S2): Salmonella Typhimurium LT2 DT104

Different capital letters in each row indicate significant differences for the same strain using different concentrations of L. reuteri extracts and different small letters in each column indicate significant differences between strains for the same test (p < 0.05)

DPPH radical scavenging activity

The radical scavenging activity of L. reuteri was evaluated using the DPPH assay. As illustrated in Fig. 1, intact L. reuteri cells exhibited a DPPH radical scavenging activity of 38.15% ± 3.12, whereas the cell-free culture supernatant (CFCS) showed a lower activity of 23.02% ± 3.52.

Fig. 1 .

Antioxidant activity of intact cells and Cell-Free Culture Supernatant (CFCS) of L. reuteri (OL468126.1) measured by DPPH radical scavenging. Data are expressed as mean ± standard deviation (n = 3). Different letters on each bar representing significant differences (p < 0.05)

Anti-biofilm activity of L. reuteri CFCS

The ability of L. reuteri CFCS (pH = 4.2 ± 0.2) to inhibit biofilm formation was evaluated using MIC and half-MIC concentrations, as shown in Fig. 2. The CFCS demonstrated anti-biofilm activity against all tested strains of S. Typhimurium under both normal and stressed conditions. Stressed S. Typhimurium (S2) was particularly adherent to polystyrene microplates in the presence of CFCS, showing the lowest biofilm inhibition at 23.45% ± 2.01 and 17.13% ± 1.64 for MIC and half-MIC, respectively. The eradication of biofilm varied, with effectiveness ranging from 9.15% ± 1.6 to 51.2% ± 3.1, with stressed S. Typhimurium (S2) being the most resistant to biofilm eradication, achieving only 9.15% ± 1.6.

Fig. 2.

Antibiofilm effect of Cell-Free Culture Supernatant (CFCS) of L. reuteri (OL468126.1) against normal and stressed S. Typhimurium. Data are expressed as mean ± standard deviation (n = 3). Capital letters are used to indicate the significant differences observed between the strains in the same condition. Different small letters indicate significant differences for the same strain at different conditions (p < 0.05). (S1): Salmonella Typhimurium 14028; (S2): Salmonella Typhimurium LT2 DT104; MIC: Minimum inhibitory concentration

Anti-adhesion effect of L. reuteri CFCS on SAF-1 cells

To assess the anti-adhesion properties, SAF-1 cells were pre-incubated with L. reuteriCFCS (pH = 4.2 ± 0.2) for 2 h at a multiplicity of infection (MOI) of 1:100, followed by infection with normal and stressed S. Typhimurium at an MOI of 1:10. As depicted in Fig. 3, the presence of CFCS significantly reduced bacterial adhesion. Specifically, adhesion of S. Typhimurium (S1) and (S2) to SAF-1 cells was reduced by 48.53% ± 4.22 and 52.35% ± 3.54, respectively, in the presence of L. reuteri CFCS. Stressed S. Typhimurium (S1) showed higher adherence to SAF-1 cells pre-exposed to CFCS.

Fig. 3.

A, B. Effect of pre-exposure of L. reuteri CFCS to SAF-1 cells on adhesion of normal and stressed S. Typhimurium strains S1 (A) and S2 (B). Percent adhesion values are given relative to the adhesion of each strain to SAF-1 cells without exposure to L. reuteri, which were taken as 100%. Each value shown was the mean standard error of the three experiments. Means with no common letters differ significantly (P < 0.05). (S1): Salmonella Typhimurium 14028; (S2): Salmonella Typhimurium LT2 DT104

Gene expression profiles indicate oxidative stress and immune response

Gene expression related to oxidative stress and immune responses was assessed in SAF-1 cells pre-exposed to L. reuteri CFCS before infection with normal and stressed S. Typhimurium. The expression levels of oxidative stress-related genes, including sod, cat, and gr, were significantly altered. Specifically, sod expression increased significantly (p < 0.05) in cells infected with stressed S. Typhimurium (S2) and Vibrio alginolyticus (ATCC 33787). Notably, cat expression was more strongly upregulated in cells infected with stressed S. Typhimurium (S2) than in those infected with V. alginolyticus (p < 0.05). In contrast, cat expression was downregulated in cells infected with non-stressed S. Typhimurium. Pre-treatment with CFCS led to decreased gr expression in cells infected with V. alginolyticus. Immune-related genes (il8, il6, and il1b) were also examined. il8 was significantly upregulated in all infection cases, while il6 expression increased significantly in cells infected with stressed S. Typhimurium. The il1b gene showed increased expression in cells infected with V. alginolyticus and non-stressed S. Typhimurium Fig. 4.

Fig. 4.

Expression of genes related to oxidative stress (sod, cat and gr) and immune response (il8, il6 and il1b) in SAF-1 cells. Bars represent the mean ± SEM from three independently isolated RNA samples. Statistically significant differences (P ≤ 0.05) between control and treated cells with CFCS of L. reuteri (*) and between the different species (#) were denoted. (S2): Salmonella Typhimurium LT2 DT104

Discussion

Pathogenic microorganisms in food represent a major public health concern and cause substantial economic losses worldwide [37]. Among these, Salmonella contamination in fish products poses a significant food safety risk [38]. Although Salmonella is often associated with poultry, it also affects other animals, including fish [39]. In this context, probiotics have emerged as promising alternatives to antibiotics for preventing and controlling Salmonella infections in aquaculture [40].

Recent studies have shed new light on the probiotic functions of L. reuteri. This bacterium produces a variety of antimicrobial substances, including bacteriocins like reuterin, which help to directly inhibit harmful pathogens such as Salmonella, Clostridium difficile, and Escherichia coli [41, 42]. Its benefits don’t stop there. L. reuteri also supports the balance of the gut microbiota by encouraging the growth of good bacteria and suppressing harmful ones, which helps maintain intestinal health [43, 44]. Moreover, it interacts with the immune system in ways that boost the body’s natural defenses, promoting the production of antimicrobial peptides and fine-tuning immune responses to better fight infections and reduce inflammation [45, 46]. These diverse actions make L. reuteri a promising probiotic with potential benefits not only for humans but also for other animals, including fish.

Unlike previous research mainly focused on terrestrial hosts, our study uniquely evaluates L. reuteri OL468126.1 against atypical S. Typhimurium strains in SAF-1 fish cells, thus contributing novel insights to probiotic research in aquatic environments.

Our primary findings indicate that L. reuteri CFCS exhibit strong antimicrobial activity against both normal and stressed S. Typhimurium strains, with acidic pH conditions enhancing this effect. This aligns with previous reports highlighting the role of organic acids and antimicrobial peptides produced by lactic acid bacteria in pathogen inhibition [47, 48]. Furthermore, antioxidant activity measured by the DPPH assay revealed that intact probiotic cells possess superior free radical scavenging capacity compared to Cell-Free Culture Supernatant, consistent with documented antioxidative properties of Lactobacillus strains [36, 49].

Biofilm formation by Salmonella complicates antimicrobial treatments. Our data demonstrate that L. reuteri CFCS variably inhibit biofilm formation, likely through compounds such as hydrogen peroxide and biosurfactants present in the cell-free supernatant [50, 51]. Additionally, the observed anti-adhesion effects in SAF-1 cells support the role of probiotics in preventing pathogen colonization, a crucial mechanism for maintaining gut health [52, 53].

Gene expression analyses further showed that L. reuteri modulates oxidative stress-related and immune response genes in SAF-1 cells, indicating enhanced cellular defense mechanisms [54–56].

However, several limitations should be acknowledged. The in vitro SAF-1 cell model, while relevant, cannot fully replicate the complex host–pathogen interactions occurring in vivo, including the role of the intestinal microbiome and environmental factors. Moreover, the long-term effects of L. reuteri application under real aquaculture conditions remain to be validated. Future studies should therefore include in vivo trials, dosage optimization, and exploration of synergistic effects with other probiotics or antimicrobial agents.

In conclusion, this study highlights the multifaceted probiotic potential of Limosilactobacillus reuteri OL468126.1, exhibiting antimicrobial, antioxidant, antibiofilm, and anti-adhesion activities against atypical S. Typhimurium in an aquatic cellular model. Our findings offer novel contributions distinct from existing terrestrial host-focused research.

From an applied perspective, these results support the integration of L. reuteri into aquaculture production chains, for instance through dietary supplementation or water treatments, to reduce antibiotic use, improve fish health, and enhance food safety. Such approaches align with sustainable development goals and strategies to combat antimicrobial resistance.

Authors contributions

All authors contributed to the study’s conception and design. Ibtissem Chakroun, Abdelkarim Mahdhi and Maria Angeles Esteban designed and supervised the study. Ibtissem Chakroun revised manuscript. Ibtissem Chakroun, Kais Fedhila and Cristóbal Espinosa-Ruiz performed experiments. Ibtissem Chakroun and Kais Fedhila analyzed data and co-wrote the paper. All authors analyzed the results and contributed to the manuscript writing, and approved the final version of the manuscript.

Funding

This research received no external funding.

Data availability

The data and materials supporting the findings of this study are available upon reasonable request. Researchers interested in accessing the data or materials used in this study may contact the corresponding author for further information.

Declarations

Ethical approval

Ethical approval was not required for this in vitro study.

Competing interests

The authors declare no conflict of interest.