Skip to main content
NCBI home page
Gastro Hep Advances logoLink to Gastro Hep Advances
. 2025 Sep 24;5(2):100817. doi: 10.1016/j.gastha.2025.100817

Cysteine Restriction Induces Ferroptosis Depending on the S-adenosylmethionine and Polyamine Biosynthetic Pathways in Hepatic Cancer Cells

Keisuke Tada 1,2, Kazuki Mitsuyama 1, Hironari Nishizawa 1, Hiroki Shima 1, Akihiko Muto 1, Motoshi Wada 2, Daisuke Saigusa 3, Kazuhiko Igarashi 1,∗
PMCID: PMC12689205  PMID: 41377684

Abstract

Background and Aims

Liver diseases such as hepatocellular carcinoma are known to be affected by nutrition and metabolic activities, but the mechanisms behind them remain unclear. We aimed to reveal the relationship between the concentration of sulfur-containing amino acids and hepatocellular response, and further investigated the mechanism focusing on methionine adenosyltransferase, which plays the central role in methionine metabolism by synthesizing S-adenosylmethionine (SAM).

Methods

Mouse hepatoma Hepa1 cells were cultured in media with reduced amounts of cysteine, methionine, or both. Cell death was monitored using propidium iodide and annexin V staining followed by flow cytometry. Metabolites were measured by mass spectrometry. Inhibitors of ferroptosis (Fer-1), necroptosis (GSK872), SAM synthesis (cycloleucine), or polyamine synthesis (sardomozide and difluoromethylornithine) were used.

Results

Cysteine restriction induced marked cell death, whereas simultaneous restriction of cysteine and methionine fully suppressed the cell death. Cysteine restriction-induced cell death was suppressed with Fer-1 and GSK872, suggesting the involvement of ferroptosis in this process. Cysteine restriction decreased reduced glutathione, which was rescued by simultaneous restriction of cysteine and methionine. Cysteine restriction-induced cell death was also suppressed by knockdown of MAT2A or its inhibitor cycloleucine. Furthermore, inhibitors of several enzymes in the polyamine biosynthetic pathway also suppressed the cell death. In contrast, primary culture of mouse hepatocytes did not show cell death upon cysteine restriction.

Conclusion

These results suggest that cysteine-glutathione and SAM-polyamine metabolic pathways are critical modulators of ferroptosis of hepatic cancer cells. Since normal liver cells were more resistant to ferroptosis than cancer cells, cysteine restriction may be exploited in treating hepatic cancer by inducing ferroptosis specifically in cancer cells without affecting normal cells in the liver.

Keywords: Cysteine, Ferroptosis, Methionine, S-adenosylmethionine, Hepatoma

Graphical abstract

graphic file with name ga1.jpg

Open in a new tab

Introduction

While the liver is a central organ for organismal metabolism, metabolic activities are also known to affect in turn responses and disease processes of the liver. One such disease is intestinal failure–associated liver disease (IFALD) in the field of pediatric surgery.1 IFALD is a liver disease found in patients who require long-term parenteral nutrition against the background of severe intestinal dysfunction that prevents them from absorbing enough water and nutrients necessary for survival and growth. Because IFALD often progresses to liver cirrhosis,2 control of its onset and progression is very important. As one of the etiologies of IFALD, parenteral nutrition components such as carbohydrates, lipids and amino acids and their administration methods have been pointed out. In addition, various modulatory factors have been suggested, including bacterial infections via parenteral nutrition catheters and translocation of bacteria due to the deterioration of the intestinal epithelial barrier function.3 Although improvements in nutrient administration and improved infection control have resulted in better control of IFALD, it is still not curable. While it has been previously reported that excess methionine causes cholestasis,4 the detailed mechanism remains unclear.

On the other hand, reducing nutritional factors has been shown to affect disease processes of the liver as well.5 The application of methionine restriction (MR) to cancer therapy has been discussed in a wide range of cancer types, including liver cancer.6, 7, 8, 9 The importance of HNF4α in the therapeutic effect of MR on liver cancer has been pointed out based on the finding that HNF4α knockdown allowed liver cancer cell lines to tolerate MR therapy.10 It has been reported that MR shows a lifespan extension effect in several model systems. MR improves glucose metabolism and lipid metabolism in hepatocytes and whole-body cells.11 Promoting the catabolism of S-adenosylmethionine (SAM) in Drosophila contributes to lifespan extension due to dietary restriction.12 Regarding the relationship between hepatocytes and amino acids, there have been reports showing that the concentration of extracellular amino acids determines the degree of maturity of hepatocytes13 and that lack of extracellular amino acids induces hepatocytes into a quiescent state.14

Methionine adenosyltransferase (MAT) is a central enzyme in methionine metabolism, synthesizing SAM from methionine and adenosine triphosphate.15 The subunits of MAT are encoded by 3 genes, Mat1a, Mat2a and Mat2b. MAT has multiple isozymes depending on its subunit composition. MAT1 is a tetramer of MAT1A whereas MAT3 is a dimer of MAT1A.16,17 MAT2 is composed of the catalytic subunit MAT2A and the regulatory subunit MAT2B that stabilizes MAT2A.16, 17, 18 MAT1 and MAT3 are expressed in the liver whereas MAT2 is expressed in almost all tissues of the body, developing liver and hepatocellular carcinoma but not in the normal liver.15,19 Upon transformation of hepatocytes to cancer, the expression of MAT1A is decreased whereas that of MAT2A is increased.20 SAM is a major intracellular methyl group donor, and is used for methylation of DNA, RNA, and histones via methyltransferases, resulting in changes in gene expression.21 Consistent with its roles in gene regulation, both MAT2 and MAT1 are present in the nuclear compartment.22, 23, 24 In addition to histones, nonhistone proteins such as transcription factors, ribosomal proteins and translation factors are also methylated to regulate their activity.25,26 Furthermore, SAM is involved in the methylation of lipids and carbohydrates.27,28 Among various organs and cells, it is known that transmethylation reactions are most actively carried out in the liver.29 SAM is also used in polyamine synthesis.30 Sulfur-containing amino acids methionine and cysteine are also involved in the synthesis of glutathione (GSH), one of the critical reducing agents against oxidative stress.30

Considering the possibility that alterations in the sulfur-containing amino acids modulate the fate of the liver cells, we investigated the effect of the restriction of these amino acids using Hepa1 cells derived from mouse hepatoma and primary mouse hepatocyte culture as cell models. We found efficient induction of ferroptosis, an iron-dependent cell death, upon cysteine restriction (CR) in Hepa1 cells but not in primary liver cells. CR-induced ferroptosis of Hepa1 cells was dependent on MAT2 and polyamine synthesis. Our findings suggest a connection between ferroptosis and SAM metabolism in proliferating liver cells.

Experimental Procedures

Animal Experimentation

The wild type mice on the C57BL/6J background were bred at the animal facility of Tohoku University. Mice were housed under specific pathogen-free conditions. All experiments performed in this study were approved by the Institutional Animal Care and Use Committee of the Tohoku University Environmental & Safety Committee.

Reagents

Erastin, (1S, 3R)-RSL3 (RSL3), dimethyl sulfoxide, α-tocopherol (α-Toc), Ferrostatin-1 (Fer-1), chloroquine, and RNase A were purchased from Sigma-Aldrich (St. Louis, MO). MG132 was purchased from Calbiochem (San Diego, CA). Trypsin was purchased from GL Science (Fukushima, Japan). APC-Annexin V was purchased from Becton, Dickinson and Company (BD) (Franklin Lakes, NJ). Sardomozide dihydrochloride and difluoromethylornithine (DFMO) were from Axon Medchem (Reston, VA).

Primary Hepatocyte Isolation

Primary hepatocyte isolation from wild type mice (14 weeks old, male) was performed as previously described.41 Briefly, after anesthesia with isoflurane, the portal vein was cannulated. After cutting the inferior vena cava, the liver was perfused with Liver perfusion medium (Thermo Fisher Scientific) at 37 °C for 10 minutes. Subsequently, after perfusion with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid buffer containing 0.05% collagenase for an additional 10 minutes, the liver tissue was excised. The liver was suspended in Dulbecco's modified Eagle medium (DMEM) and passed through a 70 μm nylon mesh. Centrifugation was performed using Percoll to purify the hepatocytes.

Cell Culture

Mouse hepatoma cell line Hepa1c1c7 (Hepa1) was cultured using DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 0.1 mg/ml streptomycin as a normal medium. Conditioned media for methionine and cysteine were prepared as follows: 10% dialyzed fetal bovine serum (Gibco, Carlsbad), 100 U/ml penicillin, 0.1 mg/ml streptomycin and 4 mM glutamine (Gibco, Carlsbad) were added in DMEM without glutamine, methionine and cysteine (Gibco, Carlsbad). L-methionine (Sigma-Aldrich, St. Louis) and L-cystine (Sigma-Aldrich, St. Louis) were added to this medium and adjusted to 10 μM or 200 μM, respectively. Normal medium41: 200 μM methionine and 200 μM cysteine. MR medium: 10 μM methionine and 200 μM cysteine. CR medium: 200 μM methionine and 10 μM cysteine. Methionine CR medium: 10 μM methionine and 10 μM cysteine. Inhibitors and metabolites were added to cells which were cultured in the normal medium for 24 hours and washed in phosphate buffered saline (PBS) at concentrations: 100 μM Z-VAD-fmk, 10 μM GSK872, 5 μM Fer-1, 100 μM NAC, 30 mM Cleu, 100 μM Sardomozide, 200 μM DFMO, 50 μM each of putrescine, spermidine or spermine.

RNA Interference

All siRNAs (siControl: Stealth RNAiTM siRNA Negative Control, Med GC, siMat2a #911: MSS232488) were obtained from Invitrogen (Carlsbad, CA). The target sequence of the siMat2a (911) RNAi is; 5′-AGGAAAGGATTATACCAAAGTGGAC-3’. Hepa1 cells were transfected with siRNAs using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's protocols. After transfection, Hepa1 cells were passaged to dishes or culture plate with culture medium.

Western Blotting

Cells were treated with trypsin, pelleted, and washed twice in PBS. Cells were lysed by radioimmunoprecipitation assay buffer (50 mM Tris-HCl (pH = 7.4), 1 mM ethylenediaminetetraacetic acid, 150 mM NaCl, 1% (v/v) NP-40, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) sodium dodecyl sulfate (SDS)) and then mixed by shaking for 10 minutes at 4 °C. After that, centrifugation was performed at 4 °C and 15,000 rpm for 10 minutes, and the supernatant was collected. 5×SDS sample buffer (312.5 mM Tris-HCl (pH = 6.8), 25% (v/v) 2-Mercaptoethanol, 10% (w/v) SDS, 50% (w/v) glycerol, 0.01% (w/v) bromophenol blue) was added and heated for 5 minutes. Lysates were resolved on 10% SDS–PAGE gels and transferred to PVDF membranes (Millipore, Billerica, MA). The membranes were blocked for 1 h in blocking buffer [3% Skim milk (Sigma-Aldrich) in T-tris-buffered saline (TBS) buffer (0.05% Tween 20 (Sigma-Aldrich) in TBS)] and subsequently incubated with the primary antibodies in T-TBS buffer containing 1% Skim milk overnight at 4 °C. After washing in T-TBS, secondary antibodies were incubated with the membranes as above. Immune complexes were detected using PierceTM ECL Plus Western Blotting Substrate (Thermo Fisher Scientific 32,132) and images were captured using ChemiDocTM MP Imaging System(Bio-Rad). The antibody for ACTB (ab3280) was purchased from Abcam (Cambridge, UK). The antibody for MAT1/3 (sc-28029) was purchased from Santa Cruz Biotech (Dallas, Texas). The antibodies for MAT2A and MAT2B were previously described.23 For the quantification of signals, all samples to be compared were run on the same gel. Bands were quantified using ImageJ. All bands to be compared were quantified on the same image and were within the linear range of detection of the software.

Quantitative PCR with Reverse Transcription

Total RNA was purified with RNeasy plus mini kit (Qiagen, Hilden, Germany). Complementary DNA was synthesized by High Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster city, CA). Quantitative PCR was performed using LightCycler Fast Start DNA Master SYBR Green I, and LightCycler 96 (Roche). mRNA transcript abundance was normalized to that of Actb. Sequences of the quantitative polymerase chain reaction primers are as follows. Actb: 5′–CGTTGACATCCGTAAAGACCTC–3′ and 5′–AGCCACCGATCCACACAGA–3′. Mat1a: 5′–TGCTGGATGCCCATCTCAAG–3′ and 5′–GCATAGCCGAACATCAAACC–3′. Mat2a: 5′–GGTGTTCATCTTGACCGGAATG–3′ and 5′–GCGGCGTAGTTCAGCCAATT–3′. Mat2b: 5′–AGGGAACCTTTCACTGGTCTG–3′ and 5′–ATTTGGAGCAATCGAGCTGAG–3′

Cell Death Assessment by Flow Cytometry

Propidium iodide (PI) and annexin V staining were used for assessment of cell death. Hepa1 or primary hepatocytes were stained by APC-Annexin V according to the manufacturer's protocols. PI was added (1 μg/mL) before flow cytometry. Hepa1 or primary hepatocytes were sorted with a FACS Verse (BD), and analyzed by FlowJo software (Tree Star, Ashland, OR). Cells that were positive for either or both of annexin V and PI were assessed as dead cells. Conversely, cells that were negative of both annexin V and PI were assessed as alive cells.

Metabolite Quantification by Mass Spectrometry

Cells were harvested, washed once with cold PBS, and stored at −80 °C. The sample was suspended in 100 μL of methanol containing the internal standards (1 μg/mL SAM-13C515N for positive ion mode and 1 μg/mL GSH-13C215N for both positive and negative ion mode), and were homogenized by mixing for 30 seconds followed by sonication for 5 minutes. After centrifugation at 16,400 × g for 10 minutes at 4 °C followed by deproteinization, 3 μL of each extract was analyzed by ultra-high-performance liquid chromatography triple quadrupole mass spectrometry (UHPLC-MS/MS). The UHPLC-MS/MS analysis was performed on an Acquity™ Ultra Performance LC I-class system (Waters Corp. Milford, UK) interfaced to a Waters Xevo TQ-XS MS/MS system equipped with electrospray ionization. The detailed parameters of ionization, detection by selected ion monitoring and UHPLC condition were modified and used based on the previous method.51 The detected peak area ratio calculated with the optimal internal standard and all values were normalized to cell number.

Statistics

For all experiments, differences of data sets were considered statistically significant when P values were lower than 0.05. Statistical comparisons were performed using the 2-sided t-test in comparison between the 2 groups. For the t-test, student’s t-test was used when the standard deviation68 of the groups was not significantly different by f-test. Welch’s t-test was used when the standard deviation of the groups was significantly different by f-test.

Manuscript Preparation

All authors had access to the study data and had reviewed and approved the final manuscript.

Results

Cysteine Restriction-Induced Cell Death is Rescued by Methionine Restriction

To investigate whether the concentrations of methionine and cysteine affect cell death, Hepa-1 cell lines were cultured in culture media containing these amino acids at 10 μM or 200 μM, and the cell death was analyzed by flow cytometry (Figure 1A). CR (ie, 10 μM) induced significant cell death, whereas MR did not. Interestingly, simultaneous restriction of cysteine and methionine did not induce cell death (Figure 1B and D). The simultaneous restriction also supported cell proliferation whereas CR suppressed it. It should be noted that MR did not reduce cell proliferation (Figure 1E). Previous reports have shown that cell death induced by cysteine-free medium is ferroptosis.31, 32, 33 In order to determine the type of cell death induced by CR in this study, we compared effects of various cell death inhibitors in combination with CR (Figure 2A). Fer-1, a ferroptosis inhibitor, markedly inhibited cysteine-restricted cell death, but Z-VAD-fmk, an apoptosis inhibitor, did not significantly suppress cell death. On the other hand, GSK872, an necroptosis inhibitor, showed a certain cell death suppression effect, but the effect was smaller than that of Fer-1 (Figure 2A). These results suggest that CR-induced cell death of Hepa1 cells is mainly due to ferroptosis, although other types of cell death could coexist. The execution of ferroptosis requires the presence of reactive oxygen species (ROS) that leads to lipid peroxidation.34,35 To examine the effect of ROS on cysteine-restricted cell death, we administered N-acetylcysteine which is a ROS scavenger, and quantified cell death (Figure 2B). N-acetylcysteine markedly suppressed cysteine-restricted cell death, suggesting that ROS is involved in the cell death in response to CR.

Figure 1.

Figure 1

Open in a new tab

CR-induced cell death is rescued by simultaneous MR. (A) Experimental flow chart. Normal medium (NM),41 MR (MR), CR, and methionine and MCR. (B–D) Light microscope image (B) and percentage of live cells (C and D) of Hepa-1 cells cultured under the indicated conditions for 48 hours. Representative data (B and C) or means and SD (D) of 3 experiments are shown. (E) Proliferation of Hepa-1 cells under the indicated conditions. Means and SD of 3 experiments are shown. The P values are comparison between CR and other conditions at 36 hours. MCR, methionine and CR; SD, standard deviation.

Figure 2.

Figure 2

Open in a new tab

CR-induced cell death is ferroptosis. (A) Percentage of live cells in Hepa-1 cells cultured for 48 hours in cysteine-limited medium supplemented in the presence of Z-VAD-fmk, GSK872 or Fer-1. (B) Percentage of live cells in Hepa-1 cells cultured for 48 hours in cysteine-limited medium supplemented with NAC. Means and SD of 3 experiments are shown. NAC, N-acetylcysteine; SD, standard deviation.

Cysteine Restriction-Induced GSH Decrease is Rescued by Simultaneous Restriction of Cysteine and Methionine

Methionine and cysteine are sulfur-containing amino acids closely linked in their metabolism (Figure 3A). SAM is used for transmethylation reactions and converted to S-adenosylhomocysteine (SAH) by methyltransferases such as GNMT, which is then metabolized to homocysteine. Homocysteine is synthesized to methionine by methionine synthase, or is metabolized in the transsulfuration pathway, which synthesizes GSH, a major intracellular antioxidant, and hence maintains cellular redox homeostasis.36 To investigate the impact of methionine and CR on sulfur metabolism and redox balance, metabolites were analyzed by mass spectrometry under their individual restrictions or in combination (Figure 3B).

Figure 3.

Figure 3

Open in a new tab

CR-induced GSH decrease is rescued by MR (A) This diagram illustrates the methionine cycle and its downstream metabolic branches, including the transsulfuration pathway, GSH synthesis, and polyamine metabolism. AHCY, CBS, CTH, GCL, γ-Glu-Cys, GS, GSH, SAM decarboxylase (AMD1), MTA, MTAP. (B) Intracellular concentrations of indicated metabolites were quantified by LC-MS/MS. Bar plots show means ± SD (n = 3), with individual data points overlaid. P values were calculated using unpaired 2-tailed t-tests with CR as the reference group. AHCY, S-adenosylhomocysteine hydrolase; CTH, cystathionine γ-lyase; GCL, glutamate-cysteine ligase; γ-Glu-Cys, γ-glutamylcysteine; GS, glutathione synthetase; MTA, 5′-methylthioadenosine; MTAP, methylthioadenosine phosphorylase.

MR decreased intracellular methionine levels and increased homocysteine levels. In addition, the levels of transsulfuration pathway intermediates, including cystathionine, cysteine, and γ-glutamylcysteine, and GSH were significantly increased. In contrast, CR led to a marked reduction in GSH despite elevated levels of cystathionine and γ-Glu-Cys. The reduced to oxidized glutathione (GSH/oxidaized glutathione) ratio was significantly decreased only under CR, indicating a profound disruption in redox balance. Notably, CR-induced GSH decrease was rescued by simultaneous restriction of cysteine and methionine. These findings indicate that MR increases GSH, maintaining intracellular redox balance under CR and hence protecting cells from oxidative stress-induced damages. Additionally, simultaneous restriction of cysteine and methionine significantly reduced the level of SAH, which is known to inhibit cystathionine β-synthase (CBS),37 compared to CR. In accordance with this, the levels of cystathionine and γ-Glu-Cys increased. These findings suggest that MR alleviates SAH accumulation, thereby restoring CBS activity, promoting de novo cysteine synthesis, and supporting GSH biosynthesis under CR.

Cysteine Restriction-Induced Cell Death Depends on SAM Synthesis

In addition to contributing to protein synthesis, methionine is an important SAM precursor. It has been reported that homeostasis of SAM synthesis is maintained by feedback control by SAM.38,39 Therefore, we next evaluated the gene expression of Mat2a and Mat2b involved in SAM synthesis and the amounts of the MAT2A and MAT2B proteins (Figure 4). Mat2a mRNA was upregulated under MR as expected, but not under CR (Figure 4A). In addition, an increase in the Mat2a mRNA was also observed under the combined restriction of cysteine and methionine. On the other hand, Mat2b mRNA expression was elevated by both methionine and CRs. The MAT2A protein under MR showed changes that mirrored its mRNA, but a milder increase was also observed under CR (Figure 4B and C). There was no significant difference in the amount of MAT2B protein under these conditions. These results suggested that increased MAT2A may protect against cell death induced by CR.

Figure 4.

Figure 4

Open in a new tab

Changes of MAT2A expression under restriction of sulfur-containing amino acids. (A) Expression levels of Mat2a and Mat2b mRNA in Hepa-1 cells cultured for 24 hours under indicated conditions. Relative values were calculated using Actb as an internal control. (B and C) Protein levels of MAT2A, MAT2B, and beta-actin (B) in Hepa-1 cells cultured as above and relative values using beta-actin as an internal control (C). These samples were derived from the same experiment and that gels/blots were processed in parallel. Relative values were calculated by calculating brightness using ImageJ. Means and SD (A and C) and representative data (B) of 3 experiments are shown. MCR, methionine and CR; SD, standard deviation.

In order to investigate this possibility, we combined a MAT inhibitor cycloleucine (Cleu) or a siRNA-mediated Mat2a knockdown with CR (Figure 5A and B). In contrast to the prediction, cysteine-restricted cell death was not enhanced under these treatments, but cell death was almost completely suppressed. It was suggested that MAT2A promoted the process of cell death when cysteine was restricted, rather than suppressing it.

Figure 5.

Figure 5

Open in a new tab

CR-induced cell death depends on SAM synthesis. (A) Percentage of live cells in Hepa-1 cells cultured for 48 hours in cysteine-restricted medium supplemented with or without cycloleucine. (B) Percentage of live cells in Mat2a-knockdown Hepa-1 cells cultured as above.

Cysteine Restriction-Induced Cell Death is Rescued by Inhibition of Polyamine Biosynthesis

Next, we focused on SAM metabolism to verify the mechanism of cell death due to CR. In addition to the methylation and transsulfuration pathways, SAM is also metabolized in the polyamine biosynthetic pathway, converted to decarboxy SAM by SAM decarboxylase, which is then used along with putrescine in the synthesis of spermidine and spermine (Figure 6A). It has been reported that a large amount of ROS is produced during the process of polyamine biosynthesis, and activation of polyamine biosynthesis increases the demand for cysteine in cancer cells.40 To evaluate the effects of the polyamine biosynthetic pathway on cell death during CR, we quantified cell death using sardomozide, the SAM decarboxylase inhibitor, and DFMO, the ornithine decarboxylase inhibitor (Figure 6B). Both inhibitors inhibited cell death under CR, suggesting that the polyamine biosynthetic pathway is involved in the execution of this cell death. To investigate the possibility that polyamines themselves induce cell death, putrescine, spermidine, and spermine were administered under the combined restriction of cysteine and methionine to evaluate cell death (Figure 6C). Putrescine administration did not cause cell death, whereas spermidine and spermine administration induced significant cell death. However, spermidine- or spermine-induced cell death was not suppressed by Fer-1 (Figure 6D). Unlike endogenous products from the polyamine biosynthetic pathway, exogenous spermine and spermidine appeared to cause cell death other than ferroptosis when added extracellularly. These results suggested that endogenous and exogenous polyamines have distinct roles in cell death.

Figure 6.

Figure 6

Open in a new tab

CR-induced cell death is suppressed by inhibition of polyamine biosynthesis. (A) Conceptual diagram of SAM metabolism. (B) Percentage of live cells in Hepa-1 cells cultured for 48 hours in cysteine-restricted medium supplemented with Sardomozide or DFMO. (C) Percentage of live cells of Hepa-1 cell line cultured for 48 h in cysteine- and methionine-restricted medium supplemented with putrescine, spermidine, or spermine. (D) Percentage of live cells in Hepa-1 cells cultured as above with Fer-1. Means and SD of 3 experiments are shown. BHMT, betaine homocysteine methyltransferase; CTH, cystathionine gamma-lyase; DFMO, difluoromethylornithine; MCR, methionine and CR; MS, methionine synthase; MTA, 5′-methylthioadenosine; MTs, methyltransferases; ODC, ornithine decarboxylase; SAHH/AHCY, S-adenosylhomocysteine hydrolase/adenosylhomocysteinase; SAMDC, SAM decarboxylase.

Cysteine Restriction Does Not Induce Cell Death in Mouse Primary Hepatocytes

Next, we investigated how the concentrations of methionine and cysteine affect primary hepatocytes. Primary hepatocytes were extracted from wild type mice by the previously reported method.41 Primary hepatocytes were cultured in the same manner as Hepa1, and cell death was analyzed with flow cytometry (Figure 7A and B). In contrast to Hepa1 cells, the primary hepatocytes did not undergo cell death under CR. We then assessed gene expression of Mat1, Mat2a, Mat2b and the MAT1/3, MAT2A, and MAT2B proteins under these conditions (Figure A1A–C). Mat2a mRNA expression tended to increase under MR, and Mat2b mRNA expression tended to increase under methionine-cysteine simultaneous restriction. Mat1 mRNA expression was very low irrespective of the conditions, suggesting that the effect of preculture for 24 hours decreased its expression. There was no significant difference in the protein levels of MAT1/3, MAT2A, and MAT2B under any condition (Figure A1B and C), unlike the Hepa1 cells.

Figure 7.

Figure 7

Open in a new tab

CR does not induce cell death in mouse primary hepatocytes. (A and B) Light microscope image (A) and percentage of live cells (B) of primary hepatocytes cultured for 48 hours under indicated conditions. Representative data (A) or means and SD of 3 experiments are shown. MCR, methionine and CR; SD, standard deviation.

Discussion

Links of metabolism and liver cell responses are emerging as critical mechanisms in disease conditions including IFALD, cholestasis, life span extension, and cancer therapy.1,4,9,11 MR has been reported to extend life span in several model animals.12,42, 43, 44, 45, 46 On the other hand, cystine/CR have been shown to promote ferroptosis in several model cell systems.47,48 However, there have been no reports examining the relationship between cysteine and methionine metabolism in hepatocellular response or its damage. In this study, we found that CR efficiently induced cell death in Hepa1 cells derived from murine hepatocarcinoma (Figure 1D). This cell death is judged to be ferroptosis, since it was efficiently suppressed by Fer-1 ferroptosis inhibitor (Figure 2A). GSK872, an necroptosis inhibitor, also suppressed the observed cell death (Figure 2A), suggesting that autophagy is involved in this cell death. A previous report has shown that ferritin-specific autophagy, ferritinophagy, is the cause of cell death in response to CR.49 Ferrous iron released upon ferritinophagy has been shown to promote ferroptosis.50 Indeed, ferrous iron is increased during the induction of ferroptosis.51 Consistent with these observations, the inhibition of ferritinophagy suppresses ferroptosis.52 Taken together with these previous reports, the present results suggest that Hepa1 cells undergo ferroptosis upon CR.

We found that ferroptosis of Hepa1 cells induced by CR was completely rescued by simultaneous restriction of methionine. A previous report has shown that methionine is essential for ferroptosis of fibrosarcoma cells induced by cysteine depletion.53 Another report described that HeLa cells undergo ferroptosis upon cysteine depletion which is relieved by methionine depletion.31 However, unlike these previous reports, methionine and cysteine were not depleted from the medium in this study and were set at 10 μM. While cell cycle arrest upon methionine depletion was suggested as a mechanism that suppresses cell death upon cysteine depletion,31 this appears not to be the case in our study since Hepa1 cells continued to proliferate even under the methionine-restricted conditions. Our results suggest that the suppression of cell death by simultaneous restriction of cysteine and methionine involves a mechanism other than cell cycle arrest.

Measurement of metabolites by mass spectrometry demonstrates that CR significantly reduced GSH. Surprisingly, the decrease in GSH under CR was completely restored by simultaneous restriction of methionine and cysteine. This rescue effect was accompanied by increased levels of cystathionine and γ-Glu-Cys, suggesting an activation of the transsulfuration pathway under simultaneous methionine and CR. Interestingly, SAH, a byproduct of transmethylation and an inhibitor of CBS,37 was elevated under CR and suppressed by simultaneous methionine and CR. While the extent of the SAH was rather small, this change may be sufficient for weakening CBS inhibition by SAH and promoting cysteine biosynthesis. In addition, these metabolic changes may be mediated in part by transcriptional regulators such as ATF4 and NRF2, both of which are known to respond to amino acid deprivation and oxidative stress.54 ATF4, activated downstream of the integrated stress response, transcriptionally upregulates genes involved in amino acid biosynthesis, including CBS and cystathionine γ-lyase.55 Additionally, NRF2 is a major regulator of antioxidant responses, and it regulates genes involved in GSH biosynthesis, such as SLC7A11, GCLM, and GCLC.56

In addition to these possibilities, the patterns of metabolites also suggest another possibility. Under CR, both cysteine and γ-Glu-Cys were rather increased compared with the normal condition. These observations suggest that cysteine itself was efficiently synthesized via transsulfuration pathway but the final reaction step for GSH synthesis was not efficiently catalyzed under CR. Insufficient activity of glutathione synthetase (GS) under CR may result from adenosine triphosphate depletion, transcriptional repression of GS, or its post-translational inhibition.57 Interestingly, this block appears to be rescued by simultaneous restriction of methionine and cysteine. Importantly, single MR increased various precursors of GSH synthesis. These observations suggest that MR increases overall flow of transsulfuration pathway, including the last step of GSH synthesis, GS. The exact mechanism of GS activation in response to MR remains to be clarified. It remains possible that metabolism of other substrates for GSH synthesis, including glycine and glutamic acid, is also altered in response to MR.

Both administration of MAT inhibitor and knockdown of Mat2a almost completely suppressed the cell death induced by CR, suggesting that MAT2 is required for the execution of cell death under CR. Together with the results of MR, it is clear that SAM itself or its downstream event promotes ferroptosis. Our current results suggest that one of the SAM-dependent reactions leading to ferroptosis is polyamine synthetic pathway. There are several reports showing that the activity of the polyamine biosynthetic pathway increases the demand for cysteine in cancer cells.58, 59, 60, 61 Importantly, the activity of the polyamine biosynthetic pathway produces large amounts of ROS40 which can promote ferroptosis.62 We found that inhibition of the 2 enzymes in polyamine biosynthetic pathway suppressed CR-induced cell death. While extracellular administration of polyamines induced cell death, Fer-1 did not suppress this cell death. When taken together, these results suggest that polyamine biosynthetic pathway activity is important for the execution of CR-induced cell death but, when added extracellularly, polyamine can induce other types of cell death as well. A recent report has also shown the involvement of polyamine pathway in enhancing of ferroptosis.63 However, another recent report found that polyamine pathway was not involved in CR-induced ferroptosis even though ferroptosis was suppressed by MR.64 Detailed factors such as the types of cells or duration of treatment with reagents may be critical for each of these findings. We surmise that, under CR, a reduction of GSH and syntheses of SAM and polyamine cooperate to induce ferroptosis.

Since polyamines are essential for cell proliferation and are increased in cancer cells,58, 59, 60 strategies targeting inhibition of polyamine biosynthesis and depletion of polyamines have been suggested.61 However, our present results raise the possibility that inhibition of polyamine metabolism may actually be beneficial for cancer cells in evading ferroptosis. In contrast, CR may be used to induce ferroptosis in the treatment of hepatocellular carcinoma because CR did not induce ferroptosis of primary hepatocytes. By adjusting the amounts of cysteine and methionine in cancer microenvironment, it may become possible to induce ferroptosis specifically in cancer cells without killing other types of cells like normal cells and immune cells.

There are a series of reports linking liver damages and ferroptosis, including NAFLD and NASH.5,65, 66, 67, 68, 69 Recently, it has been reported that the expression of ferroptosis-related genes is elevated in a rat IFALD model.70 Taken together with our present observations, it is possible that sulfur-containing amino acids and SAM metabolism are involved in the onset and progression of IFALD.

Conclusion

In conclusion, our results suggest that SAM-polyamine metabolic pathways are critical modulators of ferroptosis as well as cysteine-glutathione metabolism. It will be important to measure the related metabolites in various ferroptosis models.

Acknowledgments

The authors thank members of the Departments of Biochemistry, Tohoku University Graduate School of Medicine for discussions and support; the Biomedical Research Core of Tohoku University Graduate School of Medicine for technical support; Institute for Animal Experimentation of Tohoku University Graduate School of Medicine for breeding mice.

Authors' Contributions

Keisuke Tada: Conceived the project, carried out the main experiments, interpreted the experimental results, wrote the initial manuscript. Kazuki Mitsuyama: Carried out the main experiments, interpreted the experimental results. Hironari Nishizawa: Conceived the project, guided the main experiments, interpreted the experimental results. Hiroki Shima: Conceived the project, guided the main experiments. Akihiko Muto: Guided and supported experiments. Motoshi Wada: Provided suggestions and insights into related diseases. Daisuke Saigusa: Analyzed metabolites, interpreted the experimental results. Kazuhiko Igarashi: Edited the initial manuscript, conceived the project, interpreted the experimental results.

Footnotes

Conflicts of Interest: The authors disclose no conflicts.

Funding: This work was supported in part by Grants-in-Aid from the Japan Society for the Promotion of Science23K14556, 20K16296 and 19K23738 (to H. N.) and 25K22538, 25H01020, 23K18194, 22H00443, 20KK0176, 20KK0176 and 18H04021 (to K. I.), Grant-in-Aid for Joint Research by Young Researchers (to H.N.), Gonryo Medical Foundation (to H.N.), Takeda Science Foundation (to H.N.), the Casio Science Promotion Foundation Research, and Grant in the Natural Sciences from the Mitsubishi Foundation and (to K.I.).

Ethical Statement: All experiments performed in this study using mice were approved by the Institutional Animal Care and Use Committee of the Tohoku University Environmental & Safety Committee.

Data Transparency Statement: Materials related to this manuscript are available upon request.

Reporting Guidelines: Not applicable.

Material associated with this article can be found in the online version at https://doi.org/10.1016/j.gastha.2025.100817.

Supplementary materials

Figure A1
mmc1.pdf (215.2KB, pdf)
Extended PDF
mmc2.pdf (20.5MB, pdf)

References

  • 1.Duggan C.P., Jaksic T. Pediatric intestinal failure. N Engl J Med. 2017;377(7):666–675. doi: 10.1056/NEJMra1602650. [DOI] [PubMed] [Google Scholar]
  • 2.Khalaf R.T., Sokol R.J. New insights into intestinal failure-associated liver disease in children. Hepatology. 2020;71(4):1486–1498. doi: 10.1002/hep.31152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Norsa L., Nicastro E., Di Giorgio A., et al. Prevention and treatment of intestinal failure-associated liver disease in children. Nutrients. 2018;10(6):664. doi: 10.3390/nu10060664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Moss R.L., Haynes A.L., Pastuszyn A., et al. Methionine infusion reproduces liver injury of parenteral nutrition cholestasis. Pediatr Res. 1999;45(5 Pt 1):664–668. doi: 10.1203/00006450-199905010-00009. [DOI] [PubMed] [Google Scholar]
  • 5.Chen J., Li X., Ge C., et al. The multifaceted role of ferroptosis in liver disease. Cell Death Differ. 2022;29(3):467–480. doi: 10.1038/s41418-022-00941-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhou L., Chen Z., Liu C. Identification and verification of the role of crucial genes through which methionine restriction inhibits the progression of colon cancer cells. Oncol Lett. 2022;24(2):274. doi: 10.3892/ol.2022.13394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wanders D., Hobson K., Ji X. Methionine restriction and cancer biology. Nutrients. 2020;12(3):684. doi: 10.3390/nu12030684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Strekalova E., Malin D., Rajanala H., et al. Preclinical breast cancer models to investigate metabolic priming by methionine restriction. Methods Mol Biol. 2019;1866:61–73. doi: 10.1007/978-1-4939-8796-2_6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Sedillo J.C., Cryns V.L. Targeting the methionine addiction of cancer. Am J Cancer Res. 2022;12(5):2249–2276. [PMC free article] [PubMed] [Google Scholar]
  • 10.Xu Q., Li Y., Gao X., et al. HNF4α regulates sulfur amino acid metabolism and confers sensitivity to methionine restriction in liver cancer. Nat Commun. 2020;11(1):3978. doi: 10.1038/s41467-020-17818-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lees E.K., Krol E., Shearer K., et al. Effects of hepatic protein tyrosine phosphatase 1B and methionine restriction on hepatic and whole-body glucose and lipid metabolism in mice. Metabolism. 2015;64(2):305–314. doi: 10.1016/j.metabol.2014.10.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Obata F., Miura M. Enhancing S-adenosyl-methionine catabolism extends Drosophila lifespan. Nat Commun. 2015;6:8332. doi: 10.1038/ncomms9332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Boon R., Kumar M., Tricot T., et al. Amino acid levels determine metabolism and CYP450 function of hepatocytes and hepatoma cell lines. Nat Commun. 2020;11(1):1393. doi: 10.1038/s41467-020-15058-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fabris G., Dumortier O., Pisani D.F., et al. Amino acid-induced regulation of hepatocyte growth: possible role of Drosha. Cell Death Dis. 2019;10(8):566. doi: 10.1038/s41419-019-1779-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kotb M., Mudd S.H., Mato J.M., et al. Consensus nomenclature for the mammalian methionine adenosyltransferase genes and gene products. Trends Genet. 1997;13(2):51–52. doi: 10.1016/s0168-9525(97)01013-5. [DOI] [PubMed] [Google Scholar]
  • 16.Murray B., Antonyuk S.V., Marina A., et al. Structure and function study of the complex that synthesizes S-adenosylmethionine. IUCrJ. 2014;1(Pt 4):240–249. doi: 10.1107/S2052252514012585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Shafqat N., Muniz J.R., Pilka E.S., et al. Insight into S-adenosylmethionine biosynthesis from the crystal structures of the human methionine adenosyltransferase catalytic and regulatory subunits. Biochem J. 2013;452(1):27–36. doi: 10.1042/BJ20121580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bailey J., Douglas H., Masino L., et al. Human Mat2A uses an ordered kinetic mechanism and is stabilized but not regulated by Mat2B. Biochemistry. 2021;60(47):3621–3632. doi: 10.1021/acs.biochem.1c00672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wu C., Jin X., Tsueng G., et al. BioGPS: building your own mash-up of gene annotations and expression profiles. Nucleic Acids Res. 2016;44(D1):D313–D316. doi: 10.1093/nar/gkv1104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Calvisi D.F., Simile M.M., Ladu S., et al. Altered methionine metabolism and global DNA methylation in liver cancer: relationship with genomic instability and prognosis. Int J Cancer. 2007;121(11):2410–2420. doi: 10.1002/ijc.22940. [DOI] [PubMed] [Google Scholar]
  • 21.Mentch S.J., Locasale J.W. One-carbon metabolism and epigenetics: understanding the specificity. Ann N Y Acad Sci. 2016;1363(1):91–98. doi: 10.1111/nyas.12956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Reytor E., Pérez-Miguelsanz J., Alvarez L., et al. Conformational signals in the C-terminal domain of methionine adenosyltransferase I/III determine its nucleocytoplasmic distribution. Faseb J. 2009;23(10):3347–3360. doi: 10.1096/fj.09-130187. [DOI] [PubMed] [Google Scholar]
  • 23.Katoh Y., Ikura T., Hoshikawa Y., et al. Methionine adenosyltransferase II serves as a transcriptional corepressor of Maf oncoprotein. Mol Cell. 2011;41(5):554–566. doi: 10.1016/j.molcel.2011.02.018. [DOI] [PubMed] [Google Scholar]
  • 24.Kera Y., Katoh Y., Ohta M., et al. Methionine adenosyltransferase II-dependent histone H3K9 methylation at the COX-2 gene locus. J Biol Chem. 2013;288(19):13592–13601. doi: 10.1074/jbc.M112.429738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Biggar K.K., Li S.S. Non-histone protein methylation as a regulator of cellular signalling and function. Nat Rev Mol Cell Biol. 2015;16(1):5–17. doi: 10.1038/nrm3915. [DOI] [PubMed] [Google Scholar]
  • 26.Alam M., Shima H., Matsuo Y., et al. mTORC1-independent translation control in mammalian cells by methionine adenosyltransferase 2A and S-adenosylmethionine. J Biol Chem. 2022;298(7) doi: 10.1016/j.jbc.2022.102084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Cantoni G.L. Biological methylation: selected aspects. Annu Rev Biochem. 1975;44:435–451. doi: 10.1146/annurev.bi.44.070175.002251. [DOI] [PubMed] [Google Scholar]
  • 28.Vance D.E. Phospholipid methylation in mammals: from biochemistry to physiological function. Biochim Biophys Acta. 2014;1838(6):1477–1487. doi: 10.1016/j.bbamem.2013.10.018. [DOI] [PubMed] [Google Scholar]
  • 29.Finkelstein J.D. Methionine metabolism in mammals. J Nutr Biochem. 1990;1(5):228–237. doi: 10.1016/0955-2863(90)90070-2. [DOI] [PubMed] [Google Scholar]
  • 30.Parkhitko A.A., Jouandin P., Mohr S.E., et al. Methionine metabolism and methyltransferases in the regulation of aging and lifespan extension across species. Aging Cell. 2019;18(6) doi: 10.1111/acel.13034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Homma T., Kobayashi S., Fujii J. Methionine deprivation reveals the pivotal roles of cell cycle progression in ferroptosis that is induced by cysteine starvation. Cells. 2022;11(10):1603. doi: 10.3390/cells11101603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Li Y., Wang X., Huang Z., et al. CISD3 inhibition drives cystine-deprivation induced ferroptosis. Cell Death Dis. 2021;12(9):839. doi: 10.1038/s41419-021-04128-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lee J., You J.H., Shin D., et al. Inhibition of glutaredoxin 5 predisposes cisplatin-resistant head and neck cancer cells to ferroptosis. Theranostics. 2020;10(17):7775–7786. doi: 10.7150/thno.46903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Stockwell B.R. Ferroptosis turns 10: emerging mechanisms, physiological functions, and therapeutic applications. Cell. 2022;185(14):2401–2421. doi: 10.1016/j.cell.2022.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Pope L.E., Dixon S.J. Regulation of ferroptosis by lipid metabolism. Trends Cell Biol. 2023;33(12):1077–1087. doi: 10.1016/j.tcb.2023.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Finkelstein J.D. The metabolism of homocysteine: pathways and regulation. Eur J Pediatr. 1998;157(Suppl 2):S40–S44. doi: 10.1007/pl00014300. [DOI] [PubMed] [Google Scholar]
  • 37.Harding H.P., Novoa I., Zhang Y., et al. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol Cell. 2000;6(5):1099–1108. doi: 10.1016/s1097-2765(00)00108-8. [DOI] [PubMed] [Google Scholar]
  • 38.Shima H., Matsumoto M., Ishigami Y., et al. S-adenosylmethionine synthesis is regulated by selective N(6)-adenosine methylation and mRNA degradation involving METTL16 and YTHDC1. Cell Rep. 2017;21(12):3354–3363. doi: 10.1016/j.celrep.2017.11.092. [DOI] [PubMed] [Google Scholar]
  • 39.Pendleton K.E., Chen B., Liu K., et al. The U6 snRNA m(6)A methyltransferase METTL16 regulates SAM synthetase intron retention. Cell. 2017;169(5):824–835.e14. doi: 10.1016/j.cell.2017.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ou Y., Wang S.J., Li D., et al. Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses. Proc Natl Acad Sci U S A. 2016;113(44):E6806–E6812. doi: 10.1073/pnas.1607152113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Asai Y., Yamada T., Tsukita S., et al. Activation of the hypoxia inducible factor 1α subunit pathway in steatotic liver contributes to formation of cholesterol gallstones. Gastroenterology. 2017;152(6):1521–1535.e8. doi: 10.1053/j.gastro.2017.01.001. [DOI] [PubMed] [Google Scholar]
  • 42.Lee B.C., Kaya A., Ma S., et al. Methionine restriction extends lifespan of Drosophila melanogaster under conditions of low amino-acid status. Nat Commun. 2014;5:3592. doi: 10.1038/ncomms4592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Yoshida S., Yamahara K., Kume S., et al. Role of dietary amino acid balance in diet restriction-mediated lifespan extension, renoprotection, and muscle weakness in aged mice. Aging Cell. 2018;17(4) doi: 10.1111/acel.12796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Bárcena C., Quirós P.M., Durand S., et al. Methionine restriction extends lifespan in progeroid mice and alters lipid and bile acid metabolism. Cell Rep. 2018;24(9):2392–2403. doi: 10.1016/j.celrep.2018.07.089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zou K., Rouskin S., Dervishi K., et al. Life span extension by glucose restriction is abrogated by methionine supplementation: cross-talk between glucose and methionine and implication of methionine as a key regulator of life span. Sci Adv. 2020;6(32) doi: 10.1126/sciadv.aba1306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Parkhitko A.A., Wang L., Filine E., et al. A genetic model of methionine restriction extends Drosophila health- and lifespan. Proc Natl Acad Sci U S A. 2021;118(40) doi: 10.1073/pnas.2110387118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Peng H., Yan Y., He M., et al. SLC43A2 and NFκB signaling pathway regulate methionine/cystine restriction-induced ferroptosis in esophageal squamous cell carcinoma via a feedback loop. Cell Death Dis. 2023;14(6):347. doi: 10.1038/s41419-023-05860-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Upadhyayula P.S., Higgins D.M., Mela A., et al. Dietary restriction of cysteine and methionine sensitizes gliomas to ferroptosis and induces alterations in energetic metabolism. Nat Commun. 2023;14(1):1187. doi: 10.1038/s41467-023-36630-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hayashima K., Kimura I., Katoh H. Role of ferritinophagy in cystine deprivation-induced cell death in glioblastoma cells. Biochem Biophys Res Commun. 2021;539:56–63. doi: 10.1016/j.bbrc.2020.12.075. [DOI] [PubMed] [Google Scholar]
  • 50.Kan X., Yin Y., Song C., et al. Newcastle-disease-virus-induced ferroptosis through nutrient deprivation and ferritinophagy in tumor cells. iScience. 2021;24(8) doi: 10.1016/j.isci.2021.102837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Nishizawa H., Matsumoto M., Shindo T., et al. Ferroptosis is controlled by the coordinated transcriptional regulation of glutathione and labile iron metabolism by the transcription factor BACH1. J Biol Chem. 2020;295(1):69–82. doi: 10.1074/jbc.RA119.009548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Belaidi A.A., Masaldan S., Southon A., et al. Apolipoprotein E potently inhibits ferroptosis by blocking ferritinophagy. Mol Psychiatry. 2022;29(2):211–220. doi: 10.1038/s41380-022-01568-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Conlon M., Poltorack C.D., Forcina G.C., et al. A compendium of kinetic modulatory profiles identifies ferroptosis regulators. Nat Chem Biol. 2021;17(6):665–674. doi: 10.1038/s41589-021-00751-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Pakos-Zebrucka K., Koryga I., Mnich K., et al. The integrated stress response. EMBO Rep. 2016;17(10):1374–1395. doi: 10.15252/embr.201642195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Kensler T.W., Wakabayashi N., Biswal S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu Rev Pharmacol Toxicol. 2007;47:89–116. doi: 10.1146/annurev.pharmtox.46.120604.141046. [DOI] [PubMed] [Google Scholar]
  • 56.Wakabayashi N., Dinkova-Kostova A.T., Holtzclaw W.D., et al. Protection against electrophile and oxidant stress by induction of the phase 2 response: fate of cysteines of the Keap1 sensor modified by inducers. Proc Natl Acad Sci U S A. 2004;101(7):2040–2045. doi: 10.1073/pnas.0307301101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Lu S.C. Regulation of glutathione synthesis. Mol Aspects Med. 2009;30(1-2):42–59. doi: 10.1016/j.mam.2008.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Funakoshi-Tago M., Sumi K., Kasahara T., et al. Critical roles of Myc-ODC axis in the cellular transformation induced by myeloproliferative neoplasm-associated JAK2 V617F mutant. PLoS One. 2013;8(1) doi: 10.1371/journal.pone.0052844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Koomoa D.L., Geerts D., Lange I., et al. DFMO/eflornithine inhibits migration and invasion downstream of MYCN and involves p27Kip1 activity in neuroblastoma. Int J Oncol. 2013;42(4):1219–1228. doi: 10.3892/ijo.2013.1835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Rimpi S., Nilsson J.A. Metabolic enzymes regulated by the Myc oncogene are possible targets for chemotherapy or chemoprevention. Biochem Soc Trans. 2007;35(Pt 2):305–310. doi: 10.1042/BST0350305. [DOI] [PubMed] [Google Scholar]
  • 61.Casero R.A., Jr., Murray Stewart T., Pegg A.E. Polyamine metabolism and cancer: treatments, challenges and opportunities. Nat Rev Cancer. 2018;18(11):681–695. doi: 10.1038/s41568-018-0050-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Yang W.S., Stockwell B.R. Ferroptosis: death by lipid peroxidation. Trends Cell Biol. 2016;26(3):165–176. doi: 10.1016/j.tcb.2015.10.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Bi G., Liang J., Bian Y., et al. Polyamine-mediated ferroptosis amplification acts as a targetable vulnerability in cancer. Nat Commun. 2024;15(1):2461. doi: 10.1038/s41467-024-46776-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Xia C., Peng P., Zhang W., et al. Methionine-SAM metabolism-dependent ubiquinone synthesis is crucial for ROS accumulation in ferroptosis induction. Nat Commun. 2024;15(1):8971. doi: 10.1038/s41467-024-53380-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Tsurusaki S., Tsuchiya Y., Koumura T., et al. Hepatic ferroptosis plays an important role as the trigger for initiating inflammation in nonalcoholic steatohepatitis. Cell Death Dis. 2019;10(6):449. doi: 10.1038/s41419-019-1678-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Yamada N., Karasawa T., Kimura H., et al. Ferroptosis driven by radical oxidation of n-6 polyunsaturated fatty acids mediates acetaminophen-induced acute liver failure. Cell Death Dis. 2020;11(2):144. doi: 10.1038/s41419-020-2334-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Zhou X., Fu Y., Liu W., et al. Ferroptosis in chronic liver diseases: opportunities and challenges. Front Mol Biosci. 2022;9 doi: 10.3389/fmolb.2022.928321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Tutusaus A., de Gregorio E., Cucarull B., et al. A functional role of GAS6/TAM in nonalcoholic steatohepatitis progression implicates AXL as therapeutic target. Cell Mol Gastroenterol Hepatol. 2020;9(3):349–368. doi: 10.1016/j.jcmgh.2019.10.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Bathish B., Robertson H., Dillon J.F., et al. Nonalcoholic steatohepatitis and mechanisms by which it is ameliorated by activation of the CNC-bZIP transcription factor Nrf2. Free Radic Biol Med. 2022;188:221–261. doi: 10.1016/j.freeradbiomed.2022.06.226. [DOI] [PubMed] [Google Scholar]
  • 70.Jiang L., Wang N., Cheng S., et al. RNA-sequencing identifies novel transcriptomic signatures in intestinal failure-associated liver disease. J Pediatr Surg. 2022;57(9):158–165. doi: 10.1016/j.jpedsurg.2021.12.015. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure A1
mmc1.pdf (215.2KB, pdf)
Extended PDF
mmc2.pdf (20.5MB, pdf)

Articles from Gastro Hep Advances are provided here courtesy of Elsevier

RESOURCES