Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2025 Dec 16;21:707. doi: 10.1186/s12917-025-05148-2

Effects of composite yeast culture on the expression of immune-related genes in the splenic tissue of weaned lambs

Yu Lu 1, Pengxiang Bai 1, Songjian Li 1, Jie Ning 1, Xiaoxuan Wu 1, Qifei Luo 1, Zichen Yun 1, Hui Chen 1,✉, Dacheng Liu 1,✉
PMCID: PMC12709749  PMID: 41402822

Abstract

The objective of this study was to evaluate the effects of dietary supplementation with a composite yeast culture (CYC) on the immune status and splenic gene expression in weaned lambs. Eighteen healthy, male weaned lambs of similar age and body weight were randomly assigned to three groups, including the control group (Con, basal TMR diet), the CYC1 group (TMR supplemented with 40 g/day/lamb of CYC), and CYC2 group (TMR supplemented with 50 g/day/lamb of CYC). The pre-feeding period lasted for 7 days, followed by a 40-day formal experimental period. Upon completion of the experiment, spleens were collected from the three groups of weaned lambs, weighed, and appropriate tissue samples were obtained for histological sectioning, ELISA analysis, RT-qPCR testing, and transcriptome sequencing. Hematoxylin-eosin (H.E.) staining results revealed that the area of splenic corpuscles in the CYC1 and CYC2 groups was significantly greater than that in the Con group (P < 0.05). Enzyme-linked immunosorbent assay (ELISA) analysis indicated that the levels of tuftsin, IgG, and IgM in the splenic tissues of the two experimental groups were significantly elevated compared to those in the Con group (P < 0.05). RT-qPCR results demonstrated that dietary supplementation with CYC1 or CYC2 significantly enhanced the mRNA expression of IL-2, IL-4, and IL-1β in the spleen tissue of weaned lambs (P < 0.05), while simultaneously suppressing the expression of IL-6 and TNF-α (P < 0.05). Transcriptomic analysis revealed that the differentially expressed genes (DEGs) in the splenic tissues of the CYC1 and CYC2 groups were predominantly enriched in pathways related to cell adhesion molecules and oxidative phosphorylation. Furthermore, weighted gene co-expression network analysis (WGCNA) revealed that the MEyellow and MEmagenta modules were significantly correlated with the expression levels of immune-related factors, including tuftsin, IgG, IgM, IL-2, and IL-4. Six potential candidate genes (ICAM1, CDH5, DQA, PTPRM, NDUFB8, and ATP5MC3) associated with these immune-related factors in the spleen were identified from these modules. Functional enrichment analysis indicated that ICAM1, CDH5, DQA, and PTPRM were enriched in the cell adhesion molecules signaling pathway, while NDUFB8 and ATP5MC3 were involved in the oxidative phosphorylation signaling pathway. In conclusion, supplementing the diet with CYC can enhance the histological development of the spleen in weaned lambs, increase the splenic contents of tuftsin, IgG and IgM, up-regulate the mRNA expression of IL-2, IL-4 and IL-1β, and down-regulate that of IL-6 and TNF-α, which may be achieved through cell adhesion molecules and oxidative phosphorylation signaling pathways. This study provides a theoretical foundation for further understanding of the regulatory mechanisms of splenic immune function by composite yeast culture in weaned lambs.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-025-05148-2.

Keywords: Composite yeast culture, Weaned lamb, Spleen, Immunity, Transcriptome

Introduction

After weaning, lambs undergo a transition from a milk-based diet to solid feed, which may induce stress, reduce immunity, and lead to increased susceptibility to pathogen infection [1]. Therefore, enhancing the immune function of weaned lambs has become an important area of research. Yeast culture, as a safe and environmentally friendly microecological agent, has gradually gained attention for its potential in addressing this issue [2, 3]. Yeast culture is produced through solid-state fermentation following the inoculation of yeast in a suitable medium. The primary constituents of yeast culture are the yeast cell wall, intracellular contents, extracellular metabolites, and modified medium [4]. As a result, it contains a variety of bioactive substances such as oligosaccharides, amino acids, enzymes, and vitamins [5, 6]. Yeast cultures composed of different strains or substrates exhibit distinct functions and application outcomes. For instance, supplementing the diets of lactating Holstein cows with Saccharomyces cerevisiae fermentation products can promote the colonization of immune-related beneficial gut microbiota [7]. Incorporating yeast culture into the diets of growing-finishing pigs has been shown to effectively enhance immune status and improve intestinal barrier function [8]. Research conducted on lambs has also demonstrated that dietary supplementation with yeast culture can increase their resistance to pathogens by elevating serum levels of globulin and immunoglobulins such as IgA, IgG, and IgM [9]. In conclusion, yeast culture has shown significant benefits in the field of animal husbandry. It not only improves growth performance but also enhances the animals’ immune function, thereby contributing substantially to their overall health and development.

The composite yeast culture (CYC) utilized in this experiment was a microecological preparation produced by our group through the co-fermentation of Saccharomyces cerevisiae and Kluyveromyces marxianus at a ratio of 1:1 in a defined medium. Previous studies have demonstrated that CYC can enhance the levels of immune factors in the serum of mutton sheep, improve the structure and metabolic activity of ruminal microbial communities, and facilitate nutrient digestion and absorption [10–12]. However, its impact on splenic immune function remains insufficiently understood. The spleen serves as a critical peripheral immune organ in sheep, performing essential functions including blood filtration and hematopoietic regulation. Proper splenic function contributes to the maintenance of optimal physiological conditions in sheep and enhances their capacity to combat external pathogens [13]. Therefore, this study aims to investigate the effects of dietary supplementation with CYC on splenic gene expression in weaned lambs, with the objective of providing a theoretical foundation for its application in the feeding and management of weaned lambs.

Materials and methods

Preparation of CYC

The CYC used in the trial feeding was a microecological preparation produced by co-inoculating activated S. cerevisiae and K. marxianus at a 1:1 ratio into a fermentation substrate. The substrate consisted of agricultural by-products, including bran, corn, soybean meal, and corn germ meal. S. cerevisiae (3 × 108 CFU/g), K. marxianus (3 × 108 CFU/g), or a 1: 1 mixture of the two (3 × 108 CFU/g) were used to inoculate the diet at 8% per 1,000 kg wet mixed matrix through the addition of sterile water with constant stirring for a final system moisture content level of 40% [11]. The mixture was then subjected to aerobic pile fermentation at 30 °C for 72 h. Upon completion of fermentation, the product was dried at 45 °C, milled, and packaged. The nutritional specifications of the final CYC product were as follows: crude protein ≥ 18.0%, mannan ≥ 0.5%, crude ash ≤ 9.0%, moisture ≤ 12.0%, and viable bacterial count ≥ 106 CFU/g.

Experimental design and animal diet

Animal experiments were conducted in strict compliance with the guidelines for animal experimentation outlined by the National Institute of Animal Health of China (GB14925-2010) and were approved by the Ethics Committee of Inner Mongolia Agricultural University(NND2022104). The study was carried out in the animal facility of the College of Veterinary Medicine, Inner Mongolia Agricultural University. Eighteen healthy male lambs, aged 60 days, were procured from local farmers in Guyang County, Baotou City, and were randomly assigned to three groups, with six replicates per group. The lambs within each replicate were comparable in terms of body weight. The control group (Con) received a basal TMR diet, while the two experimental groups (CYC1 and CYC2) were fed with TMR supplemented with 40 g/day or 50 g/day of CYC per lamb, respectively. The basal diets for all groups were formulated in accordance with the Chinese feeding standard for mutton sheep (NY/T 816–2004), ensuring uniform energy and nutrient levels across all groups. The composition and nutrient content of the diets are presented in Table 1. Prior to the commencement of the experiment, the animal housing facilities was thoroughly disinfected in strict accordance with established disinfection protocols. The experimental period lasted 47 days, including a 7-day pre-feeding period and a 40-day formal test period. During the pre-feeding phase, lambs were vaccinated with live PPR vaccine and live goat pox vaccine according to the recommended immunization schedule. All experimental animals were given ad libitum access to clean and fresh water and a corn–soybean meal basal diet.

Table 1.

Dietary composition and basal diet nutrient content (%, DM basis)

Ingredients (%) Content
Corn stalk 16.00
Corn 38.00
Soybean meal 10.50
Corn germ meal 8.40
 Cypress rapeseed 2.10
Sunflower seed shell 14.00
DDGS 7.00
NaCl 0.35
NaHCO3 0.50
Limestone 0.70
NH4Cl 0.35
Premix 2.10
Total 100.00
Nutrient levels (%) Content
Dry matter 88.60
Crude protein 15.80
NDF 29.42
ADF 15.46
Ca 0.93
P 0.41

Premix for each kilogram of diet : Cu 12 mg; Fe 60 mg; Zn 60 mg; Mn 45 mg; nicotinic acid 60 mg; vitamin D, 1200IU; vitamin E, 20IU; Ca 2 g; P 1 g; Co 20 mg; NaCl 5g

Determination of spleen index and histological analysis of splenic tissue in lambs

Following the completion of the experimental period, the lambs were sacrificed by CO2 asphyxiation and their spleens were aseptically harvested. The surface connective tissues were carefully removed, and the spleens were weighed individually. The spleen index (g/kg) was calculated by dividing the spleen weight (g) by the pre-euthanasia live body weight (kg). Tissue samples measuring approximately 2 × 1 × 2 cm³ were collected and immediately fixed in a 10% neutral buffered formalin solution. After undergoing standard histological processing, including dehydration, clearing, paraffin embedding, and sectioning, the tissue sections were stained with H.E. The morphological features and structural integrity of the spleen tissues were examined under a light microscope. The areas of splenic follicles and the proportions of white pulp were quantitatively analyzed using Image-Pro Plus 6.0 software, and the average values were recorded for statistical analysis.

Determination of immune-related factors in lamb splenic tissues

An appropriate quantity of splenic tissue was collected into cryotubes, immediately immersed in liquid nitrogen, and subsequently stored in a −80 °C freezer for future use. The contents of tuftsin, IgG, and IgM in the splenic tissues were quantitatively determined using ELISA kits (purchased from Ruixin Biotechnology Co., Ltd., Quanzhou, China) in accordance with the manufacturer’s instructions. The mRNA expression levels of IL-2, IL-4, IL-6, IL-1β, and TNF-α were assessed via RT-qPCR. The gene sequences were retrieved from the NCBI database, and corresponding primers were designed based on these sequences (primer sequences are presented in Table 2). The primers were synthesized and supplied by Sangon Biotech(Shanghai) Co., Ltd.

Table 2.

Primer sequences for RT-qPCR

Gene bank accession Gene Primer sequences(5'→3') Size(bp)
NM_001009806 IL-2 F:TCTACGGGGAACACAATGAAAGAAG 104
R:TGCATCCTGGAGAGCTTGAGG 104
NM_001009313 IL-4 F:TGGGCGGACTTGACAGGAATC 85
R:CTCAGCGTACTTGTACTCGTCTTG 85
NM_001009392 IL-6 F:GTCTAATAACCACTCCAGCCACAC 84
R:TAACCTTTGCGTTCTTTACCCACTC 84
NM_001009465 IL-1β F:ATGGCTTGCTACAGTGATGAGAATG 92
R:GAGCCGAGGTCCAGGTGTTG 92
NM_001024860 TNF-α F:CAACGGCGTGGAGCTGAAAG 80
R:TGAAGAGGACCTGCGAGTAGATG 80
XM_042239325 PTPRM F:AACAGGTGCGAGAGGAAGTGAG 84
R:CGTTGGTGTAGGGCGAGAGG 84
NM_001009731 ICAM1 F: CCGTGAAGTGGTCCTGAATGTG 95
R: TGCCCAGAGTGCCCAAGATG 95
XM_027978028 CDH5 F:GGTTGTGGTGGAAGCAGAAGAC 115
R:CCTGGACTGGGTGAAGATGGG 115
XM_027971575 CD276 F:TGGAGCCCAACAAGGACCTGAG 101
R:CTGCCCATCCTGCCACAACAC 101
NM_001308582 DQA F:GCTGACCACATTGCCGCCTATG 128
R:TGCCAGACAGTCTCCCTCTTTTCC 128
XM_027957175 COX5A F: CTGTCCAGTCACTTCGCTGCTAC 121
R: ATCCCTTTACGCAACTCCCAAGC 121
XM_004004569 ATP5MC3 F:TAGGACTGGAGAGGGCTCTACGG 147
R:ACTCCTACTGTGGCAGCACCTG 147
NM_001177679 NDUFB8 F: CCACCCAGACCTGCGTTTGAAC 146
R: ACAGCATGAAGGCGACGAAGC 146
NM_001190390 GAPDH F:GGAGAAACCTGCCAAGTATGATGAG 129
R:GAGTGAGTGTCGCTGTTGAAGTC 129

F Forward Primer, R Reverse Primer

Transcriptomic sequencing of lamb splenic tissues

Five splenic tissues samples were selected from each group for transcriptome sequencing analysis. The total RNA of splenic tissues was extracted by TRIzol reagent. The concentration and purity of RNA were detected by nanodrop, and the integrity of RNA was verified by RNA-specific agarose gel electrophoresis. The construction of cDNA library, the quality inspection of cDNA library and the sequencing on Illumina NovaSeq 6000 platform were completed by Guanshu Biotechnology Service (Changchun) Co., Ltd. The Raw Data were uploaded to the NCBI SRA database (BioProject ID: PRJNA1312963). The Raw Data was filtered using fastp (0.22.0). The process included removing contaminated Reads, removing low-quality Reads, and removing Reads with a N ratio greater than 5%. The Clean Reads were used for subsequent analysis. The reference genome and gene model annotation files were collated from the database, and the reference genome index was established through Bowtie2 and the Clean Reads were compared to the reference genome (GCF _ 016772045.2).

The edgeR software was used to screen differentially expressed genes (DEGs), and the DAVID tool was used to perform GO function enrichment and KEGG signaling pathway enrichment analysis on DEGs. The weighted gene co-expression network analysis (WGCNA) package was used to perform co-expression network construction and module identification on the standardized gene expression data. The specific steps include data filtering and screening, soft threshold screening, network construction and module identification, module and phenotype correlation analysis, and Cytoscape to construct a visual gene network and output hub genes.

Verification of the gene expression by RT-qPCR

Based on the results of transcriptome analysis, 8 DEGs were selected for quantitative analysis by RT-qPCR (primer sequences are shown in Table 2). The RT-qPCR reaction system was 20 µL, and the system configuration was 10 µL 2 × SuperStar Universal SYBR Master Mix, 0.4 µL Forward Primer (10 µM), 0.4 µL Reverse Primer (10 µM), 8.2 µL ddH2O and 1 µL cDNA template. The RT-qPCR reaction procedure was set as follows : 95 °C, 30 s; 95 °C, 12 s; 60 °C, 30 s, 40 cycles. In the experiment, GAPDH was used as an internal reference gene, and the expression level of the target gene was calculated by 2⁻△△Ct method.

Statistical analysis

The data were expressed as mean ± standard deviation. Statistical analysis was conducted using GraphPad Prism version 9.5.0, and graphical visualization was performed with R software, employing packages such as ggplot2, dplyr, and FAS. Significance levels were determined based on corrected P values, where P < 0.05, 0.01, and 0.001 were indicated by *, **, and ***, respectively. To validate the expression differences of candidate genes across treatment groups, RT-qPCR and RNA-seq data were integrated, and a combined expression plot was generated for each gene. The RT-qPCR results were displayed as bar charts, while RNA-seq expression levels were overlaid on the same plots as line graphs with error bars.

Results

Effects of CYC on spleen index

According to the spleen indices data presented in Table 3, the spleen indices of the Con, CYC1, and CYC2 groups were comparable. When compared to the Con group, the spleen indices in the CYC1 and CYC2 groups increased by 11.67% and 6.67%, respectively. However, these differences were not statistically significant (P > 0.05). These findings suggest that the inclusion of CYC in the diet did not have a significant impact on the spleen indices of weaned lambs.

Table 3.

Spleen index of lambs

Term Groups P-value
Con CYC1 CYC2
Spleen index/(g/kg) 1.2±0.2 1.34±0.04 1.28±0.02 0.4223

Effects of CYC on morphological structure of splenic tissue

The morphological and structural analysis of spleen sections from the weaned lambs under an optical microscope (as shown in Fig. 1A) indicated no pathological alterations in the splenic tissues of the three groups. Compared with the Con group, the CYC1 and CYC2 groups exhibited clearer demarcation between red and white pulps, more distinct splenic corpuscle structures, increased lymphocyte density, and a more compact overall tissue architecture. As shown in Fig. 1B, the splenic corpuscle area in both the CYC1 and CYC2 groups was significantly greater than that in the Con group, showing an increase of 0.06 mm² (P < 0.05). Additionally, the proportion of white pulp increased in the two CYC groups, although the difference was not statistically significant (P > 0.05). In summary, dietary supplementation with CYC may promote the histological development and maturation of the spleen by increasing the splenic corpuscle area.

Fig. 1.

Fig. 1

Effect of CYC on the morphological structure of splenic tissue of weaned lambs (H.E. 40 ×). A Observation of splenic tissue structure under optical microscope. B Measurement of the area of splenic corpuscle and the proportion of white pulp. Note: T Trabeculae, RP Red pulp, WP White pulp, Scor Splenic corpuscle

Effects of CYC on tuftsin and immunoglobulins in splenic tissue

The contents of tuftsin, IgG, and IgM in splenic tissue were measured using ELISA (results shown in Fig. 2). The results showed that both CYC1 and CYC2 groups exhibited significantly higher contents of tuftsin and IgG compared to the Con group (P < 0.05). Additionally, IgM contents in both the CYC1 and CYC2 groups were significantly elevated by 20.54% and 19.7%, respectively, compared to the Con group (P < 0.01), although no statistically significant difference was observed between the CYC1 and CYC2 groups. These data suggest that the addition of CYC effectively enhances the contents of tuftsin and immunoglobulins (IgG and IgM) in splenic tissue, thereby indicating a modulation of the spleen’s immune status.

Fig. 2.

Fig. 2

Effects of CYC on the contents of Tuftsin, IgG and IgM in spleen tissue of weaned lambs. A-C The contents of tuftsin, IgG and IgM were detected by ELISA. P < 0.05 and 0.01 were expressed as * and * *, respectively

Effects of CYC on the mRNA expression of cytokines in splenic tissue

To further elucidate the regulatory effects of CYC on cytokine expression in splenic tissue, the mRNA expression levels of IL-2, IL-4, IL-6, IL-1β, and TNF-α were evaluated using RT-qPCR. As shown in Fig. 3, compared with the Con group, the CYC1 group exhibited significantly higher mRNA expression levels of IL-2, IL-4 and IL-1β (P < 0.05), and reduced mRNA expression levels of IL-6 and TNF-α (P < 0.05). In the CYC2 group, the mRNA expression levels of IL-2 and IL-4 were significantly elevated compared to those in the Con group (P < 0.05), while those of IL-6 and TNF-α were obviously decreased (P < 0.05). These findings suggest that the addition of CYC modulates the mRNA expression of cytokines (IL-2, IL-4, IL-6, IL-1β, and TNF-α) in splenic tissue, further confirming that the immune status of the spleen is altered.

Fig. 3.

Fig. 3

Effect of CYC on the expression of cytokines in splenic tissue of weaned lambs. A-E The expression levels of IL-2, IL-4, IL-6, IL-1β and TNF-α were detected by RT-qPCR. P < 0.05 and 0.01 were expressed as * and * *, respectively

RNA-seq analysis of the effects of CYC on gene expression changes in splenic tissue

Identification of DEGs following RNA-Seq analysis

A total of 700,259,202 raw reads were generated from the RNA-seq sequencing data. Following quality filtering, 688,339,848 clean reads were retained, representing approximately 98.3% of the total raw reads. In each sample, the proportion of bases with a Phred quality score greater than Q30 (corresponding to an error rate below 0.1%) exceeded 90%. The GC content in the filtered sequences ranged from 49.03% to 51.58%, indicating high compositional consistency across samples. Principal component analysis (PCA) (Fig. 4A) demonstrated good within-group sample reproducibility for the Con group, CYC1 group, and CYC2 group, with the CYC2 group exhibiting the highest biological replicability. Alignment results of RNA-seq data against the reference genome (Fig. 4C) revealed that compared with the Con group, the CYC1 group exhibited 987 DEGs (542 upregulated and 445 downregulated), while the CYC2 group exhibited 883 DEGs (394 upregulated and 489 downregulated). When comparing the CYC1 group with the CYC2 group, 512 DEGs (200 upregulated and 312 downregulated) were identified. According to the Venn diagram analysis (Fig. 4B), 283 shared DEGs between the “CYC1 vs. Con” and “CYC2 vs. Con”, and 711 and 602 unique DEGs observed in the “CYC1 vs. Con” and “CYC2 vs. Con”, respectively (Extreme values have been excluded, with a threshold of log2FC ≤ |±3| used to define extremity).

Fig. 4.

Fig. 4

PCA analysis, DEGs number, gene expression and gene enrichment analysis of main DEGs in splenic tissues of three groups of weaned lambs. A PCA analysis of gene expression in splenic tissues. B The number of unique and shared genes analyzed in splenic tissues of “CYC1 vs. Con” and “CYC2 vs. Con”. C Gene expression of “CYC1 vs. Con”, “CYC2 vs. Con” and “CYC2 vs. CYC1”. D-F Classification of important biological processes of unique and shared DEGs. G-I KEGG enrichment analysis of unique and shared DEGs

Functional analysis of DEGs

Focusing on the unique DEGs identified in the “CYC1 vs. Con”, GO functional analysis revealed that 397 DEGs were significantly enriched in the biological process (BP) terms(Fig. 4D). Specifically, 7.14% of these DEGs were associated with nutrient transport and metabolism; 7.14% with immune function; 10% with growth and development; 7.14% with cell adhesion; and 12.86% with signaling pathway. The KEGG pathway analysis results (Fig. 4G) reveal that 18 signaling pathways were significantly enriched, including oxidative phosphorylation (NDUFB8, ATP5MC3, COX5A), thermogenesis (ATP5MC3, UQCRH, ATP5MC1), and cell adhesion molecules (PTPRM, ICAM1, DQA, CD276).

The GO functional analysis of the unique DEGs between the “CYC2 vs. Con” revealed that 241 DEGs were significantly enriched in the BP terms(Fig. 4E). Of these, 7.55% were associated with nutrient transport and metabolism; 5.66% with immune function; 7.55% with growth and development; 11.32% with cell adhesion; and 13.21% with signaling pathway. The KEGG pathway analysis results (Fig. 4H) revealed that 21 signaling pathways were significantly enriched, including those involved in the cell cycle (CCNB1, CDK1, MAD2L1), oxidative phosphorylation (NDUFB8, ATP5MC3, COX5A), and cell adhesion molecules (PTPRM, ICAM1, DQA).

A total of 92 shared DEGs from the “CYC1 vs. Con” and “CYC2 vs. Con” comparisons were significantly enriched in BP terms, as revealed by GO analysis (Fig. 4F).Among these, 4% of the DEGs were associated with nutrient transport and metabolism, 8% were linked to immune function, 8% to growth and development, 8% to cell adhesion, and 8% to signaling pathways. KEGG pathway analysis (Fig. 4I) identified 10 significantly enriched pathways, including thermogenesis (NDUFB8, NDUFA11, ATP5MC3, COX5A), oxidative phosphorylation (NDUFB8, NDUFA11, ATP5MC3, COX5A), and cell cycle (CCNB2, PCNA, PTTG1).

DEGs associated with the cell adhesion molecules and the oxidative phosphorylation signaling pathway

KEGG analysis of the unique DEGs between the “CYC1 vs. Con” (Table 4) revealed that the cell adhesion molecules signaling pathway was enriched with 19 upregulated DEGs. When comparing the “CYC2 vs. Con”, this signaling pathway was found to be enriched with 13 upregulated DEGs. Notably, ICAM1, CDH5, DQA, PTPRM, and CD276 were commonly enriched among the DEGs in both comparisons.

Table 4.

DEGs of cell adhesion molecules and oxidative phosphorylation signaling pathway in KEGG enrichment analysis

Item compared KEGG pathway name Number of DEGs Name of DEGs
CYC1 vs. Con Cell adhesion molecules 19 NTNG2, SDC3, PTPRM, LOC101113636, PVR, VSIR, ICAM1, SELP, CLDN11, CDH5, CLDN5, CDH3, DQA, CDH1, CDH15, PDCD1, CD34, NECTIN2, CD276
CYC2 vs. Con 13 NLGN2, PTPRM, ICAM1, PTPRD, CDH5, CD6, SLITRK2, DQA, LOC101119545, ESAM, CD276, JAM3, LRRC4B
CYC1 vs. Con Oxidative phosphorylation 34  NDUFB8, LOC101113001, NDUFA11, NDUFB6, NDUFB10, NDUFB11, NDUFA12, LOC101117965, NDUFB3, ATP5MC3, LOC114114909, COX5A, UQCRH, ATP5MC1, LOC101108778, LOC101119721, LOC101121538, ATP6V1G3, ATP5MG, ATP6V1F, LOC101110066, NDUFA7, LOC105615318, LOC101110664, LOC101116886, NDUFA2, NDUFC1, LOC101107153, LOC106991840, LOC101121420, PPA1, NDUFS5, NDUFS4, LOC105609918
CYC2 vs. Con 19 ATP5PF, ND6, NDUFB8, NDUFB7, NDUFA11, NDUFB11, ATP5MC3, COX5A, ATP5F1E, LOC101121420, PPA1, NDUFS5, COX3, ATP5PO, COX1, ATP6V0A4, LOC114118339, ND5, LOC105609918

KEGG analysis of the unique DEGs between the “CYC1 vs. Con” (Table 4) revealed that the oxidative phosphorylation signaling pathway was enriched with 34 downregulated DEGs. Similarly, KEGG analysis of the unique DEGs in the “CYC2 vs. Con” showed enrichment of the same signaling pathway with 19 downregulated DEGs. In both comparisons, NDUFB8, NDUFA11, NDUFB11, ATP5MC3, COX5A, LOC101121420, PPA1, NDUFS5, and LOC105609918 were commonly identified as enriched DEGs.

Weighted gene co-expression network analysis revealed the correlation between transcriptional features and immune-related molecules in splenic tissue

To elucidate the relationship between immune-related molecules in splenic tissues (Tuftsin, IgG, IgM, IL-2, IL-4, IL-6, IL-1β, and TNF-α) and gene expression profiles, genes exhibiting expression variances within the top 25% were selected for WGCNA, based on the variance of gene expression levels (Fig. 5A and B). A total of 20 modules named by color were identified. Among these, the MEyellow module showed significant negative correlations with tuftsin (−0.53, 0.04), IgG (−0.67, 0.006), IgM (−0.57, 0.03), IL-2 (−0.56, 0.03), and IL-4 (−0.55,0.03). In contrast, the MEmagenta module exhibited positive correlations with IL-2 (0.57, 0.03) and IL-4 (0.69, 0.005). GO functional analysis of the MEyellow module genes revealed that the most enriched BP terms included ribosome, translation, mitochondrial inner membrane, multicellular organism development, and calcium-dependent cell-cell adhesion via plasma membrane cell adhesion molecules. The corresponding KEGG pathways were primarily associated with ribosome, oxidative phosphorylation, and thermogenesis (Fig. 5C). For the MEmagenta module genes, GO functional analysis indicated that the main enriched BP terms included heparin binding, positive regulation of ERK1 and ERK2 cascade, multicellular organism development, cell adhesion, and immune response. The enriched KEGG pathways included focal adhesion, cell adhesion molecules, and the MAPK signaling pathway (Fig. 5C). Using the MCODE plugin in Cytoscape, six potential core regulatory genes (ICAM1, CDH5, DQA, NDUFB8, PTPRM, and ATP5MC3) potentially influencing immune-related factors were identified from the MEyellow and MEmagenta modules, and their interaction network was visualized in a network diagram (Fig. 5D).

Fig. 5.

Fig. 5

WGCNA identified the correlation between gene modules and immune-related indicators (Tuftsin, IgG, IgM, IL-2, IL-4, IL-6, IL-1β and TNF-α) in splenic tissue of lambs, KEGG analysis of significant modules, and potential core regulatory genes network diagram. A Gene co-expression network diagram in the three groups (Con, CYC1 and CYC2). B WGCNA analysis of the correlation between host transcriptome and immune-related indicators. C Top KEGG pathway of genes in MEyellow and MEmagenta modules. The significance of the determined KEGG pathway was determined by P < 0.05. D Potential core regulatory genes network maps screened in MEyellow and MEmagenta modules

Validation for the transcriptome data by RT-qPCR

Based on the results of WGCNA and KEGG analyses, the genes PTPRM, ICAM1, CDH5, CD276, DQA, COX5A, ATP5MC3, and NDUFB8 were selected for validation using the RT-qPCR method. The results (Fig. 6) showed that the mRNA expression levels of PTPRM, ICAM1, CDH5, CD276, and DQA in the splenic tissues of the CYC1 and CYC2 groups were significantly elevated compared to those in the Con group. Conversely, the mRNA expression levels of COX5A, ATP5MC3, and NDUFB8 were markedly reduced in these experimental groups relative to the Con group. The RT-qPCR findings exhibited a high degree of consistency with the enrichment analysis results, thereby confirming the reliability of the latter.

Fig. 6.

Fig. 6

The effects of CYC on the mRNA expression of PTPRM, ICAM1, CDH5, CD276, DQA, COX5A, ATP5MC3 and NDUFB8 in splenic tissue were analyzed by RT-qPCR to verify the RNA-seq results. a-b indicates the difference between different superindexes within the same index column (P < 0.05)

Discussion

The spleen serves as a critical peripheral immune organ in lambs and plays a key role in maintaining overall health, and evaluating its immune function is of considerable importance. The splenic corpuscle located within the white pulp of the spleen serve as critical anatomical structures where immune cells collaborate to initiate and regulate immune responses [14]. Accumulating evidence suggests that immune suppression leads to a reduction in the number of splenic corpuscles [15]. In this experiment, the area of splenic corpuscles in the CYC1 and CYC2 groups was observed to increase significantly, suggesting that feeding CYC may enhance the immune function of the spleen in lambs. Tuftsin secreted by the spleen is related to cell phagocytosis and immune system regulation, and can help regulate the intensity and duration of inflammation [16]. In this study, the concentration of tuftsin in the two treatment groups was significantly increased, which indicated that the feeding of CYC made the immune regulation function of spleen more active and helped the body to maintain immune balance. The spleen contains a diverse array of immune-active molecules and plays a crucial role in regulating antigen recognition, as well as the magnitude and directionality of immune responses [17]. IgM, as the earliest antibody produced in the primary immune response, plays a key role in the early immune response, while IgG can provide long-term protection, both of which together constitute the key immune defense line against pathogens [18, 19]. Previous studies have demonstrated that feeding Saccharomyces cerevisiae products to calves can lead to increased serum levels of IgG and IgM [20]. Likewise, feeding yeast culture in the diet of Mongolian ram lambs has been shown to enhance serum IgG and IgM concentrations [10]. These research contents are mostly focused on the blood, and the spleen is the main place for antibody production, and its function is closely related to the blood antibody level. In our research, changes in IgG and IgM levels were detected in the spleen, suggesting that the CYC can enhance the ability of spleen antibody synthesis, and this change may be one of the reasons for the increase of antibody content in the blood. IL-2 and IL-4 are capable of stimulating lymphocyte proliferation and differentiation, as well as promoting antibody production [21–23]. IL-1β, IL-6, and TNF-α are pro-inflammatory cytokines that play roles in regulating the body’s inflammatory response. Among them, IL-1β also contributes to the up-regulation of adhesion molecules [24, 25]. Previous studies have demonstrated that the serum IL-6 levels in Simmental beef cattle increased after being fed yeast culture [26]. In addition, the expression of IL-4 in the spleen of pigs was found to decrease after being fed fermented feed, and hepatic IL-1β levels in sheep were reduced after administration of rhodotorula yeast culture [27, 28]. These findings contrast with the observed trends in this experiment, which revealed increased expression levels of IL-4 and IL-1β and a decreased level of IL-6. The discrepancy may be attributed to differences in animal species, feed fermentation methods, substrate composition, microbial strains used in fermentation, and tissue-specific responses. Wang et al.. found that incorporating a compound probiotics into the diet of Hu sheep significantly increased serum IgG and IL-2 levels while markedly decreasing TNF-α content in both liver and rumen tissues [29]. This is similar to the expression trend of IgG, IL-2 and TNF-α in the spleen in this experiment, indicating that the addition of CYC can enhance the resistance and defense ability of spleen to pathogens. The aforementioned results suggest that feeding with the CYC can influence the levels of immune-related molecules in the spleens of weaned lambs, thereby enhancing splenic immune function and contributing to the regulation of systemic immune homeostasis to some extent.

This experiment conducted transcriptome sequencing analysis to investigate global gene expression changes in the splenic tissue of weaned lambs following the administration of CYC. GO enrichment analysis revealed that, within the BP terms, DEGs in the CYC1 group, relative to the Con group, were mainly enriched in inflammatory response, innate immune response, multicellular organism development, and cell adhesion. In contrast, DEGs in the CYC2 group, compared to the Con group, were predominantly enriched in inflammatory response, cell-cell adhesion, and homophilic cell adhesion via plasma membrane adhesion molecules. These GO analysis results suggest that CYC may enhance splenic immune function by promoting the migration and interaction efficiency of immune cells. KEGG pathway analysis further demonstrated that, in both comparisons (“CYC1 vs. Con” and “CYC2 vs. Con”), DEGs associated with cell adhesion molecules and oxidative phosphorylation pathways were significantly enriched.

Cell adhesion molecules signaling pathways are involved in fundamental biological processes such as cell recognition, activation, and signal transduction. These pathways serve as a molecular foundation for key physiological and pathological events, including immune responses, inflammatory reactions, and coagulation [30, 31]. Previous studies have indicated that cell adhesion molecules not only serve as physical links between cells but also activate intracellular signaling pathways and play significant regulatory roles. Moreover, the signaling pathways mediated by these molecules are critically involved in neuronal migration, axonal growth, synapse formation, and synaptic plasticity [32, 33]. According to Gibson et al., cell adhesion molecules can modulate the activation of receptor tyrosine kinases, thereby affecting critical cellular functions such as survival, migration, and process extension [34]. The upregulation of cell adhesion molecules signaling pathways indicates that the CYC may enhance immune responses by promoting the aggregation and migratory capacity of immune cells. According to the results of KEGG enrichment analysis, ICAM1, CDH5, DQA, PTPRM and CD276 are DEGs that are co-enriched by the cell adhesion molecules pathway in two comparisons (“CYC1 vs. Con” and “CYC2 vs. Con”). ICAM1 can enhance the activation of T cells after binding to the receptor (LFA-1) [35], and promote the formation of immune synapses between dendritic cells and T cells. In this study, the expression levels of IL-2 and IL-4 were upregulated, whereas those of IL-6 and TNF-α were downregulated in both the CYC1 and CYC2 groups. These findings suggest that the CYC may promote the differentiation of Th1 and Th2 cells by activating the cell adhesion molecules pathway, thereby enhancing the secretion of cytokines such as IL-2 and IL-4. The observed downregulation of IL-6 and TNF-α indicates a potential role of the CYC in mitigating tissue damage through suppression of excessive inflammatory responses. CDH5 is specifically expressed at endothelial cell junctions and serves as a key marker for the stability of endothelial cell contacts. It influences immune cell migration by modulating the barrier function of endothelial cells [36–38]. In this study, the expression level of CDH5 in the lamb spleen was upregulated, which might suggest that feeding CYC could enhance the stability of contact between endothelial cells in the spleen, thereby influencing the migration of immune cells. DQA is a member of the DQ gene family in the MHC IIa region which is mainly expressed on the surface of antigen-presenting cells and can efficiently present antigens to CD4+ T cells [39, 40]. Previous studies have demonstrated that detection of the DQA gene can serve as an indicator for predicting sheep production performance and environmental adaptability [41]. Among its family members, DQA2 has been identified as a significant candidate gene associated with disease susceptibility and drug resistance in sheep [42]. The observed upregulation of the DQA gene suggests that weaned lambs fed with CYC may experience improved immunity and enhanced environmental adaptability. PTPRM is a transmembrane protein located on the cell surface, and its upregulation can modulate various biological processes, including cell growth, differentiation, adhesion, and migration, through the regulation of tyrosine phosphorylation levels [43]. CD276 is a type I transmembrane protein that can be used as an adhesion molecule to mediate cell-to-cell and cell-to-extracellular matrix adhesion and promote cell migration. Previous studies have demonstrated that CD276, as a co-signaling molecule, can supply the necessary co-stimulatory signals for T cell activation, enhance T cell-mediated immune responses, and play a crucial role in modulating inflammatory processes [44]. The upregulation of CD276 suggests that the spleen experiences alterations in both cell adhesion-mediated migration and immune-related anti-inflammatory processes. The transcriptomic analysis revealed that the mRNA expression levels of the aforementioned five genes were significantly upregulated, consistent with the results confirmed by RT-qPCR. These findings suggest that after feeding the CYC, the spleen may undergo alterations in its immune status through the enhancement of the cell adhesion molecules signaling pathway, which is jointly mediated by ICAM1, CDH5, DQA, PTPRM, and CD276.

Oxidative phosphorylation constitutes a central process in cellular energy metabolism, predominantly taking place in the inner mitochondrial membrane [45]. This mechanism involves the coordinated functioning of the electron transport chain (composed of Complex I, Complex II, Complex III and Complex IV) and ATP synthase (Complex V), through which the energy derived from nutrient oxidation is efficiently converted into ATP [46, 47]. Furthermore, oxidative phosphorylation is intricately associated with the generation of reactive oxygen species, mitochondrial physiological function, and the regulation of inflammatory responses [48–50]. In this study, through KEGG pathway enrichment analysis, it was found that NDUFB8,ATP5MC3 and COX5A were shared DEGs in two comparisons (“CYC1 vs. Con” and “CYC2 vs. Con”). Among these, NDUFB8 is subunits of Complex I, which plays a crucial role in the oxidation of NADH and electron transfer, representing a key step in the generation of the proton gradient during oxidative phosphorylation [51, 52]. COX5A encodes a subunit of Complex IV and functions in transferring electrons from cytochrome c to oxygen, resulting in the formation of water and facilitating proton translocation across the membrane [53]. ATP5MC3 is a subunit of Complex V and plays an important role in maintaining the activity and structural stability of the complex [54]. These three DEGs are all involved in critical steps of the signaling pathway, and alterations in their expression levels may directly influence the functionality of the oxidative phosphorylation pathway. In the two comparisons of this experiment (“CYC1 vs. Con” and “CYC2 vs. Con”), the expression levels of the aforementioned genes exhibited a decreasing trend in both transcriptomic data and RT-qPCR results. Given that the proliferation, activation, and functional performance of immune cells depend on an adequate energy supply, these findings may indicate that feeding with the CYC reduced the dependence of splenic immune cells on oxidative phosphorylation. This reduction could subsequently decrease the excessive production of mitochondrial ROS, thereby mitigating oxidative stress-induced damage.

WGCNA analysis was conducted to investigate the correlation between spleen gene expression profiles and variations in tuftsin, IgG, IgM, IL-2, IL-4, IL-6, IL-1β, and TNF-α after feeding CYC. The genes within the MEmagenta module exhibited a positive correlation with IL-2 and IL-4, indicating potential involvement of this module in immune regulation within the spleen through modulation of these cytokines. In contrast, genes in the MEyellow module showed negative correlations with tuftsin, IgG, IgM, IL-2, and IL-4. The observed significant associations with multiple immunological parameters suggest that the genes in this module may serve as key mediators in the overall regulation of splenic immune function. Through MCODE screening, ICAM1, CDH5, DQA, PTPRM, NDUFB8, and ATP5MC3 were identified as potential core regulatory genes associated with alterations in the immune status of the spleen following supplementation with CYC. The RT-qPCR validation results for these six candidate genes demonstrated high consistency with the transcriptomic data, thereby confirming the reliability of the findings. Among them, ICAM1, CDH5, DQA, and PTPRM are implicated in the cell adhesion molecules signaling pathway and may enhance immune responses by facilitating the recruitment and activation of immune cells [55–58]. WGCNA analysis indicates that CYC may modulate immune cell interactions and the expression of immune-related factors through the regulation of ICAM1, CDH5, DQA, and PTPRM. This observation aligns with the findings of Zhou et al. [59], who reported that elevated ICAM1 levels were associated with significantly increased proportions of regulatory T cells, resting natural killer cells, and M1 macrophages, along with altered immune factor profiles. Notably, the present study suggests that CYC may further potentiate the cell adhesion molecules signaling pathway by upregulating the expression of CDH5, DQA, and PTPRM, thus exerting a more comprehensive regulatory effect across multiple facets of the immune response. These insights not only provide a novel perspective on the immunomodulatory mechanisms of CYC but also establish a theoretical foundation for its potential application as an immune-enhancing agent. On the other hand, NDUFB8 and ATP5MC3 are genes involved in energy metabolism, functioning as components of respiratory chain complex I and ATP synthase, respectively [54, 60]. The simultaneous down-regulation of these genes indicates that the CYC may have attenuated energy metabolism in the spleen, thereby maintaining an “energy-efficient and sustainable” immune state. In summary, CYC can activate cell adhesion molecules and the oxidative phosphorylation signaling pathway, which are enriched with genes such as ICAM1, CDH5, and DQA. It is significantly associated with the levels of tuftsin, IgG, and IgM, as well as with the expression of IL-2 and IL-4, suggesting a potential molecular mechanism underlying the modulation of these immune factor secretions.(Fig. 7) The aforementioned findings underscore the effects of feeding CYC on the expression of immune-related genes in the spleen of weaned lambs, providing new insights into its application. Nevertheless, this study remains preliminary and is subject to several limitations. First, the sample size of weaned lambs per group is relatively small, which may limit the statistical power and generalizability of the results. Second, the causal relationship between potential core regulatory genes and the immune indicators have not been functionally validated. Furthermore, the transcriptomic data reveal suboptimal sample clustering within the CYC1 group. In future research, these limitations could be addressed by increasing the number of experimental animals to enhance result reliability, as well as by conducting in vivo and in vitro functional assays such as gene knockout or overexpression experiments to confirm the functional roles of the identified core regulatory genes.

Fig. 7.

Fig. 7

Dietary supplementation of CYC in weaned lambs can regulate the homeostasis of spleen immune factors by activating cell adhesion molecules signaling pathway and inhibiting oxidative phosphorylation signaling pathway

Conclusion

In summary, the addition of CYC in the diet may activate the cell adhesion molecules signaling pathway and inhibit the oxidative phosphorylation signaling pathway by regulating DEGs such as ICAM1, CDH5, DQA, PTPRM, NDUFB8 and ATP5MC3 in the spleen, thereby affecting the content of tuftsin, IgG, IgM, IL-2, IL-4, IL-1β, IL-6 and TNF-α, and improving the spleen immune function of weaned lambs.

Supplementary Information

Supplementary Material 1 (204.4KB, zip)
Supplementary Material 2 (38.4KB, pdf)

Acknowledgements

We thank all the members who participated in this study for their support and the experimental site keepers for their help.

Generative AI statement

The authors declare that no Generative AI was used in the creation of this manuscript.

Authors’ contributions

Yu Lu: experimental operation, data analysis and interpretation, and manuscript writing; Pengxiang Bai: collection and arrangement of materials; Songjian Li: collection and arrangement of materials; Jie Ning: collection and arrangement of materials; Xiaoxuan Wu: collection and collation of materials; Qifei Luo: collection and arrangement of materials; Zichen Yun : collection and arrangement of materials; Hui Chen: research conception and design, and review the submitted documents; Dacheng Liu: Research conception and design, and review the final version of the submitted manuscript.All authors read and approved the final manuscript.

Funding

The author(s) declare financial support was received for the research, authorship, and/or publication of this article. We are grateful to the National Key Research and Development Program (2023YFE0100400), First-class Disciplines of Inner Mongolia Scientific Research Special Program (YLXKZX-NND-012), Basic Scientific Research Projects of Colleges and Universities directly under the Inner Mongolia Autonomous Region (BR22-11-17) and Natural Science Foundation Project of Inner Mongolia Autonomous Region (2024LHMS03054) for financial support.

Data availability

Sequence data that support the findings of this study have been deposited in the NCBI SRA database with the BioProject PRJNA1312963.

Declarations

Ethics approval and consent to participate

The animal study was approved by the animal welfare and research ethics committee of Inner Mongolia Agricultural University. The study was conducted in accordance with the local legislation and institutional requirements.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Hui Chen, Email: cinderellachenhui@163.com.

Dacheng Liu, Email: nmgldc@163.com.

References

  • 1.Li C, Xu Y, Jia J, Weng X, Zhang Y, Peng J, et al. Impacts of early weaning on lamb gut health and immune function: short-term and long-term effects. Animals. 2025;15:2135. 10.3390/ani15142135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Amin AB, Mao S. Influence of yeast on rumen fermentation, growth performance and quality of products in ruminants: a review. Anim Nutr. 2021;7:31–41. 10.1016/j.aninu.2020.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Song B, Wu T, You P, Wang H, Burke JL, Kang K, et al. Dietary supplementation of yeast culture into pelleted total mixed rations improves the growth performance of fattening lambs. Front Vet Sci. 2021;8:657816. 10.3389/fvets.2021.657816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Qi P, Wang L. Effect of adding yeast cultures to high-grain conditions on production performance, rumen fermentation profile, microbial abundance, and immunity in goats. Anim (Basel). 2024;14:1799. 10.3390/ani14121799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Perricone V, Sandrini S, Irshad N, Savoini G, Comi M, Agazzi A. Yeast-derived products: the role of hydrolyzed yeast and yeast culture in poultry nutrition—a review. Anim (Basel). 2022;12:1426. 10.3390/ani12111426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Liu S, Yang L, Zhang Y, Chen H, Li X, Xu Z, et al. Review of yeast culture concerning the interactions between gut microbiota and young ruminant animals. Front Vet Sci. 2024;11:1335765. 10.3389/fvets.2024.1335765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Jiang Q, Sherlock DN, Elolimy AA, Vailati-Riboni M, Yoon I, Loor JJ. Impact of a Saccharomyces cerevisiae fermentation product during an intestinal barrier challenge in lactating Holstein cows on ileal microbiota and markers of tissue structure and immunity. J Anim Sci. 2023;101:skad309. 10.1093/jas/skad309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.He W, Gao Y, Guo Z, Yang Z, Wang X, Liu H, et al. Effects of fermented wheat Bran and yeast culture on growth performance, immunity, and intestinal microflora in growing-finishing pigs. J Anim Sci. 2021;99:skab308. 10.1093/jas/skab308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mahmoud MM, Youssef IMI, Abd El-Tawab MM, Bakr HA, Eissa NA, Hassan MS, et al. Influence of probiotic and yeast culture supplementation on selected biochemical and immunological parameters of growing lambs. Pol J Vet Sci. 2020;23:5–12. 10.24425/pjvs.2019.131413. [DOI] [PubMed] [Google Scholar]
  • 10.Chen H, Liu S, Li S, Li D, Li X, Xu Z, et al. Effects of yeast culture on growth performance, immune function, antioxidant capacity and hormonal profile in Mongolian Ram lambs. Front Vet Sci. 2024;11:1424073. 10.3389/fvets.2024.1424073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Xu Z, Yang L, Chen H, Liu S, Li X, Li S, et al. Saccharomyces cerevisiae and Kluyveromyces Marxianus yeast co-cultures modulate the ruminal Microbiome and metabolite availability to enhance rumen barrier function and growth performance in weaned lambs. Anim Nutr. 2024;19:139–52. 10.1016/j.aninu.2024.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Xu Z, Yang L, Chen H, Bai P, Li X, Liu D. Transcriptomic characterization of the functional and morphological development of the rumen wall in weaned lambs fed a diet containing yeast co-cultures of Saccharomyces cerevisiae and Kluyveromyces Marxianus. Front Vet Sci. 2025;12:1510689. 10.3389/fvets.2025.1510689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mei S, He G, Zhang T, Chen Z, Zhang R, Liao Y, et al. Effect of feeding fermented distiller’s grains diets on immune status and metabolomics of spleen and mesenteric lymph nodes in finishing cattle. J Proteom. 2024;296:105107. 10.1016/j.jprot.2024.105107. [DOI] [PubMed] [Google Scholar]
  • 14.Irgashev A, Asanova E, Kalandarova Z, Cho GJ, Ishenbaeva S. Comparative immunohistochemical detection of major immunocompetent cells and cell proliferation in peripheral lymphoid organs in cattle and Yak (bos gruniensis). Anatom Histol Embryol. 2025;54:e70039. 10.1111/ahe.70039. [DOI] [PubMed] [Google Scholar]
  • 15.Carsetti R, Di Sabatino A, Rosado MM, Cascioli S, Piano Mortari E, Milito C, et al. Lack of gut secretory Immunoglobulin a in memory B-cell dysfunction-associated disorders: a possible gut-spleen axis. Front Immunol. 2019;10:2937. 10.3389/fimmu.2019.02937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wen E, Xin G, Li S, Dong Y, Zhu Y, Wan C, et al. Tuftsin ameliorates Splenic inflammatory injury by promoting neuropilin-1 in severe acute pancreatitis. Biochem Pharmacol. 2022;199:115030. 10.1016/j.bcp.2022.115030. [DOI] [PubMed] [Google Scholar]
  • 17.Zheng Y, Guan J, Wang L, Luo X, Zhang X. Comparative proteomic analysis of spleen reveals key immune-related proteins in the Yak (bos grunniens) at different growth stages. Comp Biochem Physiol D Genom Proteom. 2022;42:100968. 10.1016/j.cbd.2022.100968. [DOI] [PubMed] [Google Scholar]
  • 18.Atif SM, Gibbings SL, Redente EF, Camp FA, Torres RM, Kedl RM, et al. Immune surveillance by natural IgM is required for early neoantigen recognition and initiation of adaptive immunity. Am J Respir Cell Mol Biol. 2018;59:580–91. 10.1165/rcmb.2018-0159OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Damelang T, Brinkhaus M, van Osch TLJ, Schuurman J, Labrijn AF, Rispens T, et al. Impact of structural modifications of IgG antibodies on effector functions. Front Immunol. 2023;14:1304365. 10.3389/fimmu.2023.1304365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang C, Zhang J, Yu Z, Zhou G, Yao J. Effects of supplementation with Saccharomyces cerevisiae products on dairy calves: a meta-analysis. J Dairy Sci. 2022;105:7386–98. 10.3168/jds.2021-21519. [DOI] [PubMed] [Google Scholar]
  • 21.Zhang J, Li K, Cao Y, Wang D, Cheng J, Gao H, et al. Inducible IL-2 production and IL-2 + cell expansion are landmark events for T-cell activation of teleost. Fish Shellfish Immunol. 2024;148:109515. 10.1016/j.fsi.2024.109515. [DOI] [PubMed] [Google Scholar]
  • 22.Pacheco A, Conington J, Corripio-Miyar Y, Frew D, Banos G, McNeilly TN. Genetic profile of adaptive immune traits and relationships with parasite resistance and productivity in Scottish blackface sheep. Anim: Int J Anim Biosci. 2024;18:101061. 10.1016/j.animal.2023.101061. [DOI] [PubMed] [Google Scholar]
  • 23.Zhao F, Qu J, Wang W, Li S, Xu S. The imbalance of Th1/TH2 triggers an inflammatory response in chicken spleens after ammonia exposure. Poult Sci. 2020;99:3817–22. 10.1016/j.psj.2020.04.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kihara T, Toriuchi K, Aoki H, Kakita H, Yamada Y, Aoyama M. Interleukin-1β enhances cell adhesion in human endothelial cells via microRNA-1914-5p suppression. Biochem Biophys Rep. 2021;27:101046. 10.1016/j.bbrep.2021.101046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cheng S-C, Huang W-C, Pang S, Wu J-H, Cheng Y-H. Quercetin inhibits the production of IL-1β-induced inflammatory cytokines and chemokines in ARPE-19 cells via the MAPK and NF-κB signaling pathways. Int J Mol Sci. 2019;20:2957. 10.3390/ijms20122957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li X, An N, Chen H, Liu D. Effects of yeast culture on growth performance, antioxidant capacity, immune function, and intestinal microbiota structure in simmental beef cattle. Front Vet Sci. 2024;11:1533081. 10.3389/fvets.2024.1533081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yu DY, Oh S-H, Kim IS, Kim GI, Kim JA, Moon YS, et al. Intestinal microbial composition changes induced by Lactobacillus plantarum GBL 16, 17 fermented feed and intestinal immune homeostasis regulation in pigs. J Anim Sci Technol. 2022;64:1184–98. 10.5187/jast.2022.e89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lu X, Ma H, Liu Y, Chen M, Dang J, Su X, et al. Rhodotorula yeast culture improved the antioxidant capacity, lipid metabolism, and immunity of sheep livers. Vet Sci. 2025;12:314. 10.3390/vetsci12040314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wang L, Lv Z, Ning X, Yue Z, Wang P, Liu C, et al. The effects of compound probiotics on production performance, rumen fermentation and microbiota of Hu sheep. Front Vet Sci. 2024;11:1440432. 10.3389/fvets.2024.1440432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kozlova I, Sytnyk V. Cell adhesion molecules as modulators of the epidermal growth factor receptor. Cells. 2024;13:1919. 10.3390/cells13221919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Song L, Dong X, Hu G. Transcriptome analysis of red sea Bream (pagrus major) head kidney and spleen infected by vibrio anguillarum. Aquaculture Rep. 2021;21:100789. 10.1016/j.aqrep.2021.100789. [Google Scholar]
  • 32.Verpoort B, de Wit J. Cell adhesion molecule signaling at the synapse: beyond the scaffold. Cold Spring Harbor Perspect Biol. 2024;16:a041501. 10.1101/cshperspect.a041501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sheng L, Leshchyns’ka I, Sytnyk V. Cell adhesion and intracellular calcium signaling in neurons. Cell Commun Signal: CCS. 2013;11:94. 10.1186/1478-811X-11-94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Gibson NJ. Cell adhesion molecules in context: CAM function depends on the neighborhood. Cell Adh Migr. 2011;5:48–51. 10.4161/cam.5.1.13639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sengupta K, Dillard P, Limozin L. Morphodynamics of T-lymphocytes: scanning to spreading. Biophys J. 2024;123:2224–33. 10.1016/j.bpj.2024.02.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Casal JI, Bartolomé RA. Beyond N-cadherin, relevance of cadherins 5, 6 and 17 in cancer progression and metastasis. Int J Mol Sci. 2019;20:3373. 10.3390/ijms20133373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Muller WA. Mechanisms of leukocyte transendothelial migration. Annu Rev Pathol. 2011;6:323–44. 10.1146/annurev-pathol-011110-130224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Schulte D, Küppers V, Dartsch N, Broermann A, Li H, Zarbock A, et al. Stabilizing the VE-cadherin-catenin complex blocks leukocyte extravasation and vascular permeability. EMBO J. 2011;30:4157–70. 10.1038/emboj.2011.304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Parasar P, Bhushan B, Panigrahi M, Kumar H, Kaisa K, Dutt T. Characterization of BoLA class II DQA and DQB by PCR-RFLP, cloning, and sequencing reveals sequence diversity in crossbred cattle. Anim Biotechnol. 2023;34:955–65. 10.1080/10495398.2021.2006205. [DOI] [PubMed] [Google Scholar]
  • 40.Yang H, Yang Y-L, Li G-Q, Yu Q, Yang J. Identifications of immune-responsive genes for adaptative traits by comparative transcriptome analysis of spleen tissue from Kazakh and Suffolk sheep. Sci Rep. 2021;11:3157. 10.1038/s41598-021-82878-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Gowane GR, Sharma P, Kumar R, Misra SS, Alex R, Vohra V, et al. Population-wide genetic analysis of ovar-DQA1 and DQA2 loci across sheep breeds in India revealed their evolutionary importance and fitness of sheep in a tropical climate. Anim Biotechnol. 2023;34:4645–57. 10.1080/10495398.2023.2180010. [DOI] [PubMed] [Google Scholar]
  • 42.Ugbo B, Yakubu S, Omeje A, Bibinu JNS, Musa BS, Egahi IO. Assessment of genetic relationship and application of computational algorithm to assess functionality of non-synonymous substitutions in DQA2 gene of cattle, sheep and goats. Open J Genet. 2015;5:145–58. 10.4236/ojgen.2015.54011. [Google Scholar]
  • 43.Mo X, Liu M, Gong J, Mei Y, Chen H, Mo H, et al. PTPRM is critical for synapse formation regulated by zinc ion. Front Mol Neurosci. 2022;15:822458. 10.3389/fnmol.2022.822458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Zhang G, Wang J, Kelly J, Gu G, Hou J, Zhou Y, et al. B7-H3 augments the inflammatory response and is associated with human sepsis. J Immunol (Baltim Md : 1950). 2010;185:3677–84. 10.4049/jimmunol.0904020. [DOI] [PubMed] [Google Scholar]
  • 45.Kumar M, Sharma S, Kumar J, Barik S, Mazumder S. Mitochondrial electron transport chain in macrophage reprogramming: potential role in antibacterial immune response. Curr Res Immunol. 2024;5:100077. 10.1016/j.crimmu.2024.100077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Rui L. New antidiabetes agent targeting both mitochondrial uncoupling and pyruvate catabolism: two birds with one stone. Diabetes. 2019;68:2195–6. 10.2337/dbi19-0024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Singh A, Kukreti R, Saso L, Kukreti S. Oxidative stress: a key modulator in neurodegenerative diseases. Mol (Basel Switz). 2019;24:1583. 10.3390/molecules24081583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Koch RE, Buchanan KL, Casagrande S, Crino O, Dowling DK, Hill GE, et al. Integrating mitochondrial aerobic metabolism into ecology and evolution. Trends Ecol Evol. 2021;36:321–32. 10.1016/j.tree.2020.12.006. [DOI] [PubMed] [Google Scholar]
  • 49.Mallik B, Frank CA. Roles for mitochondrial complex I subunits in regulating synaptic transmission and growth. Front Neurosci. 2022;16:846425. 10.3389/fnins.2022.846425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Ji W, Tang X, Du W, Lu Y, Wang N, Wu Q, et al. Optical/electrochemical methods for detecting mitochondrial energy metabolism. Chem Soc Rev. 2022;51:71–127. 10.1039/d0cs01610a. [DOI] [PubMed] [Google Scholar]
  • 51.Bohovych I, Khalimonchuk O. Sending out an SOS: mitochondria as a signaling hub. Front Cell Dev Biol. 2016;4:109. 10.3389/fcell.2016.00109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Baradaran R, Berrisford JM, Minhas GS, Sazanov LA. Crystal structure of the entire respiratory complex I. Nature. 2013;494:443–8. 10.1038/nature11871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Schmidt-Rohr K. Oxygen is the high-energy molecule powering complex multicellular life: fundamental corrections to traditional bioenergetics. ACS Omega. 2020;5:2221–33. 10.1021/acsomega.9b03352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Neilson DE, Zech M, Hufnagel RB, Slone J, Wang X, Homan S, et al. A novel variant of ATP5MC3 associated with both dystonia and spastic paraplegia. Mov Disord: Off J Mov Disord Soc. 2022;37:375–83. 10.1002/mds.28821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Fan Z, Zhang H, Rong M, Meng D, Yu Z, Jiang L, et al. Molecular cloning and bioinformatics analysis of DQA gene from Mink (neovison vison). Int J Mol Sci. 2019;20:1037. 10.3390/ijms20051037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Chuntharpursat-Bon E, Povstyan OV, Ludlow MJ, Carrier DJ, Debant M, Shi J, et al. PIEZO1 and PECAM1 interact at cell-cell junctions and partner in endothelial force sensing. Commun Biol. 2023;6:358. 10.1038/s42003-023-04706-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Sayitoglu EC, Luca BA, Boss AP, Thomas BC, Freeborn RA, Uyeda MJ, et al. AML/T cell interactomics uncover correlates of patient outcomes and the key role of ICAM1 in T cell killing of AML. Leukemia. 2024;38:1246. 10.1038/s41375-024-02255-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Hay IM, Shamin M, Caroe ER, Mohammed ASA, Svergun DI, Jeffries CM, et al. Determinants of receptor tyrosine phosphatase homophilic adhesion: structural comparison of PTPRK and PTPRM extracellular domains. J Biol Chem. 2023;299:102750. 10.1016/j.jbc.2022.102750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Zhou Q, Xu J, Xu Y, Sun S, Chen J. Role of ICAM1 in tumor immunity and prognosis of triple-negative breast cancer. Front Immunol. 2023;14:1176647. 10.3389/fimmu.2023.1176647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Li L, Ge Z, Liu S, Zheng K, Li Y, Chen K, et al. Multi-omics landscape and molecular basis of radiation tolerance in a tardigrade. Science. 2024;386:eadl0799. 10.1126/science.adl0799. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (204.4KB, zip)
Supplementary Material 2 (38.4KB, pdf)

Data Availability Statement

Sequence data that support the findings of this study have been deposited in the NCBI SRA database with the BioProject PRJNA1312963.


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES