Skip to main content
NCBI home page
Biomolecules & Therapeutics logoLink to Biomolecules & Therapeutics
. 2025 Dec 19;34(1):136–145. doi: 10.4062/biomolther.2025.217

β-Catenin and AMPK/AKT/FOXO Signaling Mediate Doxorubicin-Induced Senescence and Lipid Accumulation in C2C12 Myoblasts

Chawon Yun 1,†, Sou Hyun Kim 1,†, Doyoung Kwon 2,†, RanJu Woo 1, Ki Wung Chung 1, Jaewon Lee 1, Yun-Hee Lee 3,*, Young-Suk Jung 1,*
PMCID: PMC12782858  PMID: 41414677

Abstract

Skeletal muscle atrophy is a major complication associated with aging, chronic disease, and chemotherapy. Doxorubicin (Dox), a widely used anticancer agent, accelerates muscle wasting; however, the underlying cellular mechanisms remain poorly understood. In this study, we examined the effects of Dox on myogenic differentiation, senescence, and lipid metabolism using C2C12 myoblasts. Dox exposure impaired myotube formation without causing overt cytotoxicity. Mechanistically, Dox disrupted myogenic differentiation by inhibiting protein kinase B/mammalian target of rapamycin (AKT/mTOR) signaling, thereby de-repressing forkhead box O1/3 (FOXO1/3) and upregulating the muscle-specific ubiquitin ligases muscle atrophy F-box (MAFbx) and muscle RING finger 1 (MuRF1), which promote proteolysis. Dox also decreased glycogen synthase kinase 3β (GSK3β) phosphorylation while paradoxically increasing total and phosphorylated β-catenin, indicating dysregulated Wnt/β-catenin signaling. These alterations were accompanied by a senescence-like phenotype, characterized by elevated senescence-associated β-galactosidase (SA-β-gal) activity, increased phosphorylated histone variant γH2AX, and activation of the p53–p21 axis. Notably, cellular senescence coincided with excessive lipid accumulation in myotubes. Dox reduced phosphorylation of adenosine monophosphate-activated protein kinase (AMPK) and acetyl-CoA carboxylase (ACC) while enhancing expression of key lipogenic regulators, thereby creating a metabolic environment favoring lipid storage. Collectively, these findings demonstrate that Dox not only suppresses myogenic differentiation but also induces premature senescence and metabolic reprogramming toward lipid accumulation. Targeting these pathways through AMPK activation, FOXO inhibition, or senolytic interventions may offer therapeutic strategies to preserve skeletal muscle integrity in patients undergoing chemotherapy.

Keywords: Doxorubicin, β-Catenin, AMPK, AKT, FOXO, Senescence

INTRODUCTION

Skeletal muscle atrophy is a progressive condition characterized by the loss of muscle mass, strength, and function. While age-related muscle wasting (sarcopenia) occurs naturally, it can also be triggered by chronic illness, prolonged inactivity, or pharmacological agents (Chen et al., 2025; Zhou et al., 2025). Among these, chemotherapeutic agents are of particular concern. The anthracycline doxorubicin (Dox) is widely used to treat various malignancies because of its potent antitumor efficacy; however, its therapeutic benefits are often offset by adverse severe effects, including cardiotoxicity and skeletal muscle degeneration (Hiensch et al., 2020; Pigg et al., 2025). Such toxicities limit cumulative dosing and markedly reduce the quality of life in patients with cancer.

Initially, Dox-induced muscle atrophy was attributed primarily to reduced protein synthesis. However, growing evidence indicates that broader signaling disruptions are involved (Hiensch et al., 2020; Wiedmer et al., 2021). Central to this process is the protein kinase B/mammalian target of rapamycin/forkhead box O (AKT/mTOR/FOXO) pathway, which maintains muscle homeostasis (Jackman and Kandarian, 2004). Under physiological conditions, AKT activation stimulates mTOR to promote protein synthesis and myogenic differentiation, while simultaneously phosphorylating and inhibiting FOXO1/3 transcription factors, thereby repressing atrogenes, such as muscle atrophy F-box (MAFbx) and muscle RING finger 1 (MuRF1) (Stitt et al., 2004). When AKT signaling is suppressed, FOXO is dephosphorylated and activated, leading to increased transcription of atrophy-related genes. Indeed, Dox reduces phosphorylated AKT and mTOR, thereby attenuating anabolic signaling and enhancing FOXO-driven proteolysis (Faber et al., 2025; Li et al., 2024b; Pigg et al., 2025).

Beyond proteostasis, Dox also induces cellular senescence, a state of permanent cell-cycle arrest characterized by senescence-associated β-galactosidase (SA-β-gal) activity, persistent DNA damage indicated by phosphorylated histone variant γH2AX, and activation of the p53–p21 axis (Chang et al., 2025; Liu et al., 2025). Accumulation of senescent cells impairs regenerative capacity, promotes inflammation, and fosters fibrosis, thereby exacerbating functional decline (Bielak-Zmijewska et al., 2014; Chang et al., 2025; Pigg et al., 2025). Previous studies have demonstrated that Dox can trigger premature senescence in skeletal muscle and vascular cells (Pundlik et al., 2024; Van Asbroeck et al., 2025), suggesting that its impact extends beyond acute atrophy to accelerate tissue aging.

Another pathway implicated in Dox-related pathology is Wnt/β-catenin signaling. β-catenin, a key mediator of myogenesis and stem cell renewal, is normally regulated by glycogen synthase kinase 3β (GSK3β)–mediated phosphorylation that targets it for proteasomal degradation. Under Dox-induced stress, altered GSK3β regulation may impair β-catenin turnover, leading to its abnormal stabilization and dysregulated signaling rather than reflecting increased GSK3β activity (Li et al., 2024a; Xue et al., 2025). Dysregulated β-catenin signaling has been reported to induce senescence through activation of the p53/p21 pathway and fibrotic remodeling (Goyal et al., 2025; Kajabadi et al., 2023). These findings suggest that aberrant β-catenin regulation may contribute to both senescence and impaired myogenic regeneration in Dox-treated muscle.

Metabolic homeostasis is also disrupted by Dox. Specifically, Dox suppresses adenosine monophosphate-activated protein kinase (AMPK), a master regulator of energy balance and lipid metabolism (Garcia and Shaw, 2017; Li et al., 2025). Under normal conditions, AMPK phosphorylates and inhibits acetyl-CoA carboxylase (ACC), thereby reducing malonyl-CoA production and fatty acid synthesis. When AMPK is inhibited, ACC remains active, favoring lipogenesis. Dox reduces phosphorylation of both AMPK and ACC while upregulating lipogenic regulators, including sterol regulatory element-binding protein 1 (SREBP-1), stearoyl-CoA desaturase 1 (SCD-1), and perilipin-2 (PLIN-2), a lipid droplet coat protein (Li et al., 2012; Matsui et al., 2012). This shift promotes abnormal lipid droplet accumulation in myotubes, contributing to metabolic stress, mitochondrial dysfunction, and impaired insulin signaling (Hamrick et al., 2016; Li et al., 2022).

Despite these insights, the precise cascade correlating AKT/FOXO inhibition, β-catenin dysregulation, senescence, and lipid metabolic alterations in skeletal muscle remains poorly understood. Therefore, this study investigated how Dox affects myogenic differentiation, proteostasis (AKT/FOXO axis), Wnt/β-catenin signaling, cellular senescence, and lipid metabolism in C2C12 myotubes. By elucidating the molecular and metabolic pathways linking these processes, we aim to identify potential intervention points to preserve muscle integrity during chemotherapy. Such interventions may include AMPK activation to restore energy balance, FOXO inhibition to limit proteolysis, or senolytic strategies to eliminate senescent cells. Collectively, this work provides a comprehensive framework for understanding and mitigating Dox-induced muscle degeneration.

MATERIALS AND METHODS

Reagents and antibodies

Doxorubicin (Dox) and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against myogenin (MyoG), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and SREBP-1 were obtained from Santa Cruz Biotechnology (Dallas, TX, USA). Anti-myoblast determination protein (MyoD) was purchased from BD Biosciences, and anti-myosin heavy chain (MHC) was obtained from the Developmental Studies Hybridoma Bank (Bethesda, MD, USA). Antibodies against phosphorylated AMPK (p-AMPK; Thr172), total AMPK, AKT, phosphorylated AKT (p-AKT; Ser473), β-catenin, phosphorylated β-catenin (Ser33/37/Thr41), GSK3β, phosphorylated GSK3β (p-GSK3β; Ser9), eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1), mTOR, phosphorylated mTOR (p-mTOR; Ser2448), FOXO1, phosphorylated FOXO1 (p-FOXO1; Ser256), FOXO3a, p-FOXO3a (Ser253), ACC, p-ACC (Ser79), SCD-1, and fatty acid synthase (FAS) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against MAFbx and MuRF1 were obtained from ABclonal (Woburn, MA, USA). TRIzol™ reagent was from Ambion (Waltham, MA, USA), and Direct-zol™ RNA MiniPrep kit was from Zymo Research (Irvine, CA, USA). Reverse transcription was performed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA), while quantitative polymerase chain reaction (qPCR) was performed with SYBR Green Master Mix (SmartGene, Daejeon, Korea). Protein lysates were prepared using ProEX™ CETi protein extraction solution (TransLab, Daejeon, Korea). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Sigma-Aldrich.

Cell culture and treatment

C2C12 myoblasts were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Welgene, Gyeongsan, Korea) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin (HyClone, Logan, UT, USA) at 37°C in a humidified atmosphere containing 5% CO₂. For myogenic differentiation, cells were switched to differentiation medium (DMEM containing 2% horse serum and 1% penicillin–streptomycin) and cultured for 5 days. To evaluate the effect of Dox on myogenic differentiation, Dox (0.2 μg/mL) was added on the third day of differentiation. After 24 h, the medium was replaced with fresh differentiation medium and cells were incubated for an additional 24 h. Cell viability was assessed using the MTT assay as previously described (Byun et al., 2025).

Senescence-associated β-galactosidase (SA-β-Gal) staining

To detect Dox-induced senescence, cells were fixed with 4% paraformaldehyde and incubated overnight at 37°C with SA-β-Gal staining solution containing 1 mg/mL 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal; Sigma-Aldrich, #9630), 40 mM citric acid/sodium phosphate buffer (pH 5.8), 5 mM potassium ferrocyanide, and 5 mM potassium ferricyanide. Senescent cells exhibiting blue staining were visualized under a light microscope, and the percentage of SA-β-Gal-positive cells was quantified.

Quantitative PCR (qPCR)

Total RNA was isolated using TRIzol™ reagent and purified with the Direct-zol™ RNA MiniPrep kit. cDNA was synthesized from 1 μg of RNA using the iScript™ cDNA synthesis kit. qPCR was performed on a CFX96 Real-Time PCR System (Bio-Rad) using SYBR Green detection. Primer sequences for key myogenic and metabolic genes are listed in Table 1. Relative gene expression levels were calculated using the 2−ΔΔCt method and normalized to GAPDH as a housekeeping gene (Byun et al., 2025).

Table 1.

List of mouse primers used for real-time reverse transcription polymerase chain reaction

Symbol Primer sequence (5’-3’)
Forward Reverse
Myf5 AGGAAAAGAAGCCCTGAAGC GCAAAAAGAACAGGCAGAGG
MyoG ACTCCCTTACGTCCATCGTG CAGGACAGCCCCACTTAAAA
Mck CGGAGGAACAATCCAATGTC TGGTCACTTTCCTGCACTTG
Gapdh CACCTCCACAGCACAGACAG ACCTTGGCCATGTGATTGTT
Open in a new tab

Western blot analysis

Cells were lysed in ProEX™ CETi buffer containing protease and phosphatase inhibitors. Equal amounts of protein were separated via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were incubated with the appropriate primary antibodies followed by horseradish peroxidase (HRP)-conjugated secondary antibodies. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection kit (Bio-Rad) and quantified with Image Studio Lite software. Protein expression was normalized to GAPDH or total protein, as indicated (Seo et al., 2024).

Oil Red O (ORO) staining and lipid quantification

Intracellular neutral lipid accumulation was evaluated by ORO staining. Differentiated C2C12 myotubes were treated with Dox or vehicle, fixed with 4% paraformaldehyde, and incubated with 0.3% (w/v) filtered ORO solution for 1 h. After washing with distilled water, lipid droplets were visualized by light microscopy. For quantification analysis, the bound dye was eluted with isopropanol, and absorbance was measured at 510 nm using a microplate reader. Lipid accumulation was expressed relative to control (Yun et al., 2024).

Statistical analyses

All data are presented as mean ± standard deviation (SD) from at least three independent experiments. Statistical analyses were performed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test or Student’s t-test, as appropriate. A p-value<0.05 was considered statistically significant.

RESULTS

Doxorubicin impaired C2C12 myogenic differentiation without inducing significant cytotoxicity

Under normal differentiation conditions (Fig. 1A), C2C12 myoblasts fused to form elongated, multinucleated myotubes. During the 5-day differentiation period, the early myogenic regulator MyoD gradually decreased while expression of the late myogenic markers MyoG and MHC progressively increased, peaking on day 3 and slightly declining thereafter; this was consistent with normal myogenic maturation (Fig. 1B) (Ohkawa et al., 2006). When Dox (0.2 μg/mL) was added on the third day of differentiation, myotubes exhibited pronounced morphological alterations, including reduced fusion and thinner fibers, resulting in a markedly decreased number of mature myotubes compared with those in untreated controls (Fig. 1C). Notably, this Dox concentration did not significantly reduce cell viability, as determined by the MTT assay (Fig. 1D). Despite the absence of overt cytotoxicity, Dox treatment substantially downregulated the protein expression of MyoG and MHC in differentiated C2C12 myotubes (Fig. 1E). These findings indicate that Dox disrupts the myogenic differentiation program of C2C12 cells, impairing myotube formation through mechanisms independent of acute cell death.

Fig. 1.

Fig. 1

Open in a new tab

Doxorubicin impairs C2C12 myogenic differentiation without inducing significant cytotoxicity. (A) Experimental design: C2C12 myoblasts were cultured in GM or switched to DM for 5 days. Dox (0.2 μg/mL) was added on day 3 of differentiation (red text in the timeline). (B) Time course of myogenic protein expression (MyoD, MyoG, and MHC) during differentiation with or without Dox. (C) Representative phase-contrast images showing reduced myotube length and diameter in Dox-treated cells on day 5. (D) Cell viability measured by MTT assay indicates no significant cytotoxicity at the Dox concentration used. (E) Western blot analysis showing decreased MyoG and MHC protein levels in Dox-treated cells. Data represent mean ± SD; p<0.05, p<0.01 vs. control (Tukey’s test). Different letters (a, b, c) denote groups significantly different from one another. Dox, doxorubicin; GM, growth medium; DM, differentiation medium; MyoD, myoblast determination protein; MyoG, myogenin; MHC, myosin heavy chain; MTT, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; SD, standard deviation.

Doxorubicin disrupted AKT/mTOR/FOXO signaling in differentiating C2C12 cells

The AKT/mTOR/FOXO axis plays a pivotal role in the regulation of muscle protein synthesis and degradation (Chen et al., 2022; Jaiswal et al., 2022). Therefore, we examined whether Dox affects this pathway to elucidate the molecular mechanism underlying Dox-induced myotube atrophy. Western blot analysis revealed that Dox markedly decreased phosphorylation of AKT at Ser473 (Fig. 2A). Phosphorylation of 4E-BP1, a downstream substrate of the mTOR pathway, showed a slight increase, whereas p-mTOR (Ser2448) levels themselves did not show a significant change under this acute treatment (Fig. 2A) (Chen et al., 2022; Sartori et al., 2021). Dox did not increase the phosphorylation of FOXO1 at Ser256 or FOXO3a at Ser253, sites whose phosphorylation normally suppresses FOXO activity, indicating that FOXO remained largely dephosphorylated and transcriptionally active (Fig. 2B). Accordingly, the expression of the FOXO target E3 ubiquitin ligases MAFbx and MuRF1 was upregulated in Dox-treated cells (Fig. 2B). Quantitative analysis confirmed that the phospho-FOXO1/total FOXO1 and phospho-FOXO3a/total FOXO3a ratios were significantly reduced by Dox treatment (Fig. 2C). Collectively, these results demonstrate that Dox suppressed anabolic protein synthesis signaling while enhancing catabolic proteolytic pathways, thereby shifting the intracellular balance toward muscle protein degradation. This signaling reprogramming provides a mechanistic basis for Dox-induced muscle atrophy.

Fig. 2.

Fig. 2

Open in a new tab

Doxorubicin modulates the AKT/mTOR/FOXO signaling pathway in C2C12 cells. (A) Western blot analysis showing decreased phosphorylation of p-AKT (Ser473) in Dox-treated cells, whereas total AKT levels were unchanged. p-4E-BP1 (Thr37/46) slightly increased following Dox exposure, while p-mTOR (Ser2448) and total mTOR remained unaltered. (B) Dox treatment reduced phosphorylation of FOXO1 (p-FOXO1; Ser256) and FOXO3a (p-FOXO3a; Ser253), indicating their dephosphorylation and activation, and concomitantly upregulated the ubiquitin ligases MAFbx and MuRF1. (C) Quantitative analysis of FOXO phosphorylation status showing decreased p-FOXO1/FOXO1 and p-FOXO3a/FOXO3a ratios in Dox-treated cells. Data represent mean ± SD; p<0.05 vs. control (Tukey’s test). Different letters (a, b, c) denote groups significantly different from each other; n.s., not significant. Con, control; Dox, doxorubicin; AKT, protein kinase B; mTOR, mammalian target of rapamycin; FOXO, forkhead box O; 4E-BP1, eukaryotic translation initiation factor 4E-binding protein 1; MAFbx, muscle atrophy F-box; MuRF1, muscle RING finger 1; SD, standard deviation; n.s., not significant.

Doxorubicin induced aberrant Wnt/β-catenin signaling in C2C12 cells

The Wnt/β-catenin pathway is essential for myogenic differentiation and satellite cell renewal (Jones et al., 2015; von Maltzahn et al., 2012). Therefore, we investigated whether Dox alters this signaling cascade, which could explain the impaired myotube formation and differentiation observed under chemotherapeutic stress. As shown in Fig. 3, western blot and immunofluorescence analyses revealed that Dox treatment disrupted the GSK3β/β-catenin signaling axis in differentiating C2C12 cells. The level of inhibitory p-GSK3β (Ser9) decreased (Fig. 3A) and the p-GSK3β/GSK3β ratio became smaller (Fig. 3B), changes consistent with reduced inhibitory phosphorylation. However, total and phosphorylated β-catenin (ser33/37/Thr41) concurrently increased (Fig. 3A); this indicated that β-catenin turnover was impaired rather than reflecting a simple net increase in GSK3β activity. Immunofluorescence imaging further revealed abnormal accumulation of β-catenin in the cytoplasm of Dox-treated myotubes, which appeared shortened and atrophic compared with those in untreated controls (Fig. 3C). This cytoplasmic sequestration suggests a non-canonical dysregulation without robust nuclear translocation and TCF/LDF-dependent transcriptional activation. Such dysregulation may contribute to impaired myogenic differentiation and enhanced muscle atrophy by promoting premature cell-cycle exit (Li et al., 2024a; Liu et al., 2022; Zhao et al., 2022).

Fig. 3.

Fig. 3

Open in a new tab

Aberrant Wnt/β-catenin signaling in doxorubicin-treated C2C12 cells. (A) Western blot analysis showing reduced p-GSK3β (Ser9) and modest increases in p-β-catenin (Ser33/37/Thr41) and total β-catenin following Dox treatment. Total GSK3β levels remained unchanged. (B) Quantitative analysis showing a decreased p-GSK3β/GSK3β ratio and an increased p-β-catenin/β-catenin ratio in Dox-treated cells. (C) Immunofluorescence staining for β-catenin (green) and nuclei (DAPI, blue) reveals enhanced cytoplasmic accumulation of β-catenin and shortened, atrophic myotubes after Dox treatment. Scale bars: 25 μm. Data represent mean ± SD; p<0.05 vs. control (Tukey’s test). Different letters (a, b, c) denote groups significantly different from each other. Con, control; Dox, doxorubicin; GSK3β, glycogen synthase kinase 3β; β-catenin, beta-catenin; DAPI, 4′,6-diamidino-2-phenylindole; SD, standard deviation.

Doxorubicin induced a senescent phenotype in C2C12 myogenic cells

Cellular senescence is increasingly recognized as a key contributor to muscle degeneration and impaired regeneration (Ajoolabady et al., 2025; Saito and Chikenji, 2021). To determine whether Dox-induced muscle atrophy involves a senescence mechanism, we analyzed canonical markers of DNA damage and cell-cycle arrest. As demonstrated in Fig. 4, Dox treatment induced a senescence-like phenotype in C2C12 cells, as evidenced by increased SA-β-Gal activity and upregulation of p53-p21 pathway components. Microscopic observation revealed numerous SA-β-Gal-positive cells, visible as green-stained cytoplasm under a microscope (Fig. 4A). This indicated pronounced accumulation of senescent cells in response to Dox exposure. Even a low concentration of Dox (0.05 μg/mL) significantly increased the proportion of SA-β-Gal-positive cells, with a more pronounced effect observed at 0.2 μg/mL (Fig. 4B). Consistent with these senescent features, Dox exposure elevated the expression levels of several proteins associated with DNA damage and cell-cycle arrest (Wang et al., 2016). Western blot analysis showed increased levels of phosphorylated histone variant γH2AX (p-γH2AX; Ser139), p-p53 (Ser15), total p53, and cyclin-dependent kinase inhibitor p21 in Dox-treated cells compared with those in controls (Fig. 4C). The robust upregulation of p21, a downstream effector of p53, indicates activation of the p53–p21 signaling axis, a hallmark senescence induction (Kumari and Jat, 2021). Collectively, these results demonstrate that Dox induces premature cellular senescence in C2C12 myogenic cells, which likely contributes to impaired differentiation and reduced regenerative capacity under chemotherapeutic stress.

Fig. 4.

Fig. 4

Open in a new tab

Doxorubicin induces cellular senescence in C2C12 cells. (A) SA-β-Gal staining showing an increased proportion of senescent (blue) cells following Dox treatment. (B) Quantification of SA-β-Gal–positive cells (percentage of total) confirms a significant rise in senescent cell frequency in Dox-treated cultures. (C) Western blot analysis of DNA damage and senescence markers demonstrating elevated levels of p-γH2AX (Ser139), p-p53 (Ser15), total p53, and p21 in Dox-treated cells compared with those in controls. Each protein was normalized to GAPDH; bar graphs (right) represent relative protein expression. Data represent mean ± SD; p<0.05 vs. control (Tukey’s test). Different letters (a, b, c) denote groups significantly different from each other. Con, control; Dox, doxorubicin; SA-β-Gal, senescence-associated β-galactosidase; p-γH2AX, phosphorylated histone variant γH2AX; p-p53, phosphorylated p53; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SD, standard deviation.

Lipid accumulation was associated with doxorubicin-induced senescence in C2C12 cells

Metabolic reprogramming, particularly altered lipid metabolism, is a characteristic feature of senescent cells (Beloribi-Djefaflia et al., 2016; Zhang et al., 2024). Therefore, we further examined whether Dox-induced senescence was accompanied by dysregulation of lipid homeostasis and AMPK signaling. As illustrated in Fig. 5, ORO staining and western blot analysis showed that Dox treatment promoted intracellular lipid accumulation in differentiated C2C12 myotubes. ORO staining revealed abundant lipid droplets in Dox-treated cells, whereas untreated controls showed minimal staining (Fig. 5A). Quantitative analysis of extracted ORO dye confirmed that senescent, Dox-treated cells accumulated significantly higher levels of neutral lipids than did controls (Fig. 5B). To investigate the mechanism underlying this lipid accumulation, we examined the AMPK pathway, a central regulator of energy metabolism and lipid homeostasis. Dox treatment decreased p-AMPK (Thr172) levels and its downstream target p-ACC (Ser79), while total ACC levels remained largely unchanged (Fig. 5C). Because active phosphorylated AMPK suppresses lipid biosynthesis through ACC inhibition, the reduction in p-AMPK and p-ACC suggests a metabolic shift away from fatty acid oxidation toward lipid storage (Garcia and Shaw, 2017; Pundlik et al., 2024; Wang et al., 2018). Consistently, the ratios of p-AMPK/AMPK and p-ACC/ACC were significantly lower in Dox-treated cells (Fig. 5D). Furthermore, Dox exposure increased the expression of lipogenic regulators, including the mature form of SREBP-1, SCD-1, and PLIN-2, further supporting a pro-lipogenic shift (Fig. 5C) (Jensen-Urstad and Semenkovich, 2012; Li et al., 2012; Matsui et al., 2012). Together, these findings indicate that Dox-induced senescence is accompanied by metabolic reprogramming favoring lipid synthesis and storage in skeletal muscle cells, a process that may exacerbate muscle dysfunction during chemotherapy (Pundlik et al., 2024).

Fig. 5.

Fig. 5

Open in a new tab

Lipid accumulation is associated with Doxorubicin-induced senescence in C2C12 cells. (A) ORO staining shows enhanced lipid droplet formation (red) in Dox-treated myotubes compared with that in untreated controls. (B) Quantification of ORO staining intensity per cell indicates significantly greater intracellular lipid accumulation in Dox-induced senescent cells. (C) Western blot analysis showing reduced p-AMPK (Thr172) and p-ACC (Ser79), along with increased expression of lipogenic proteins SREBP-1, SCD-1, and PLIN-2 in Dox-treated cells. Total ACC and FAS levels were unchanged. (D) Quantitative analysis showing significantly reduced p-AMPK/AMPK and p-ACC/ACC ratios following Dox treatment. Data represent mean ± SD; p<0.05 vs. control (Tukey’s test). Different letters (a, b, c) denote groups significantly different from each other. Con, control; Dox, doxorubicin; ORO, Oil Red O; AMPK, adenosine monophosphate-activated protein kinase; ACC, acetyl-CoA carboxylase; SREBP-1, sterol regulatory element-binding protein 1; SCD-1, stearoyl-CoA desaturase 1; PLIN-2, perilipin-2; FAS, fatty acid synthase; SD, standard deviation.

DISCUSSION

This study demonstrates that Dox, a widely used anthracycline chemotherapeutic, disrupts skeletal muscle homeostasis through multiple coordinated mechanisms. We showed that Dox impaired myogenic differentiation, activated catabolic signaling, induced premature senescence, and reprogrammed lipid metabolism in C2C12 myogenic cells. Collectively, these findings broaden the current understanding of chemotherapy-induced muscle wasting and identify new potential therapeutic targets.

A key observation was that Dox markedly inhibited C2C12 myoblast differentiation into myotubes even at sub-cytotoxic concentrations. The expression of MyoG and MHC was suppressed despite preserved cell viability, indicating that impaired myogenesis occurs independently of cell death (Hiensch et al., 2020). Clinically, this suggests that muscle quality and regenerative capacity may decline in patients receiving anthracyclines before overt muscle mass loss becomes evident. Mechanistically, Dox reduced phosphorylation of AKT and mTOR while maintaining dephosphorylated, active forms of FOXO1/3. Active FOXO transcription factors drive the expression of the E3 ubiquitin ligases MAFbx and MuRF1, promoting proteasomal degradation of muscle proteins (Jackman and Kandarian, 2004; Stitt et al., 2004). Thus, Dox shifts the balance from protein synthesis to proteolysis, consistent with muscle catabolism observed in disuse atrophy and cachexia (Segalés et al., 2020). The AKT/FOXO axis therefore represents a critical therapeutic node that may be targeted to mitigate chemotherapy-induced muscle wasting.

Our findings also revealed that Dox perturbed the GSK3β/β-catenin signaling axis. Normally, active GSK3β phosphorylated β-catenin, marking it for proteasomal degradation. Paradoxically, Dox decreased inhibitory p-GSK3β (Ser9), implying enhanced GSK3β activity, yet simultaneously increased both total and phosphorylated β-catenin. Immunofluorescence confirmed cytoplasmic accumulation of β-catenin in atrophic myotubes, suggesting impaired degradation or compensatory stabilization of β-catenin under stress conditions. Because aberrant β-catenin signaling can activate the p53–p21 pathway and promote senescence (Kajabadi et al., 2023; Li et al., 2024a; Liu et al., 2022; Zhao et al., 2022), these alterations may contribute to the senescent phenotype observed in our model. Indeed, Dox induced classical markers of senescence, including increased SA-β-Gal activity and elevated p-γH2AX (Ser139), p-p53 (Ser15), and p21 (Bielak-Zmijewska et al., 2014; Dungan et al., 2023). Senescent cells accumulate in aged muscle, impair regeneration, and release proinflammatory factors known collectively as the senescence-associated secretory phenotype (SASP), which aggravates tissue dysfunction (Dungan et al., 2023). Although SASP components were not quantified here, their possible contribution to chronic inflammation and fibrosis in Dox-treated muscle warrants further research. A notable finding of this study is the link between Dox-induced senescence and lipid accumulation. ORO staining revealed excessive lipid droplet formation in Dox-treated myotubes. Mechanistically, Dox reduced p-AMPK (Thr172) and p-ACC (Ser79) levels while increasing the expression of lipogenic regulators, including SREBP-1, SCD-1, and PLIN-2. Because AMPK activation normally promotes fatty acid oxidation and inhibits lipogenesis, its suppression by Dox favors lipid storage and metabolic stress (Garcia and Shaw, 2017). The coexistence of senescence and lipid accumulation suggests a vicious cycle in which metabolic imbalance reinforces cellular senescence and vice versa (Hamsanathan and Gurkar, 2022; Nissinen et al., 2016; Pundlik et al., 2024). This coupling of cellular aging and metabolic reprogramming introduces a new dimension to the pathophysiology of chemotherapy-induced muscle atrophy.

These results extend those of prior studies that emphasized apoptosis or inflammation in chemotherapy-related muscle loss (Coletti, 2018; Gilliam and St Clair, 2011). Instead, our data demonstrate that premature cellular aging and metabolic dysfunction are equally critical contributors (Dungan et al., 2023; Huang et al., 2017). By integrating impaired differentiation, enhanced proteolysis, senescence, and lipid accumulation into a unified mechanistic framework, our study identifies several promising therapeutic avenues. Pharmacologic activation of AMPK, using agents such as metformin or AICAR, may restore metabolic balance, whereas senolytic therapies could selectively eliminate senescent cells. Additionally, modulation of β-catenin signaling might limit maladaptive stress responses; however, this approach must be approached cautiously given β-catenin’s dual role in both muscle regeneration and degeneration.

This study had some limitations. First, all experiments were performed in vitro using C2C12 cells, which may not fully recapitulate the systemic complexity of muscle tissue in vivo. Future animal studies are required to validate these findings. Second, SASP components were not characterized, and the direct contribution of lipid accumulation to senescence remains to be clarified. Finally, rescue experiments using pathway-specific modulators would strengthen causal links between the observed molecular events.

In conclusion, our results indicate that Dox-induced muscle atrophy involves not only inhibition of myogenic differentiation and activation of proteolysis but also premature senescence and lipid metabolic reprogramming (Fig. 6). Targeting these interrelated pathways, particularly through AMPK activation, FOXO inhibition, or senolytic strategies, may provide new therapeutic opportunities to preserve skeletal muscle integrity and improve quality of life in patients with cancer undergoing anthracycline chemotherapy.

Fig. 6.

Fig. 6

Open in a new tab

Schematic illustration of Doxorubicin-induced senescence, proteolysis, and lipid accumulation in C2C12 myoblasts. Doxorubicin inhibits AKT signaling, activating FOXO1/3 and increasing MAFbx and MuRF1 to promote proteolysis and impair myogenic differentiation. Reduced p-GSK3β stabilizes β-catenin and induces the p53–p21 senescence pathway. Concurrent suppression of AMPK decreases ACC phosphorylation and enhances lipogenic regulators, including SREBP1, SCD1, and PLIN2, leading to lipid accumulation. These coordinated defects in differentiation, senescence, and metabolism contribute to Doxorubicin-induced muscle atrophy. AKT, protein kinase B; FOXO, Forkhead box O; MAFbx, muscle atrophy F-box; MuRF1, muscle RING finger-1; GSK3β, glycogen synthase kinase-3 beta; ACC, acetyl-CoA carboxylase; AMPK, AMP-activated protein kinase; SREBP1, sterol regulatory element-binding protein 1; SCD1, stearoyl-CoA desaturase 1; PLIN2, perilipin 2.

ACKNOWLEDGMENTS

This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the Ministry of Education (2019R1A6A1A10072987). This work was also supported by the Bio & Medical Technology Development Program of the National Research Foundation (NRF), funded by the Korean government (MSIT) (RS-2025-16063709). It was also supported by a grant from the National Research Foundation of Korea (NRF), funded by the Ministry of Science and ICT (RS-2025-00558179).

REFERENCES

  1. Ajoolabady A., Pratico D., Bahijri S., Tuomilehto J., Uversky V. N., Ren J. Hallmarks of cellular senescence: biology, mechanisms, regulations. Exp. Mol. Med. 2025;57:1482–1491. doi: 10.1038/s12276-025-01480-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Beloribi-Djefaflia S., Vasseur S., Guillaumond F. Lipid metabolic reprogramming in cancer cells. Oncogenesis. 2016;5:e189. doi: 10.1038/oncsis.2015.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bielak-Zmijewska A., Wnuk M., Przybylska D., Grabowska W., Lewinska A., Alster O., Korwek Z., Cmoch A., Myszka A., Pikula S., Mosieniak G., Sikora E. A comparison of replicative senescence and doxorubicin-induced premature senescence of vascular smooth muscle cells isolated from human aorta. Biogerontology. 2014;15:47–64. doi: 10.1007/s10522-013-9477-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Byun M. R., Kim S. H., Woo R., Noh S. J., Joo S. H., Jung Y. S., Choi J. S. Quinine inhibits myogenic differentiation by disrupting AKT signaling pathway. Toxicol. Res. 2025;41:81–90. doi: 10.1007/s43188-024-00273-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chang Z. S., Wang L., Zhou J. X., Li M. X., Yang M. Y., Luo B., Liu J. J., Sun X. Y., Xia J. B. FoxO3 activation alleviates doxorubicin-induced cardiomyopathy by enhancing autophagic flux and suppressing mTOR/ROS signalling. J. Cell. Mol. Med. 2025;29:e70775. doi: 10.1111/jcmm.70775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen K., Gao P., Li Z., Dai A., Yang M., Chen S., Su J., Deng Z., Li L. Forkhead box O signaling pathway in skeletal muscle atrophy. Am. J. Pathol. 2022;192:1648–1657. doi: 10.1016/j.ajpath.2022.09.003. [DOI] [PubMed] [Google Scholar]
  7. Chen P., Jia F., Wang M., Yang S. Analysis of the mechanism of skeletal muscle atrophy from the pathway of decreased protein synthesis. Front. Physiol. 2025;16:1533394. doi: 10.3389/fphys.2025.1533394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Coletti D. Chemotherapy-induced muscle wasting: an update. Eur. J. Transl. Myol. 2018;28:7587. doi: 10.4081/ejtm.2018.7587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dungan C. M., Wells J. M., Murach K. A. The life and times of cellular senescence in skeletal muscle: friend or foe for homeostasis and adaptation? Am. J. Physiol. Cell Physiol. 2023;325:C324–C331. doi: 10.1152/ajpcell.00553.2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Faber J. G., van Herwijnen M., Hauser D., Daemen S., Caiment F., van den Beucken T. FOXO3 mediated gene expression modulates doxorubicin sensitivity in human cardiomyocytes. Toxicology. 2025;518:154267. doi: 10.1016/j.tox.2025.154267. [DOI] [PubMed] [Google Scholar]
  11. Garcia D., Shaw R. J. AMPK: mechanisms of cellular energy sensing and restoration of metabolic balance. Mol. Cell. 2017;66:789–800. doi: 10.1016/j.molcel.2017.05.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gilliam L. A., St Clair D. K. Chemotherapy-induced weakness and fatigue in skeletal muscle: the role of oxidative stress. Antioxid. Redox Signal. 2011;15:2543–2563. doi: 10.1089/ars.2011.3965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Goyal A., Afzal M., Khan N. H., Goyal K., Srinivasamurthy S. K., Gupta G., Benod Kumar K., Ali H., Rana M., Wong L. S., Kumarasamy V., Subramaniyan V. Targeting p53-p21 signaling to enhance mesenchymal stem cell regenerative potential. Regen. Ther. 2025;29:352–363. doi: 10.1016/j.reth.2025.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hamrick M. W., McGee-Lawrence M. E., Frechette D. M. Fatty infiltration of skeletal muscle: mechanisms and comparisons with bone marrow adiposity. Front. Endocrinol. 2016;7:69. doi: 10.3389/fendo.2016.00069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hamsanathan S., Gurkar A. U. Lipids as regulators of cellular senescence. Front. Physiol. 2022;13:796850. doi: 10.3389/fphys.2022.796850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hiensch A. E., Bolam K. A., Mijwel S., Jeneson J. A. L., Huitema A. D. R., Kranenburg O., van der Wall E., Rundqvist H., Wengstrom Y., May A. M. Doxorubicin-induced skeletal muscle atrophy: Elucidating the underlying molecular pathways. Acta Physiol. (Oxf.) 2020;229:e13400. doi: 10.1111/apha.13400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Huang S. C., Wu J. F., Saovieng S., Chien W. H., Hsu M. F., Li X. F., Lee S. D., Huang C. Y., Huang C. Y., Kuo C. H. Doxorubicin inhibits muscle inflammation after eccentric exercise. J. Cachexia Sarcopenia. Muscle. 2017;8:277–284. doi: 10.1002/jcsm.12148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jackman R. W., Kandarian S. C. The molecular basis of skeletal muscle atrophy. Am. J. Physiol. Cell Physiol. 2004;287:C834–C843. doi: 10.1152/ajpcell.00579.2003. [DOI] [PubMed] [Google Scholar]
  19. Jaiswal N., Gavin M., Loro E., Sostre-Colon J., Roberson P. A., Uehara K., Rivera-Fuentes N., Neinast M., Arany Z., Kimball S. R., Khurana T. S., Titchenell P. M. AKT controls protein synthesis and oxidative metabolism via combined mTORC1 and FOXO1 signalling to govern muscle physiology. J. Cachexia. Sarcopenia Muscle. 2022;13:495–514. doi: 10.1002/jcsm.12846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jensen-Urstad A. P., Semenkovich C. F. Fatty acid synthase and liver triglyceride metabolism: housekeeper or messenger? Biochim. Biophys. Acta. 2012;1821:747–753. doi: 10.1016/j.bbalip.2011.09.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jones A. E., Price F. D., Le Grand F., Soleimani V. D., Dick S. A., Megeney L. A., Rudnicki M. A. Wnt/beta-catenin controls follistatin signalling to regulate satellite cell myogenic potential. Skelet. Muscle. 2015;5:14. doi: 10.1186/s13395-015-0038-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kajabadi N., Low M., Jacques E., Lad H., Tung L. W., Babaeijandaghi F., Gamu D., Zelada D., Wong C. K., Chang C., Yi L., Wosczyna M. N., Rando T. A., Henríquez J. P., Gibson W. T., Gilbert P. M., Rossi F. M. V. Activation of β-catenin in mesenchymal progenitors leads to muscle mass loss. Dev. Cell. 2023;58:489–505.e7. doi: 10.1016/j.devcel.2023.02.009. [DOI] [PubMed] [Google Scholar]
  23. Kumari R., Jat P. Mechanisms of cellular senescence: cell cycle arrest and senescence associated secretory phenotype. Front. Cell Dev. Biol. 2021;9:645593. doi: 10.3389/fcell.2021.645593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li C. W., Yu K., Shyh-Chang N., Jiang Z., Liu T., Ma S., Luo L., Guang L., Liang K., Ma W., Miao H., Cao W., Liu R., Jiang L. J., Yu S. L., Li C., Liu H. J., Xu L. Y., Liu R. J., Zhang X. Y., Liu G. S. Pathogenesis of sarcopenia and the relationship with fat mass: descriptive review. J. Cachexia Sarcopenia Muscle. 2022;13:781–794. doi: 10.1002/jcsm.12901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li M., Ding L., Cao L., Zhang Z., Li X., Li Z., Xia Q., Yin K., Song S., Wang Z., Du H., Zhao D., Li X., Wang Z. Natural products targeting AMPK signaling pathway therapy, diabetes mellitus and its complications. Front. Pharmacol. 2025;16:1534634. doi: 10.3389/fphar.2025.1534634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li W., Gan C., Yu S., Xu J., Tang L., Cheng H. Wnt3a/GSK3β/β-catenin signalling modulates doxorubicin-associated memory deficits in breast cancer. Mol. Neurobiol. 2024a;61:5441–5458. doi: 10.1007/s12035-023-03910-x. [DOI] [PubMed] [Google Scholar]
  27. Li Y., Yan J., Yang P. The mechanism and therapeutic strategies in doxorubicin-induced cardiotoxicity: role of programmed cell death. Cell Stress Chaperones. 2024b;29:666–680. doi: 10.1016/j.cstres.2024.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Li Y., Zhang Y., Li R., Chen W., Howell M., Zhang R., Chen G. The hepatic Raldh1 expression is elevated in Zucker fatty rats and its over-expression introduced the retinal-induced Srebp-1c expression in INS-1 cells. PLoS One. 2012;7:e45210. doi: 10.1371/journal.pone.0045210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liu B., Peng Z., Zhang H., Zhang N., Liu Z., Xia Z., Huang S., Luo P., Cheng Q. Regulation of cellular senescence in tumor progression and therapeutic targeting: mechanisms and pathways. Mol. Cancer. 2025;24:106. doi: 10.1186/s12943-025-02284-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Liu J., Xiao Q., Xiao J., Niu C., Li Y., Zhang X., Zhou Z., Shu G., Yin G. Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal. Transduct. Target. Ther. 2022;7:3. doi: 10.1038/s41392-021-00762-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Matsui H., Yokoyama T., Sekiguchi K., Iijima D., Sunaga H., Maniwa M., Ueno M., Iso T., Arai M., Kurabayashi M. Stearoyl-CoA desaturase-1 (SCD1) augments saturated fatty acid-induced lipid accumulation and inhibits apoptosis in cardiac myocytes. PLoS One. 2012;7:e33283. doi: 10.1371/journal.pone.0033283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Nissinen T. A., Degerman J., Räsänen M., Poikonen A. R., Koskinen S., Mervaala E., Pasternack A., Ritvos O., Kivelä R., Hulmi J. J. Systemic blockade of ACVR2B ligands prevents chemotherapy-induced muscle wasting by restoring muscle protein synthesis without affecting oxidative capacity or atrogenes. Sci. Rep. 2016;6:32695. doi: 10.1038/srep32695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ohkawa Y., Marfella C. G., Imbalzano A. N. Skeletal muscle specification by myogenin and Mef2D via the SWI/SNF ATPase Brg1. EMBO J. 2006;25:490–501. doi: 10.1038/sj.emboj.7600943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pigg Q. W., Harris D. R., Inoue D. S., Janini Gomes M. Mitigating doxorubicin-induced skeletal muscle toxicity: a review of oxidative stress mechanisms and the therapeutic role of exercise. Antioxidants (Basel) 2025;14:45. doi: 10.3390/antiox14070870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pundlik S. S., Barik A., Venkateshvaran A., Sahoo S. S., Jaysingh M. A., Math R. G. H., Lal H., Hashmi M. A., Ramanathan A. Senescent cells inhibit mouse myoblast differentiation via the SASP-lipid 15d-PGJ(2) mediated modification and control of HRas. Elife. 2024;13:RP95229. doi: 10.7554/eLife.95229.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Saito Y., Chikenji T. S. Diverse roles of cellular senescence in skeletal muscle inflammation, regeneration, and therapeutics. Front. Pharmacol. 2021;12:739510. doi: 10.3389/fphar.2021.739510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sartori R., Romanello V., Sandri M. Mechanisms of muscle atrophy and hypertrophy: implications in health and disease. Nat. Commun. 2021;12:330. doi: 10.1038/s41467-020-20123-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Segalés J., Perdiguero E., Serrano A. L., Sousa-Victor P., Ortet L., Jardí M., Budanov A. V., Garcia-Prat L., Sandri M., Thomson D. M., Karin M., Hee Lee J., Muñoz-Cánoves P. Sestrin prevents atrophy of disused and aging muscles by integrating anabolic and catabolic signals. Nat. Commun. 2020;11:189. doi: 10.1038/s41467-019-13832-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Seo J., Kwon D., Kim S. H., Byun M. R., Lee Y. H., Jung Y. S. Role of autophagy in betaine-promoted hepatoprotection against non-alcoholic fatty liver disease in mice. Curr. Res. Food Sci. 2024;8:100663. doi: 10.1016/j.crfs.2023.100663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Stitt T. N., Drujan D., Clarke B. A., Panaro F., Timofeyva Y., Kline W. O., Gonzalez M., Yancopoulos G. D., Glass D. J. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol. Cell. 2004;14:395–403. doi: 10.1016/S1097-2765(04)00211-4. [DOI] [PubMed] [Google Scholar]
  41. Van Asbroeck B., Krüger D. N., Van, den Bogaert S., Dombrecht D., Bosman M., Van Craenenbroeck E. M., Guns P. J., van Breda E. Distinct impact of doxorubicin on skeletal muscle and fat metabolism in mice: without dexrazoxane effect. Int. J. Mol. Sci. 2025;26:789. doi: 10.3390/ijms26031177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. von Maltzahn J., Chang N. C., Bentzinger C. F., Rudnicki M. A. Wnt signaling in myogenesis. Trends Cell Biol. 2012;22:602–609. doi: 10.1016/j.tcb.2012.07.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wang D., Liu Y., Zhang R., Zhang F., Sui W., Chen L., Zheng R., Chen X., Wen F., Ouyang H.-W., Ji J. Apoptotic transition of senescent cells accompanied with mitochondrial hyper-function. Oncotarget. 2016;7:28286–28300. doi: 10.18632/oncotarget.8536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wang Q., Liu S., Zhai A., Zhang B., Tian G. AMPK-mediated regulation of lipid metabolism by phosphorylation. Biol. Pharm. Bull. 2018;41:985–993. doi: 10.1248/bpb.b17-00724. [DOI] [PubMed] [Google Scholar]
  45. Wiedmer P., Jung T., Castro J. P., Pomatto L. C. D., Sun P. Y., Davies K. J. A., Grune T. Sarcopenia - Molecular mechanisms and open questions. Ageing Res. Rev. 2021;65:101200. doi: 10.1016/j.arr.2020.101200. [DOI] [PubMed] [Google Scholar]
  46. Xue C., Chu Q., Shi Q., Zeng Y., Lu J., Li L. Wnt signaling pathways in biology and disease: mechanisms and therapeutic advances. Signal Transduct. Target. Ther. 2025;10:106. doi: 10.1038/s41392-025-02142-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Yun C., Kim S. H., Kwon D., Byun M. R., Chung K. W., Lee J., Jung Y. S. Doxorubicin attenuates free fatty acid-induced lipid accumulation via stimulation of p53 in HepG2 cells. Biomol. Ther. (Seoul) 2024;32:94–103. doi: 10.4062/biomolther.2023.200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhang F., Guo J., Yu S., Zheng Y., Duan M., Zhao L., Wang Y., Yang Z., Jiang X. Cellular senescence and metabolic reprogramming: unraveling the intricate crosstalk in the immunosuppressive tumor microenvironment. Cancer Commun. (Lond.) 2024;44:929–966. doi: 10.1002/cac2.12591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhao H., Ming T., Tang S., Ren S., Yang H., Liu M., Tao Q., Xu H. Wnt signaling in colorectal cancer: pathogenic role and therapeutic target. Mol. Cancer. 2022;21:144. doi: 10.1186/s12943-022-01616-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhou X., Li S., Wang L., Wang J., Zhang P., Chen X. The emerging role of exercise preconditioning in preventing skeletal muscle atrophy. Front. Physiol. 2025;16:1559594. doi: 10.3389/fphys.2025.1559594. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Biomolecules & Therapeutics are provided here courtesy of Korean Society of Applied Pharmacology

RESOURCES