Singapore grouper iridovirus utilizes Rab1 to facilitate viral trafficking and evade the immune response by targeting the STING-IRF3 pathway

Abstract

Background

The phylum Nucleocytoviricota comprises diverse nucleocytoplasmic large DNA viruses (NCLDVs) that infect a wide range of eukaryotic hosts, yet the mechanisms underlying their intracellular transport and immune evasion remain poorly understood. Singapore grouper iridovirus (SGIV), a representative NCLDV, is a major pathogen in marine aquaculture. Rab GTPases are central regulators of vesicular trafficking and frequent targets of viral manipulation, but their roles in SGIV infection have not been elucidated. Here, we investigated the roles of Rab1 from Epinephelus coioides (EcRab1) during SGIV infection.

Methods

Orange-spotted grouper (E. coioides) and grouper spleen (GS) cells were used in this study. The immunoblotting and qRT-PCR were used for measuring the expression of proteins and mRNAs. Viral entry and trafficking were analyzed by single-particle imaging and live-cell imaging, respectively. Immunofluorescence staining was employed to detect the location of proteins and organelle. siRNA or shRNA was used to knock down gene expression in cultured cells in vitro. The interaction between proteins was investigated by co-immunoprecipitation assay and confocal imaging.

Results

SGIV infection markedly downregulated EcRab1, and both overexpression and silencing of EcRab1 significantly altered viral replication. EcRab1 promoted viral entry and delivery to early endosomes (EEs) via interaction with Rab5, generating transient Rab1⁺/Rab5⁺ vesicles that matured into Rab5⁺ vesicles. In addition to its role in trafficking, EcRab1 maintained the structural integrity of the Golgi apparatus and mediated the transport of STING from the endoplasmic reticulum to the Golgi, thereby enhancing the production of IFN-I. SGIV counteracted these processes through the action of its protein VP20, which bound both GDP- and GTP-loaded forms of EcRab1, inhibited the association between STING and EcRab1, and prevented the localization of STING to the Golgi. Moreover, the VP20–EcRab1 complex facilitated the recruitment of IRF3 to autophagosomes for degradation, thus attenuating antiviral signaling pathways.

Conclusions

Our findings reveal that SGIV hijacks host EcRab1 to promote trafficking to early endosomes while simultaneously disrupting STING–IRF3 signaling, thereby facilitating viral replication and immune evasion. This study reveals a novel mechanism through which Rab1 contributes to large DNA virus infection and suggests that Rab1 could serve as a potential antiviral target.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12964-025-02585-2.

Introduction

To multiply, viruses must reach specific intracellular sites conducive to replication while evading detection by the host immune system. Vesicles, which are central to intracellular cargo transport and intercellular communication, play multifaceted roles in host–virus interactions. Viruses frequently exploit diverse vesicular compartments to facilitate their entry, trafficking, and assembly, whereas host cells employ distinct vesicle-mediated pathways to initiate immune responses. Moreover, viruses strategically hijack key regulatory components of vesicle trafficking to disrupt organelle dynamics and evade immune surveillance. Despite their biological significance, mechanistic insights into these processes remain limited, impeding the development of therapeutic strategies targeting vesicle-associated viral evasion mechanisms.

Rab proteins are small GTPases that act as pivotal molecular switches to regulate the formation, fusion, and transport of vesicles. Rab1, which is ubiquitously expressed, is involved in trafficking between the endoplasmic reticulum (ER) and the Golgi apparatus, Golgi structure maintenance, and autophagy, particularly the formation of autophagosomes. Like all Rabs, Rab1 cycles between active GTP- and inactive GDP-bound states [1–3]. The conformational variations between GDP-bound and GTP-bound Rab are predominantly localized to two regions: switch I and switch II. Inactive Rab proteins are bound to GDP and GDP-dissociation inhibitor (GDI) and are localized to the cytoplasm; upon approaching their target membrane, GDI is displaced by GDI displacement factor (GDF), allowing membrane insertion of the Rab protein [4, 5]. The Rab protein then interacts with a cognate guanine nucleotide exchange factor (GEF), which facilitates the replacement of GDP for GTP, activating the Rab [6]. The Rab proteins are inactivated by GTPase-activating proteins (GAPs), which catalyze the hydrolysis of GTP to GDP, allowing Rab to be removed from the membrane via its interaction with GDI [7]. These regions are conformationally flexible in the GDP-bound state, but become structurally ordered in the GTP-bound state. This conformational change facilitates the specific downstream effectors that bind to GTP-bound Rabs and enable them to perform their functional roles [8]. Rab proteins are localized to specific membrane compartments, allowing these small GTPases to direct and orchestrate many of the complex trafficking events associated with regulated exocytosis [9]. Due to its pivotal role in regulating vesicular trafficking, Rab1 is often targeted and manipulated by intracellular bacterial pathogens for inhibiting phagosome maturation [10], which has been characterized well. It has also been reported that some viruses require Rab1 for successful infection [11–13], whereas hosts use Rab1 to regulate immune responses against virus infection. However, the intricate interactions between Rab1 and viruses remain poorly understood.

The newly created phylum Nucleocytoviricota are a group of large DNA viruses that infect various eukaryotic hosts from protists to human, some viruses of which are infamous pathogens such as African swine fever virus (ASFV) and monkeypox virus, thereby posing substantial risks to biosecurity and economic development [14]. This phylum currently contains more than 10 established families such as Poxviridae, Iridoviridae, and Asfarviridae by the International Committee on Taxonomy of Viruses (ICTV), and many emerging giant viruses that have not yet been allocated to recognized taxonomic families [15–18]. Among these families, Iridoviridae stands out for containing significant pathogens of ectothermic animals. These viruses particularly infecting commercially valuable fish species like groupers, causing systemic infections with high mortality. Singapore grouper iridovirus (SGIV), isolated from diseased Epinephelus tauvina, is a novel member of the genus Ranavirus and causes more than 90% of mortality in grouper [19, 20]. As a typical large DNA virus, SGIV contains a 140,131 kb genome that encodes 162 open reading frames, providing molecular foundation for manipulating host cells to facilitate viral replication [21]. SGIV exploits clathrin-mediated endocytosis and micropinocytosis for entry, then co-opt vesicular transport systems for intracellular trafficking while evading host surveillance [22]. However, the precise mechanisms underlying SGIV trafficking remain largely unelucidated. Rab GTPases serve as key regulators of intracellular vesicle trafficking and play essential roles in coordinating cargo transport within cells. Our previous studies have implicated multiple Rab proteins (e.g., Rab5, Rab7) in SGIV infection [23, 24]. Nevertheless, the specific Rab proteins utilized by SGIV remain incompletely characterized.

Our transcriptomic data identified Rab1 as a significantly dysregulated Rab GTPase following SGIV infection. Consequently, this study elucidates the dual role of Rab1 in SGIV infection in E. coioides. Our findings demonstrate that SGIV downregulates Rab1 expression both in vitro and in vivo, likely to counteract its immune-enhancing functions that potentiate host defense. Paradoxically, Rab1 is essential for SGIV replication by facilitating viral entry and trafficking to early endosomes (EEs) via the Rab1–Rab5 interaction. Moreover, SGIV VP20 competitively binds Rab1, hijacking it to disrupt the STING–TBK1–IRF3 signaling pathway and shuttle IRF3 into autophagosomes for degradation—thereby effectively subverting interferon responses. Our study thus not only elucidates the intricate dual role of Rab1 in SGIV infection but also provides new insights into understanding how large DNA viruses manipulate host machinery to balance their life cycle and counteract immunity.

Materials and methods

Animals, cells and viruses

A total of 200 orange spotted groupers (E. coioides) with an average weight of 16.5 ± 3.4 g were sourced from a fish farm in Hainan Province and acclimated for two weeks in a laboratory with a circulating water system set at 27 °C and 30 ppt prior to the experiment. Only fish that were visibly healthy and active were selected for the studies. Grouper spleen (GS) cells, which have been previously used to study transcription factor functions in marine fish, were constructed in the laboratory [25]. The GS cells were grown in Gibco’s L-15 medium with 10% fetal bovine serum (Gibco, USA) and maintained in incubators at 28 °C [26]; the SGIV was initially isolated in the laboratory and propagated in GS cells [19]; and the virus stocks were stored at –80 °C until used. Each fish received an intraperitoneal injection of 100 μL of SGIV (1 × 10⁶ TCID₅₀/mL) [27, 28].

EcRab1 expression patterns

The groupers were injected with 100 μL of 10⁶ TCID₅₀/mL SGIV to examine the EcRab1 expression pattern in vivo. Control infection was carried out using phosphate-buffered saline (PBS). All the fish were anesthetized using eugenol (1:10,000), dissected, and their tissues were harvested, rapidly frozen in liquid nitrogen, and stored at −80 °C. Samples were collected at various time points (0, 12, 24, 36, and 48 hpi) for subsequent qRT-PCR analysis. EcRab1 expression in vitro following SGIV stimulation was examined after seeding GS cells in 24-well plates and leaving them overnight. They were infected with SGIV at an MOI of 1, and samples were taken at various time points (0, 12, 24, 36, and 48 hpi) for qRT-PCR analysis. Table 1 shows the primers used for the qRT-PCR.

Table 1.

Primers used in qRT-PCR

Targeted sequence (5'−3')
Actin-RT-F: TACGAGCTGCCTGACGGACA	Actin-RT-R: GGCTGTGATCTCCTTCTGCA
EcRab1-RT-F: CCGCACCATCACGTCCAGTTAC	EcRab1-RT-R: CGATCTCCTGTAGCCACTGTTTGAC
SGIV-MCP-RT-F: GCACGCTTCTCTCACCTTCA	SGIV-MCP-RT-R: AACGGCAACGGGAGCACTA
SGIV-VP19-RT-F: TCCAAGGGAGAAACTGTAAG	SGIV-VP19-RT-R: GGGGTAAGCGTGAAGAC
SGIV-ICP18-RT-F: ATCGGATCTACGTGGTTGG	SGIV-ICP18-RT-R: CCGTCGTCGGTGTCTATTC
SGIV-LITAF-RT-F: GATGCTGCCGTGTGAACTG	SGIV-LITAF-RT-R: GCACATCCTTGGTGGTGTTG
SGIV-ICP46-RT-F: ACTCCGCCAGAATACGTTCG	SGIV-ICP46-RT-R: GGCAGAGAGCCAAGACACAT
EcIFN1-RT-F: GTGTCCTTCCCGAATCATCT	EcIFN1-RT-F: ACAGCCTGCCTGCTTACAAC
EcIRF3-RT-F: GACAACAAGAACGACCCTGCTAA	EcIRF3-RT-R: GGGAGTCCGCTTGAAGATAGACA
EcMYD88-RT-F: AGCTGGAGCAGACGGAGTG	EcMYD88-RT-R: GAGGCTGAGAGCAAACTTGGTC
EcSTAT1-RT-F: ACCAGTCGGGACTCAACATC	EcSTAT1-RT-R: GAACCTCGGACAGCTGAGAC
EcISG15-RT-F: GGGTGTCCCTGCTGGTGAT	EcISG15-RT-R: CTCTCTGCCCTGGTGAATGAG
EcISG56-RT-F: CAGGCATGGTGGAGTGGAAC	EcISG56-RT-R: CTCAAGGTAGTGAACAGCGAGGTA
EcIFP35-RT-F: TTCAGATGAGGAGTTCTCTCTTGTG	EcIFP35-RT-R: TCATATCGGTGCTCGTCTACTTTCA
EcMXI-RT-F: CGAAAGTACCGTGGACGAGAA	EcMXI-RT-R: TGTTTGATCTGCTCCTTGACCAT
EcIFITM1-RT-F: CTGCTGCTGTGGCTTGTT	EcIFITM1-RT-R: ACACGGATGAGTTCCCTTT

Antibodies and reagents

The antibodies, including rabbit anti-GFP (catalog no. AB290), rabbit anti-Rab1 (catalog no. AB302545), rabbit anti-p62 (catalog no. AB109012), and rabbit anti-β-tubulin (catalog no. AB15568) were obtained from Abcam (Cambridge, UK); the rabbit anti-LC3A/B (catalog no. 12741), rabbit anti-HA (catalog no. 3724), rabbit anti-ATG5 (catalog no. 12994) and mouse anti-HA (catalog no. 2367) were obtained from Cell Signaling Technology (Danvers, MA, USA); and the mouse anti-Flag (catalog no. F1804) was purchased from Sigma-Aldrich (St Louis, MI, USA). Our laboratory prepared the SGIV polyclonal anti-MCP antibody. Invitrogen (Waltham, MA, USA) supplied the secondary goat anti-rabbit IgG H&L antibodies (catalog no. A-11008) and goat anti-mouse IgG H&L antibodies (catalog no. A11003). MedChem Express (Monmouth Junction, NJ, USA) supplied the proteasome inhibitor MG132 (HY-13259), the autophagy inhibitor 3-MA (HY-19312), and the apoptosis inhibitor Z-VAD-FMK (HY-16658B); and Invitrogen supplied the Lyso-Tracker (Red DND-99). The DAPI, Hoechst 33342, and Rap came from Sigma-Aldrich. ISD and 2′3′-cGAMP were purchased from InvivoGen (San Diego, CA, USA). Invitrogen supplied the fluorescent label Alexa Fluor 647 fluorescent label and 4% paraformaldehyde, while Biotium (Fremont, Ca, USA) supplied the lipophilic dye DiO. The sequence for the labeled siRNA-EcRab1 is shown in Table 2 and was synthesized by Sangon Biotech (Shanghai, China).

Table 2.

Targeted sequences of siRNA

Targeted gene		Targeted sequence (5'−3')
EcRab1	NC	UUCUCCGAACGUGUCACGU
	siRNA	CCAAGGAAUUUGCCGACAA

Construction of plasmids

The recombinant plasmids pHA-EcRab1 and pEGFP-EcRab1 and the virus gene plasmid VP20 had been previously constructed (ORF020L, GenBank accession no. YP_164115.1) [29]. The mutant plasmids pEGFP-DN EcRab1 (Rab1 S22N) and pEGFP-CA EcRab1 (Rab1 Q67L) were constructed by mutating the serine codon (S) at position 22 of EcRab1 to asparagine (N) and the glutamine codon (Q) at position 67 to leucine (L) using a V2 Rapid Mutagenesis kit (Vazyme, Nanjing, China) [30]. The recombinant plasmids: pEGFP-EcRab5, pmCherry-EcRab5, pHA-TBK1, pHA-cGAS, pHA-STING, pHA-IRF3, pmCherry-STING, pmCherry-IRF3, pmCherry-TBK1, pmCherry-C1, pEGFP-C1 and pcDNA3.1–3 × HA were maintained in the laboratory [24, 28, 31]. The STING domain interacting with EcRab1 was defined by subcloning the STING domain into pEGFP-C1 to obtain the pEGFP-STING-N, pEGFP-STING-TM, pEGFP-STING-LBD, and pEGFP-STING-C plasmids. In addition, the ATG5 DNA coding sequence was cloned into the pSilencer 2.1-U6 hygro vector. The primers are listed in Table 3.

Table 3.

Primers used for vector construction

Targeted sequence (5'−3')
pEGFP-EcSTING-N-EcoRI-F: tcgagctcaagcttcgaattcATGCAGTGCCTCCAAGATCAG
pEGFP-EcSTING-N-KpnI-R: ggatcccgggcccgcggtaccTTAAAATAACATTTCAGGAGACAGAAACA
pEGFP-EcSTING-TM-EcoRI-F: tcgagctcaagcttcgaattcATGGGATGGGTTGCCATGG
pEGFP-EcSTING-TM-KpnI-R: ggatcccgggcccgcggtaccTTACTTCCTCCCCTCACAGATGTC
pEGFP-EcSTING-LBD-EcoRI-F: tcgagctcaagcttcgaattcATGAACGTGGCCCACGGC
pEGFP-EcSTING-LBD-KpnI-R: ggatcccgggcccgcggtaccTTACTCCTGCTGCTGCAGGTG
pEGFP-EcSTING-C-EcoRI-F: tcgagctcaagcttcgaattcATGAAAGAGGAGTTCTGCCTCACT
pEGFP-EcSTING-C-KpnI-R: ggatcccgggcccgcggtaccTTATATTCTTCCTTGATAATGGTCGG
pSilencer-EcATG5-BamHI-F: tgtggaaaggacgcgggatccGCAGAAGAAAGATCATAAATTCAAGAG
pSilencer-EcATG5-HindIII-R: acgacggccagtgccaagcttAAAAAGCAGAAGAAAGATCATAAATCTC

Virus infection assay

The impact of EcRab1 on viral infection was assessed by growing GS cells in 24-well plates that had been transfected with pEGFP-C1, pEGFP-EcRab1, NC, or siRNA-EcRab1. The cells were incubated with SGIV at an MOI of 1 and the cytopathic effects were observed at 24 hpi under an inverted light microscope. The cells were subsequently collected for RNA extraction and western blotting.

Total RNA isolation and qRT-PCR analysis

An SV Total RNA Isolation kit (Promega, Madison, WI, USA) was used to extract the total RNA and a ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan) was used to synthesize the cDNA. A qRT-PCR was conducted using an Applied Biosystems QuantStudio 5 Real Time Detection System (Thermo Fisher, Waltham, MA, USA) to assess the transcript levels of the host and viral genes. The qRT-PCR conditions were an initial step at 95 °C for 30 s, followed by 40 cycles consisting of 5 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. The results were normalized to the housekeeping gene β-actin to determine relative expression. Relative gene expression was assessed using the 2^−ΔΔCt approach.

Western blotting

The cells were harvested and lysed in RIPA lysis buffer after being rinsed three times with ice-cold PBS. Protease and phosphatase inhibitors were then added and the samples were incubated on ice for 30 min. The samples were then centrifuged at 13,000 rpm at 4 °C for at least 15 min. The isolated proteins were resolved using 10% SDS-PAGE and subsequently transferred onto 0.22 μm polyvinylidene difluoride (PVDF) membranes (ISEQ00010, Millipore, Burlington, MA, USA). The membranes were then blocked with 5% (wt/vol) skimmed milk in tris-buffered saline containing 0.5% Tween 20 (TBST) and incubated with one of the following primary antibodies: anti-GFP (1:3,000), anti-HA (1:3,000), anti-Flag (1:3,000), anti-SGIV major capsid protein (MCP) (1:2,000), anti-Rab1 (1:2,000), anti-LC3A/B (1:2,000), anti-p62 (1:2,000), anti-ATG5 (1:2,000) or anti-β-tubulin (1:3,000), for 2 h. The membranes were then washed five times with tris-buffered saline containing TBST and incubated with horse-radish peroxidase (HRP)-labeled goat anti-mouse or rabbit IgG antibody at room temperature for 2 h. After five washes with TBST, the immunoreactive bands were visualized with an ECL reagent and imaged using a chemiluminescence imaging system. ImageJ v7.0 software and the grayscale ratio of the target protein to β-tubulin were used to quantify the protein levels.

Co-immunoprecipitation (Co-IP) assay

A total of 12 μg of the relevant plasmid was co-transfected into GS cells. The culture medium was removed at 48 hpi and the cell monolayers were washed twice with ice-cold PBS. The cells were lysed in RIPA lysis buffer and the resulting whole-cell lysates (WCLs) were centrifuged at 12,000 × g for 3 min at 4 °C, after which the supernatants were collected for immunoprecipitation using a Co-IP kit (catalog numbers P2181S/P2185S; Beyotime Institute of Biotechnology, Nanjing, China) according to the manufacturer’s instructions [32]. The samples were washed with TBS more than five times, and potentially associated proteins were tested by western blotting using different antibodies.

Subcellular localization

The subcellular localization of EcRab1 was determined by culturing GS cells in 35 mm glass-bottom cell culture dishes and co-transfecting them with 0.6 μg of pEGFP-EcRab1 and 0.6 μg of either pDsRed2-ER, pDsRed2-Mito, or pDsRed2-Golgi (Clontech, San Jose, CA, USA) for 48 h. The transfection procedure used Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. The GS cells were also transfected with 1.2 μg pEGFP-EcRab1 for 48 h, followed by staining with Lyso-Tracker Red DND-99 (1:1,000 dilution; Invitrogen) for 30 min. Subsequently, the cells were stained with 4',6-diamidino-2-phenylindole (DAPI) for 5 min and the stained cells were examined using a confocal microscope.

Indirect immunofluorescence assay (IFA)

EcRab1 associations with key molecules in the cGAS/STING signaling pathway (including cGAS, STING, TBK1, and IRF3), 0.6 μg of pHA-cGAS, pHA-STING, pHA-TBK1, pHA-IRF3 and 0.6 μg of pEGFP-EcRab1 were co-transfected into GS cells for indirect immunofluorescence assay. In brief, the GS cells were fixed 48 h after transfection and underwent permeabilization and blocking with 0.2% bovine serum albumin (BSA; Sigma Aldrich). A 1:100 dilution of the primary antibody targeting HA was prepared in 0.2% BSA and left at room temperature for 2 h. The cells were washed three times with PBS, treated with Alexa Fluor 555-labeled anti-rabbit IgG Fab2 (1:100) for 2 h, stained with DAPI, and then visualized using confocal microscopy.

Virus purification and fluorescence labeling

The SGIV was purified and fluorescence labeled. Then, GS cell monolayers were infected with SGIV at an MOI of 0.1. The SGIV particles were harvested using repeated freeze–thaw cycles and centrifuged at 12,000 × g for 30 min at 4 °C using a Beckman Allegra X-15R centrifuge (Beckman Coulter, Brea, CA, USA). The supernatant was then ultracentrifuged at 200,000 × g for 1 h at 4 °C with a Beckman 70 Ti rotor. the resulting pellet was resuspended in TN buffer (50 mM tris–HCl, 150 mM NaCl, pH 7.5), applied to a sucrose gradient (30–60%, wt/vol), and ultracentrifuged at 150,000 × g for 1 h at 4 °C using a Beckman SW 40 rotor. The purified viral band was isolated in TN buffer, ultracentrifuged at 100,000 × g for 1 h at 4 °C, resuspended in TN buffer, and stored at –80 °C until needed. The fluorescence labeling process involved incubating the SGIV particles with Alexa Fluor 647 in PBS at room temperature for 2 h with gentle vortexing. Unbound dye was eliminated after three high-speed centrifugation steps at 14,000 × g for 1 h at 4 °C using a Beckman Microfuge 20R centrifuge. The labeled virus was subsequently visualized using a transmission electron microscope and stored at 4 °C.

SGIV internalization assay

Viral internalization assays were performed by quantifying the SGIV particles at the cell periphery and within the cytoplasm. Specifically, GS cells transfected with either NC or siRNA-EcRab1 were exposed to Alexa-Fluor 647-labeled SGIV at an MOI of 10 for 1 h at 4 °C. The internalization assay was initiated by quickly moving the cells to a 28 °C environment to start the infection process. They were then fixed at 1 h after infection and examined using confocal microscopy. A random sample of approximately 90 cells was analyzed [24].

Confocal microscopy and single-particle imaging assay

The fluorescent images were captured using a Leica STELLARIS 5 confocal microscope (Leica, Wetzlar, Germany). The EGFP and DiO signals were excited with a 488 nm Ar-Kr laser and a 500–550 nm bandpass filter was used to filter the emissions. A laser with a wavelength of 533 nm was used to excite the Cy3 signal and a bandpass filter ranging from 540–590 nm was used to filter the emissions. The Alexa Fluor 647 signal was excited with a 633 nm helium neon laser and the emissions were filtered through a 650–700 nm bandpass filter. The results were visualized using a 100 × oil immersion objective, and image stacks with a z-step size of 200 nm were acquired. For single-particle imaging, images of different fixed samples were captured. Then, MATLAB was used to process the images by filtering out noise, detecting edges, and extracting fluorescent signals to quantify different channels, enabling the identification of SGIV particles on the cell membrane or in the cytoplasm. For live-cell imaging, the culture was placed on a confocal microscope, and real-time imaging was initiated immediately after adding SGIV to the cells.

Molecular docking

The 3D structures of STING, EcRab1, DN EcRab1, CA EcRab1 and VP20 were predicted and illustrated using PyMol (Schrödinger, LLC; Version 3.1.0a0; Schrödinger Inc., New York, NY, USA) and Alpha Fold 3 [33, 34]. The docking results were used to select the optimal binding conformations for Rab1-STING/VP20-DN EcRab1/VP20-CA EcRab1 based on the lowest energy score and PyMol was used to visualize the results.

Statistical analysis

All experiments were repeated at least three times, and data are presented as mean ± standard error of the mean (SEM). Two-tailed Student’s t-tests (either paired or unpaired) were used to assess any differences between two groups, while a one-way ANOVA followed by a post-hoc analysis using Tukey’s multiple comparisons test was used to compare values among multiple groups. Pearson’s correlation coefficient was used to analyze the correlations. GraphPad Prism 10 (GraphPad Software Inc, Boston, MA, USA) was used for data plot and statistical analysis. Statistically significant differences are indicated (*p < 0.05).

Results

EcRab1 significantly affected SGIV infection

Firstly, the expression pattern of endogenous EcRab1 during SGIV infection was examined. As shown in Fig. 1A and B, EcRab1 transcription significantly downregulated after SGIV infection both in vivo and in vitro. Correspondingly, EcRab1 protein levels were markedly reduced (Fig. 1C). Moreover, EcRab1 colocalized with fluorescently labeled SGIV at the early stage of virus infection, and prominently surrounded viral factories during the late phase of SGIV infection (Fig. 1D).

Fig. 1.

SGIV infection specifically downregulates EcRab1 expression both in vivo and in vitro. A-B EcRab1 transcript levels were analyzed in vivo (A) and in vitro (B) at different time points after infection with SGIV. Grouper spleen (GS) tissues and cells were infected with SGIV, and collected at 0, 12, 24, 36, and 48 hpi for qRT-PCR. C EcRab1 and viral protein levels were detected at different times post SGIV infection. GS cells were infected with SGIV (MOI = 1), and collected at 0, 6, 12, 24, and 48 hpi for western blotting. β-tubulin was used as the internal control. D EcRab1 distribution pattern after SGIV infection. GS cells were transfected with pEGFP-EcRab1, and incubated with Alexa-Fluor 647 labeled SGIV for 1 h, followed by fixation for imaging the samples at the early stage of viral infection. Moreover, GS cells transfected with pEGFP-EcRab1 were infected with SGIV (MOI = 10) and fixed at 24 hpi for imaging the samples at the late stage of viral infection. The nucleus and virus factory were stained by DAPI. White arrows indicate viral factory. Scale bars represent 5 µm. The Rab1:β-tubulin ratio was statistically analyzed. Data are presented as mean ± SEM (n = 3). Statistically significant differences are indicated (*p < 0.05)

Second, we investigated whether EcRab1 affects SGIV infection. Overexpression of EcRab1 significantly accelerated the severity of SGIV-induced cytopathic effect (CPE) at 24 h post-infection (h.p.i.), compared to the control cells (Fig. 2A). Moreover, viral gene transcription levels, including major capsid protein (MCP), SGIV ORF019R (VP19), lipopolysaccharide induced TNF-α factor (LITAF), SGIV ORF086R (ICP18) and infected cell polypeptide 46 (ICP46) were significantly increased in EcRab1-overexpressing cells (Fig. 2B). Further Western blot analysis confirmed that SGIV MCP expression significantly increased in EcRab1-overexpressing cells (Fig. 2C). In addition, knockdown of EcRab1 obviously decelerated CPE formation, viral gene transcription, and MCP expression (Fig. 2D–F). It also significantly impaired SGIV uptake, reducing internalized virus particles by approximately 50% (Fig. 2G and H). Collectively, these findings demonstrate a significant role for EcRab1 in regulating SGIV infection.

Fig. 2.

Impact of EcRab1 on SGIV infection. A-C Overexpression of EcRab1 promotes the CPE (A), viral genes transcription (B), and viral protein expression (C). GS cells were transfected with pEGFP-C1 or pEGFP-EcRab1 respectively, and then infected with SGIV (MOI = 1) for 24 h. The CPEs were observed under an inverted light microscope, and indicated by white arrows. Scale bar represents 50 μm. Meanwhile, the infected cells were harvested to evaluate the mRNA and protein levels of SGIV by qRT-PCR and western blotting, respectively. Proteins intensities were quantified using Image J software and normalized to the expression of β-tubulin. D-E EcRab1 Knockdown significantly inhibited the CPE (D), viral genes transcription (E), and viral protein expression (F). GS cells were transfected with siRNA-EcRab1 or NC, and infected with SGIV (MOI = 1) for 24 h, followed by observation for CPEs and samples were collected for qRT-PCR and western blotting. The CPEs are indicated by white arrows, and the scale bars is 50 μm. G Knockdown of EcRab1 reduces internalized SGIV particles. After transfection with NC or siRNA-EcRab1, GS cells were incubated with Alex-Fluor 647 labeled SGIV for 20 min at 4 °C and then transferred to 28 °C to initiate infection. They were then fixed at 1 hpi. Cell boundaries were visualized by DiO staining (green signals). Scale bars represent 5 µm. Over 90 cells were randomly selected and analyzed by MATLAB program. SGIV uptake was quantified as the percentage of internalized virus particles in siRNA-EcRab1 transfected cells relative to that of NC transfected cells. The value of control cells was arbitrarily set as 100%. H EcRab1 knockdown inhibits viral genes transcription at 4 hpi. GS cells transfected with NC or siRNA-EcRab1 were incubated with SGIV for 1 h at 4 °C and then transferred to 28 °C environment. Cells were collected at 4 hpi for qRT-PCR analysis to determine the mRNA levels of ICP-18, VP19 and MCP. The statistical analysis of MCP:β-tubulin ratio was performed. Data are presented as mean ± SEM (n = 3). Statistically significant differences are indicated (*p < 0.05)

EcRab1 facilitates SGIV transport to early endosomes by interacting with Rab5

Upon internalization, SGIV is translocated to EEs [24, 35]. Therefore, the EcRab1 influence on this process was further investigated. As shown in Fig. 3A, EcRab1 knockdown markedly inhibited the colocalization of SGIV particles with EEs, which suggested that there was a relationship between EcRab1 and EEs. However, previous studies have reported that Rab1 is involved in the endoplasmic reticulum (ER) to Golgi transport system [36]. To elucidate the detailed function of EcRab1, we investigated the colocalization of EcRab1 and different cellular structure. As shown in Fig. 3B, EcRab1 obviously colocalized with Golgi apparatus, EEs, and LEs and partially colocalized with the ER and lysosomes. In contrast, no colocalization was observed between EcRab1and mitochondria. These results suggested that EcRab1 was involved in regulating EEs.

Fig. 3.

Influence of EcRab1 on virus trafficking to EEs. A EcRab1 knockdown affects the transport of SGIV to EEs. GS cells co-transfected with pEGFP-EcRab5 and NC or siRNA-EcRab1 were incubated with Alex-Fluor 647-labeled SGIV at 4 °C for 20 min, transferred to 28 °C, and then fixed for 1 h. Scale bar is 5 µm. Over 90 cells were analyzed by MATLAB program. Data are the mean ± SEM and statistical differences (p < 0.05) are indicated by an *. B Colocalization of EcRab1 with various organelles. GS cells were seeded into glass bottom dishes (35 mm) and co-transfected with pEGFP-EcRab1 and pDsRed2-Golgi, pDsRed2-ER, pDsRed2-Mito, pDsRed2-EE or pDsRed2-LE, respectively. After staining with DAPI for 5 min, cells were imaged under confocal microscope. GS cells were also transfected with pEGFP-EcRab1 for 24 h and stained with Lyso-Tracker (1:1,000) for 30 min. After staining with Hoechst 33342 for 10 min, images of the cells under confocal microscope were obtained. The fluorescent intensity along the white line was analyzed for co-localization. The Pearson’s correlation coefficients for these confocal fields of view were assessed using LAS X software, with “r” denoting the PCC value showing co-localization. Scale bars are 5 µm

Dominant-negative (DN) EcRab1 (Rab1; S22N) and constitutively active (CA) EcRab1 (Rab1; Q67L) mutants were used to investigate whether EcRab1 activation affected EEs formation. Figure 4A shows that the EEs were enlarged in cells overexpressed CA EcRab1, and nearly disappeared in the cells that overexpressed DN EcRab1. Furthermore, SGIV MCP expression was promoted by CA EcRab1, but inhibited by DN EcRab1 (Fig. 4B). Subsequent analysis revealed a notable reduction in both the size and number of EEs after knockdown of EcRab1 (Fig. 4C). Moreover, co-immunoprecipitation (Co-IP) showed that there was an interaction between EcRab1 and EcRab5 (Fig. 4D). The dynamic regulation of SGIV transportation to EEs by EcRab1 was investigated using single particle tracking. Initially, SGIV particles were located in the EcRab1⁺ vesicle. Subsequently, EcRab5 was recruited to the membrane EcRab1⁺ vesicle on SGIV to form a EcRab1⁺/EcRab5⁺ vesicle. Over time, EcRab1 progressively dissociated from the vesicle, which facilitated SGIV transfer into EcRab5⁺ vesicles (Fig. 4E). An additional movie file shows this in more detail (see Additional file 1 and 2). Hence, these results showed that EcRab1 regulated EEs formation by interacting with EcRab5, which subsequently affected SGIV trafficking to EEs.

Fig. 4.

EcRab1 effects on EEs formation and virus trafficking. A Impact of EcRab1 mutants on EEs. GS cells were transfected with EcRab1, CA EcRab1 or DN EcRab1, incubated with SGIV (MOI = 1) for 24 h, and then fixed for immunofluorescence staining using anti-MCP antibody. Nucleus were stained with DAPI and the EcRab5 and SGIV-MCP fluorescence intensities were quantitatively analyzed by LAS X software. Scale bars are 5 μm. B Impact of EcRab1 mutants on SGIV infection. GS cells were transfected with EcRab1, CA EcRab1 and DN EcRab1 respectively, incubated with SGIV (MOI = 1) for 24 h, and then fixed for western blotting. The intensities of the proteins were quantified using Image J software and normalized to the expression of β-tubulin. C EcRab1 affects EE formation. GS cells were transfected with pEGFP-EcRab5 and NC or siRNA-EcRab1, fixed, and observed under a fluorescence confocal microscope. The quantitative signals from EcRab5 were analyzed by LAS X software. Scale bars are 5 μm. D EcRab1 interacts with EcRab5. GS cells were co-transfected with pEGFP-EcRab5 and pHA-EcRab1 or the empty vector for 48 h. Cell lysates were immunoprecipitated with anti-GFP using a Dynabeads Protein G Immunoprecipitation kit. Then the immunoprecipitates and whole cell lysates (WCLs) were analyzed by western blotting with anti-GFP, anti-HA, and anti-β-tubulin. E Real-time tracking of EcRab1-positive vesicles carrying SGIV to EEs. GS cells were transfected with pEGFP-EcRab1 and pDsRed2-EcRab5 for 24 h, then incubated with Alex-Fluor 647-labeled SGIV, and immediately imaged under a confocal microscope. Black arrows indicate the dynamic SGIV transportation process from EcRab1-positive vesicles to EEs and red, green, and purple fluorescent signals represent SGIV, EcRab1, and EcRab5, respectively. Scale bar is 5 µm. The statistical analysis of MCP:β-tubulin ratio was performed. Data are presented as mean ± SEM (n = 3). Statistically significant differences are indicated (*p < 0.05)

EcRab1 interacts with VP20 and targets STING in the cGAS-STING pathway

SGIV VP20, which interacts with EcRab1, was identified to further elucidate the molecular mechanism underlying the interaction between SGIV and EcRab1 (Fig. 5A and B). As shown in Fig. 5A, VP20 exhibited a vesicular pattern within the cytoplasm, and co-localized with EcRab1. Co-IP assays confirmed the interaction between VP20 and EcRab1 (Fig. 5B). Previous studies have reported that VP20 could attenuate the host IFN response via the TBK1-IRF3 signaling pathway [29]. Therefore, the SGIV might evade the immune system by modulating the IFN response through VP20-mediated exploitation of EcRab1. First, we examined whether EcRab1 influences IFN expression. Figure 5C shows that interferon stimulatory DNA (ISD) induced a significant increase in the transcription of IFN-related genes, an effect that was markedly impaired following EcRab1 knockdown. This suggested that EcRab1 was involved in the DNA-mediated innate immune response. Next, we investigated potential targets of EcRab1 within the cGAS-STING pathway. Upon EcRab1 knockdown, overexpression of TBK1 or IRF3 still upregulated IFN-I expression, whereas ISD, cGAS, and STING failed to induce IFN-I activation (Fig. 5D), which suggested that cGAS and STING were the potential targets for EcRab1. Cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) was generated by cGAS and activated STING [37]; therefore the cGAMP ability to activate IFN-I expression after EcRab1 knockdown was investigated. As shown in Fig. 5E, even exogenous cGAMP failed to restore IFN-I expression after EcRab1 knockdown. Moreover, EcRab1 strongly colocalized with STING but not with cGAS, with Pearson’s correlation coefficients (PCC) of 0.84 and 0.11, respectively (Fig. 5F). Co-IP analysis further confirmed the physical interaction between STING and EcRab1 (Fig. 5G and H).

Fig. 5.

EcRab1 interacts with SGIV VP20 and mediates STING activation. A Colocalization of VP20 and EcRab1. GS cells were co-transfected with pEGFP-VP20/pEGFP-C1 and pHA-EcRab1, pmCherry-VP20/pmCherry-C1 and pEGFP-EcRab1, and then fixed for IFA analysis. Scale bar is 5 μm. B EcRab1 interacts with VP20. GS cells were co-transfected with pEGFP-VP20 and pHA-EcRab1or the empty vector for 48 h, and collected for Co-IP analysis. C EcRab1 positively regulates the DNA-stimulated interferon pathway. The IFN-I, IRF3, MYD88, ISG15, ISG56, IFP35 and MXI mRNA levels were determined by qRT-PCR. GS cells were transfected with NC or siRNA-EcRab1 for 12 h, and then transfected with ISD. The cells were collected for qRT-PCR analysis. D EcRab1 has no effect on IFN expression induced by TBK1 and IRF3. GS cells were transfected with ISD, cGAS, STING, TBK1 and IRF3 after knocking down EcRab1. The IFN-I mRNA levels were determined by qRT-PCR. E knockdown of EcRab1 inhibits cGAMP-induced IFN expression. GS cells were transfected with different concentrations of cGAMP after knockdown of EcRab1, and were collected for qRT-PCR analysis. F EcRab1 colocalizes with STING rather than cGAS. GS cells were co-transfected with pEGFP-EcRab1 and pHA-cGAS or pHA-STING, and then fixed for IFA analysis. The PCC (r) was used to analyze the fluorescent intensity along the white line using LAS X software. Scale bars are 5 µm. G There is no interaction between EcRab1 and cGAS. GS cells were co-transfected with pEGFP-EcRab1 and pHA-EcRab1 or the empty vector for 48 h, and collected for Co-IP analysis. H EcRab1 interacts with STING. GS cells were co-transfected with pEGFP-EcRab1 and pEGFP-STING or the empty vector for 48 h, and collected for CO-IP analysis. I Modeling of the STING/EcRab1 complex. Left: STING (blue) binds to EcRab1 (pink). Right: Detailed interaction of STING (blue) binding to EcRab1 (pink). The residues of binding region are labeled and hydrogen bonds are indicated by dashed lines. J EcRab1 binds to the C-terminal domain of STING. Schematic diagram of domains of STING is listed, and each domain is cloned to pEGFP-C1. GS cells were co-transfected with each domain of STING and pHA-EcRab1 for 24 h, and then collected for Co-IP analysis. K The C-terminal domain on STING co-localizes with EcRab1. GS cells were co-transfected with each domain of STING and pHA-EcRab1 for 24 h, and then fixed for IFA analysis. Scale bars are 5 µm. Quantification of the co-localization rate of STING mutants and EcRab1 via LAS X software. Data are presented as mean ± SEM (n = 3). Statistically significant differences are indicated (*p < 0.05)

Molecular docking simulations revealed that the STING/EcRab1 complex was relatively stable and that the C-terminal domain of STING constituted the critical interaction interface (Fig. 5I). STING contains four functional domains: an N-terminal domain, a transmembrane (TM) domain, a ligand-binding domain (LBD), and a C-terminal domain. To identify the specific domain responsible for the interaction with EcRab1, various truncated STING constructs encompassing individual domains were generated and subjected to Co-IP assays. Among these, only the C-terminal domain was capable of binding EcRab1 (Fig. 5J), and confocal fluorescence imaging confirmed this finding (Fig. 5K). These results indicate that EcRab1 targets STING within the cGAS-STING signaling pathway by directly interacting with its C-terminal domain.

SGIV VP20 hijacks EcRab1 to inhibit STING activation

STING requires translocation from the ER to the Golgi apparatus for its activation [38]. Given the established role of Rab1 in vesicular transport from the ER to the Golgi apparatus [11, 39, 40], we hypothesized that EcRab1 may facilitate the ER-to-Golgi trafficking of STING. As expected, obvious colocalization of EcRab1, STING, and Golgi was observed (Fig. 6A). Knockdown of EcRab1obviously impaired the formation of Golgi bodies (Fig. 6B). Notably, EcRab1 knockdown markedly decreased the colocalization of STING with the Golgi apparatus, with a reduction in PCC from 0.87 to 0.39. Furthermore, STING was blocked in the ER (Fig. 6C), which suggested that EcRab1 was involved in STING translocation.

Fig. 6.

VP20 competes with STING to bind EcRab1. A EcRab1 co-localizes with STING in the Golgi apparatus. GS cells were transfected with pEGFP-STING, pHA-EcRab1 and pDsRed2-Golgi, and then fixed for IFA analysis. Scale bars represent 5 μm. B EcRab1 affects the Golgi structure. GS cells were transfected with pDsRed2-Golgi and NC or siRNA-EcRab1, and then fixed for staining. The flourescent signals were analyzed by LAS X software. Scale bars represent 5 μm. C EcRab1 affects STING transport to the Golgi apparatus. GS cells were transfected with pEGFP-STING/pDsRed2-Golgi/NC, pEGFP-STING/pDsRed2-Golgi/siRNA-EcRab1, pEGFP-STING/pDsRed2-ER/NC or pEGFP-STING/pDsRed2-ER/siRNA-EcRab1, and then fixed for imaging. Co-localization of STING with the Golgi apparatus/ER was quantified using LAS X software. The “r” value represents the PCC value for STING and Golgi/ER co-localization, scale bars are 5 μm. D VP20 impairs colocalization of STING with the Golgi apparatus. GS cells were transfected with pEGFP-STING/pDsRed2-Golgi/empty vector or pEGFP-STING/pDsRed2-Golgi/pFLAG-VP20, and then fixed for IFA analysis. Quantification of the co-localization rate of STING and Golgi via LAS X software. Scale bars represent 5 μm. E VP20 interferes with STING binding to EcRab1. The plasmid combinations pEGFP-C1/pFLAG-STING/pHA-EcRab1 or pEGFP-VP20/pFLAG-STING/pHA-EcRab1 were transfected into GS cells for 48 h, and collected for Co-IP analysis. F VP20 uses EcRab1 to suppress host immunity. The IFN-I, IRF3, ISG15, ISG56 and IFITM1 mRNA levels were determined by qRT-PCR. GS cells were transfected with NC or siRNA-EcRab1 for 12 h, and then transfected with VP20, the cells were collected for qRT-PCR analysis. G Interaction between VP20 and EcRab1 mutants. pEGFP-C1, pEGFP-CA EcRab1, pEGFP-DN EcRab1, pEGFP-EcRab1 and pFlag-VP20 were simultaneously transfected. 48 h after transfection, the cell lysates were tested for Co-IP using anti-Flag antibodies and then western blotting. H Molecular docking of VP20-DN EcRab1 and VP20-CA EcRab1. The blue ribbons represent VP20, the green ribbons represent DN EcRab1 and the purple ribbons represent CA EcRab1. The residues involved are labeled. Data are presented as mean ± SEM (n = 3). Statistically significant differences are indicated (*p < 0.05)

It has been reported that VP20 can disrupt the cGAS-STING pathway but does not directly interact with STING [29]. EcRab1 interacts with both VP20 and STING, suggesting that VP20 may competitively bind to EcRab1 to interfere with STING trafficking and activation. As shown in Fig. 6D, STING was transported to the Golgi apparatus in the absence of VP20. However, when VP20 was overexpressed, colocalization between STING and the Golgi apparatus was abolished. Co-IP assays further demonstrated the competitive binding between VP20 and STING for EcRab1 (Fig. 6E). Additionally, EcRab1 knockdown alleviated the suppressive effect of VP20 on the host innate immune response (Fig. 6F).

The cycling between the GTP-bound and GDP-bound states of Rab proteins is essential for their specific subcellular localization and function [5]. Therefore, we investigated whether different nucleotide states of EcRab1 affect its interaction with VP20. As shown in Fig. 6G, both CA EcRab1 and DN EcRab1 showed stronger interactions with VP20 compared to wild-type EcRab1, with CA EcRab1 showing the strongest binding, followed by DN EcRab1 and wild-type EcRab1. In parallel, computational predictions of protein–protein interactions between VP20 and DN EcRab1 or CA EcRab1 revealed tight binding regions on EcRab1 (Fig. 6H). The predicted binding affinities of VP20-associated DN EcRab1 and CA EcRab1 were −48.63, −95.12 (kcal. mol⁻¹), respectively. In addition, Rab1 active state regulated by the switch I and II [41], both DN and CA forms of EcRab1 are capable of binding to VP20 at the Asp44 residue located on switch I. This observation suggests that Asp44 is a critical site on EcRab1, and it implies a potential mechanism through which VP20 may regulate the activity of EcRab1. Collectively, these results demonstrate that VP20 competes with STING for binding to EcRab1, thereby disrupting STING translocation and subsequently attenuating the host innate immune response.

EcRab1 facilitates the interaction between STING and TBK1

After reaching the Golgi apparatus, STING recruits TBK1 for phosphorylation, thereby enabling the recruitment of IRF3 [42]. To investigate whether EcRab1 interacts with TBK1 or IRF3 in the cGAS-STING signaling pathway, colocalization analysis was performed. As shown in Fig. 7A, EcRab1 colocalized strongly with TBK1, exhibiting a PCC of 0.81. While, there was minimal colocalization between EcRab1 and IRF3 (PCC = 0.25). Co-IP assays further confirmed the interaction between GFP-tagged EcRab1 and Flag-tagged TBK1, but not with HA-tagged IRF3 (Fig. 7B and C). Upon EcRab1 overexpression, the colocalization between STING and TBK1 was enhanced (Fig. 7D), and their interaction was also strengthened, as demonstrated by Co-IP (Fig. 7E). These results suggested that EcRab1 also interacted with TBK1 and this interaction was possibly due to STING bonding with both EcRab1 and TBK1.

Fig. 7.

EcRab1 facilitates STING and TBK1 binding. A Colocalization of EcRab1 with TBK1 and IRF3. GS cells were co-transfected with pEGFP-EcRab1 and pHA-TBK1 or pHA-IRF3, and then fixed for staining or IFA analysis. The fluorescence intensity along the white line was analyzed for co-localization. The PCCs in these confocal fields of view were calculated using LAS X software, with “r” denoting the PCC value that showed co-localization. Scale bars are 5 µm. B EcRab1 interacts with TBK1. GS cells were grown overnight and co-transfected with pEGFP-EcRab1 and pFlag-TBK1 or the empty vector for 48 h, and collected for Co-IP analysis. C EcRab1 did not interact with IRF3. GS cells were grown overnight and co-transfected with pEGFP-EcRab1 and pHA-IRF3 or the empty vector for 48 h, and collected for Co-IP analysis. D Overexpression of EcRab1 promotes colocalization of TBK1 and STING. GS cells were simultaneously transfected with pmCherry-STING/pHA-TBK1/pEGFP-C1 or pmCherry-STING/pHA-TBK1/pEGFP-EcRab1, and then fixed for IFA analysis. The co-localization rates for STING and TBK1 were quantified using LAS X software and “r” represents the PCC for co-localization between of STING and TBK1. Scale bars are 5 μm. E Overexpression of EcRab1 promotes interactions between TBK1 and STING. The plasmid combinations pEGFP-C1/pFLAG-STING/pHA-TBK1 or pEGFP-EcRab1/pFLAG-STING/pHA-TBK1 were transfected into GS cells for 48 h, respectively. The cell lysates were immunoprecipitated with anti-HA using the Dynabeads Protein G Immunoprecipitation kit and then the immunoprecipitates and WCLs were analyzed using IB with anti-GFP, anti-HA, anti-FLAG and anti-β-tubulin. Data are presented as mean ± SEM (n = 3). Statistically significant differences are indicated (*p < 0.05)

EcRab1 is required for VP20 degradation of IRF3 by autophagy

Given that VP20 interacts with IRF3 [29], we investigated whether EcRab1 is involved in this process. Notably, EcRab1 knockdown significantly increased IRF3 protein levels and enhanced the colocalization between VP20 and IRF3 (Fig. 8A). Moreover, VP20 reduced IRF3 protein levels, but this reduction decreased after EcRab1 knockdown (Fig. 8B). The increase of IRF3 may be due to the increase in protein expression or a decrease of protein degradation. To determine the involvement of degradation pathways, specific inhibitors—proteasome inhibitor (MG132), autophagy inhibitor (3-MA), and apoptosis inhibitor (Z-VAD-FMK) were used to assess their effects on VP20-mediated IRF3 degradation. As shown in Fig. 8C, 3-MA effectively reinstated the inhibitory effect of VP20 on IRF3. Meanwhile, ATG5 knockdown yielded consistent results, further validating the above findings (Fig. 8D). Furthermore, when the cells were treated with 3-MA, EcRab1 knockdown did not result in a significant increase in IRF3 protein levels (Fig. 8E). This confirms that EcRab1 modulates VP20-mediated IRF3 degradation through regulation of autophagy, implying that VP20 promotes IRF3 degradation via the autophagic pathway. The microtubule-associated protein light chain 3 (LC3) is widely utilized as a specific marker for identifying autophagosome formation, as indicated by fluorescent LC3 puncta [43, 44]. As illustrated in Fig. 8F, IRF3 did not co-localize with LC3 in either normal cells or cells pretreated with the autophagy inducer, rapamycin (Rap). Notably, in the presence of VP20, IRF3 strongly colocalized with LC3; however, only a small fraction of the VP20 was located in the autophagosome. Additionally, IRF3 colocalization with LC3 was significantly reduced following EcRab1 knockdown. Collectively, these results suggested that EcRab1 and autophagy were involved in IRF3 degradation by VP20.

Fig. 8.

VP20 degradation of IRF3 requires EcRab1. A Co-localization of VP20 and IRF3 after EcRab1 knockdown. GS cells were simultaneously transfected with pEGFP-VP20/pmCherry-IRF3/NC or pEGFP-VP20/pmCherry-IRF3/siRNA-EcRab1, fixed and then observed under a fluorescence confocal microscope, and their quantitative signals were analyzed by LAS X software, scale bars represent 5 μm. The white arrow indicates the co-localization situation. B EcRab1 knockdown inhibited the degradation of IRF3 by VP20. GS cells were co-transfected with pEGFP-C1/pHA-IRF3, pEGFP-VP20/pHA-IRF3, pHA-IRF3/pGFP-VP20/NC or pHA-IRF3/pGFP-VP20/siRNA-EcRab1. The WCLs were subjected to IB with anti-HA, anti-GFP, anti-Rab1 and anti-β-tubulin. C VP20 uses autophagy to degrade IRF3. GS cells were co-transfected with recombinant plasmids expressing IRF3 and viral VP20 or an empty vector for 24 h, and then the cells were treated with MG132 (10 μM), 3-MA (3 mM), or Z-VAD-FMK (1 mM) for 12 h. Protein expression was detected using western blotting. D Knockdown of ATG5 affected VP20 degradation of IRF3. After GS cells were co-transfected with pHA-IRF3/pEGFP-VP20/pSilencer-Scramble or pHA-IRF3/pGFP-VP20/pSilencer-ATG5, the protein expression was detected by western blot. E EcRab1 affects VP20 to degrade IRF3 by affecting autophagy. GS cells were incubated overnight, and co-transfected with pHA-IRF3/pEGFP-VP20/NC or pHA-IRF3/pGFP-VP20/siRNA-EcRab1, and then the cells were treated with autophagy inhibitor (3-MA) for 12 h. Protein expression was detected using western blotting. F VP20 facilitates IRF3 co-localization with LC3. GS cells were co-transfected with pmCherry-IRF3/pHA-LC3, pmCherry-IRF3/pHA-LC3 (incubated with 5 µM Rap for 2 h), pmCherry-IRF3/pHA-LC3/pEGFP-VP20/NC or pmCherry-IRF3/pHA-LC3/pEGFP-VP20/siRNA-EcRab1, fixed and observed under a fluorescence confocal microscope, scale bars represent 5 μm. The percentage of LC3 dots that colocalized with IRF3 was quantitatively analyzed. The statistical analysis of HA-IRF3:β-tubulin ratio was performed. Data are presented as mean ± SEM (n = 3). Statistically significant differences are indicated (*p < 0.05)

As a result, we conducted a more in-depth investigation into the role of EcRab1 in the process of autophagy. As demonstrated in Fig. 9A, VP20 did not colocalize with autophagosomes, indicating that VP20 does not directly regulate autophagy. This phenomenon was further corroborated by the protein expression levels of LC3 and SQSTM1/p62 (Fig. 9B). In contrast, EcRab1 colocalized with autophagosomes, suggesting its potential involvement in the autophagic process. The potential regulation of autophagy by EcRab1 was further investigated. Following Rap treatment, the number of LC3-positive puncta in cells overexpressing EcRab1 significantly increased compared to that of the control group (Fig. 9C). Concurrently, LC3-II and SQSTM1/p62 levels were assessed via western blot analysis. The results showed that the LC3-II to LC3-I ratio was significantly elevated in the cells transfected with pEGFP-EcRab1 and that there was a reduction in SQSTM1/p62 protein levels (Fig. 9D). In addition, EcRab1 knockdown impaired autophagosome formation and markedly inhibited autophagy (Fig. 9E and F). These findings suggested that EcRab1 plays a positive regulatory role in autophagy.

Fig. 9.

VP20 used EcRab1 regulation of autophagy to degrade IRF3. A Locations of VP20, EcRab1 and autophagosomes. GS cells were simultaneously transfected with pEGFP-C1/pHA-LC3, pEGFP-VP20/pHA-LC3 or pEGFP-EcRab1/pHA-LC3, and then fixed for staining or IFA analysis. Scale bars represent 5 μm. B Alterations in LC3 and p62 protein expression levels following the overexpression of VP20. C, E Effects of EcRab1 overexpression (C) or knockdown (E) on autophagy. GS cells were transfected with empty vector/pEGFP-LC3, pHA-EcRab1/pEGFP-LC3, NC/pEGFP-LC3 or siRNA-EcRab1/pEGFP-LC3 respectively, and then incubated with 5 µM Rap for 2 h. The nucleus was stained with DAPI. Scale bars are 5 µm. Quantification of LC3 puncta/per cell in (C) and (E) were expressed as mean ± SEM, n = ∼90 cells. D, F Changes of LC3 and p62 protein expression levels when EcRab1 was overexpressed (D) or knocked down (F). G VP20 promotes EcRab1 and LC3 co-localization. GS cells were co-transfected with pEGFP-EcRab1/pHA-LC3/empty vector or pEGFP-EcRab1/pHA-LC3/pFLAG-VP20, fixed and observed under a fluorescence confocal microscope, scale bars represent 5 μm. The percentage of LC3 dots that colocalized with EcRab1 was quantitatively analyzed. H VP20 leads to co-localization of EcRab1 and IRF3. GS cells were co-transfected with pEGFP-EcRab1/pmCherry-IRF3/empty vector or pEGFP-EcRab1/pmCherry-IRF3/pFLAG-VP20, fixed and observed under a fluorescence confocal microscope, scale bars represent 5 μm. The percentage of EcRab1 dots that colocalized with IRF3 was quantitatively analyzed. I VP20 facilitates the interaction between EcRab1 and IRF3. The plasmid combinations pEGFP-EcRab1/pFLAG-VP20/pHA-IRF3 or pEGFP-EcRab1/empty vector/pHA-IRF3 were transfected into GS cells for 48 h, and collected for Co-IP analysis. The statistical analysis of LC3-II:β-tubulin and p62:β-tubulin ratio was performed. Data are presented as mean ± SEM (n = 3). Statistically significant differences are indicated (*p < 0.05)

We then investigated whether VP20 promotes IRF3 degradation by enhancing the fusion of IRF3 with autophagosomes in an EcRab1-dependent manner. Notably, the colocalization of EcRab1 and LC3 was increased in VP20-overexpressing cells compared to the control group (Fig. 9G), suggesting that VP20 enhances the recruitment of EcRab1 to autophagosomes. Furthermore, the colocalization of EcRab1 and IRF3 in GS cells was assessed by confocal microscopy. EcRab1 and IRF3 colocalized in the presence of VP20, but not in its absence (Fig. 9H). Additionally, Co-IP confirmed EcRab1 could only interact with IRF3 when VP20 was overexpressed (Fig. 9I). Collectively, these results demonstrate that VP20 hijacks EcRab1 to mediate IRF3 degradation via the autophagic pathway.

Discussion

Rab GTPases play pivotal roles in regulating intracellular vesicle trafficking and are frequently exploited by pathogens [45–47]. However, the mechanisms by which viruses interact with Rab proteins remain poorly understood. In this study, we focused on the detailed mechanism of SGIV-Rab1 interactions in host cells. The results indicated that EcRab1 directly affected SGIV infection by regulating early viral infection events, including virus entry and transport to EEs, which was consistent with the pre-existing reports about the important roles played by Rab1 during infection by different viruses. However, Rab1 mainly affects the late stage, virus assembly, and release stages of other viruses. Rab1 GTPase activity is required to produce the viral assembly compartment and for final envelopment of Epstein-Barr virus (EBV), and interestingly, Rab1 has been shown to be a component of the mature EBV virion [48, 49]. Rab1 is also required for virion assembly of classical swine fever virus (CSFV) and herpes simplex virus 1 [12, 50] and Rab1 plays an essential role in transporting viral proteins associated with human immunodeficiency virus type 1 (HIV-1) and SARS-CoV-2 [51, 52]. In the case of Vaccinia virus, Rab1 was required for the production of extracellular enveloped virions (EEVs), other than intracellular mature virions (IMVs) [53]. In hepatocytes, Rab1 inactivation has no effect on genome replication, but decreases HCV release [54]. Notably, although most viruses survive depending on Rab1, Rab1 actually inhibits a few viruses, such as the ASFV and rabies virus. Viral protein CP204L of ASFV can be degraded by the recruitment of Rab1 [55]. Moreover, human monoclonal antibody RAB1 has been shown to neutralize the rabies virus by binding to the viral glycoprotein G [56, 57].

The investigation into EcRab1 regulation of SGIV transport showed that EcRab1 affected EE formation and interacted with Rab5. EcRab1 knockdown or inactivation reduced EE levels, whereas its activation promoted EE formation. Accordingly, Rab1 inactivation or activation significantly blocked or promoted SGIV transport to EEs, respectively, which affected virus infection outcomes. Moreover, the vesicle carrying SGIV was observed to sequentially recruit EcRab1 and Rab5 in real time, which indicated that EcRab1 may affect EE formation and virus trafficking by interacting with Rab5 and suggested a new role for Rab1 in endocytic pathways. Currently, the roles of Rab1 in ER-to-Golgi trafficking and autophagy has been described well. However, there is little information about the function of Rab1 in endocytic vesicles. It has been reported that Rab1 associated with EEs containing asialoorosomucoid (ASOR) and regulates the minus-end-directed motility of EEs along microtubules, which would affect the endocytic trafficking of ASOR, EGF and transferrin [58, 59]. The results from this study further increases understanding about the Rab1 regulation of endocytic pathways. Beyond regulating motility, Rab1 also influences EE formation, indicating that Rab1 has multiple functional roles in the endocytic pathway.

Upon viral infection, host cells initiate an innate immune response, with the cGAS-STING pathway serving as the primary mechanism for detecting viral DNA and triggering immune activation. After DNA recognition, cGAS generates a second messenger molecule, cGAMP, which in turn activates STING. Activated STING subsequently required trafficking from ER to Golgi apparatus, followed by recruitment and activation of kinase TBK1 and transcription factor IRF3 that induce IFN expression [60–62]. Several Rab GTPases have been shown to regulate STING signaling by specifically modulating its trafficking and thereby influencing IFN production [63]. In HEK293T cells, STING strongly interacts with Rab2b, Rab6b, Rab9a, and Rab14, but interacts weakly with Rab23 and Rab27, showing respective effects on STING signaling [63]. Thereinto, RAB14 mediating the STING Golgi-exit is essential for STING degradation by lysosomes and the attenuation of IFN signaling. This study found that another Rab GTPase, EcRab1, also interacted with STING by specifically binding to its C-terminal domain. Moreover, EcRab1 is probably involved in trafficking STING from ER to Golgi apparatus and for the STING-mediated immune response, due to the function of Rab1 seems to be responsible for maintaining Golgi structure and transporting vesicles from ER to Golgi apparatus. Given that different Rabs had distinct effects on STING signaling and the multiple Rabs that interact with STING may determine STING function.

In addition to the cGAS-STING pathway, Rab1 plays a role in the immune response by regulating multiple signaling pathways [64, 65]. The trafficking of Toll-like receptors (TLRs) from ER to Golgi are also dependent on Rab1. Ubiquitination of Rab1by RNF115 inhibits the activation of Rab1 and the post-ER trafficking of TLRs [65]. By promoting TLR4 trafficking from the ER to the cell membrane, Rab1a stimulates TLR4/NF-κB signaling and triggers NLRP3 inflammasome [66, 67]. It has been demonstrated that the GTPase Rab1 functions as a key regulator of both the early secretory pathway and autophagy [68, 69]. Rab1B knockdown by siRNA or the overexpression of a dominant-negative Rab1B variant in CHO cells results in the inhibition of autophagosome formation and the subsequent accumulation of immature autophagosomes [68]. Furthermore, it has been demonstrated that Ypt1/Rab1 interacts with and activates casein kinase 1 delta (CK1δ), which subsequently regulates membrane trafficking and autophagosome biogenesis [70]. Previous studies have also suggested that autophagy may exhibit a dual function in viral infections, exerting either pro-viral or anti-viral effects contingent upon the specific virus and the particular stage of the viral replication cycle [71, 72]. Moreover, Rab1 mediation of the immune response plays an important role in resistance to many pathogens. Rab1 interacts with TRAF3 in the RLR signaling pathway and facilitates MAVS recruitment, leading to TBK1 and IRF3 phosphorylation and upregulation of IFN expression during Zika virus infection [73]. In aquatic animals, Rab1 is used by the host immune system to prevent infection by pathogens such as RGNNV and Vibro splendidus [30, 74]. Interestingly, during SGIV infection, Rab1 does not significantly enhance the host immune response, revealing its varied roles in viral infections. This observation further highlights the complexity of SGIV infection mechanisms, likely linked to the capacity of the virus encoding numerous encoded proteins.

We found that SGIV VP20 and STING compete for binding to EcRab1. When VP20 was expressed, VP20 rather than STING interacted with EcRab1, which blocked STING transportation from the ER to the Golgi apparatus and attenuated IFN-I expression. Moreover, the expression of VP20 facilitated the interaction between EcRab1 and IRF3, subsequently directing IRF3 towards autophagosomes. This process resulted in the degradation of IRF3 via autophagy and a concomitant decrease in the expression of IFN-I. In contrast, in the absence of VP20, no interaction between EcRab1 and IRF3 was observed, suggesting that VP20 may act as a bridging protein that facilitates the formation of an EcRab1–IRF3 complex. Furthermore, the results from this study suggested that SGIV could manipulate EcRab1 to inhibit the cGAS-STING-IFN signaling pathway during successful infection. This is the first report of Rab1 being manipulated by a virus to evade the immune response. Analogous to other DNA viruses, SGIV has developed a range of immune evasion strategies to counteract IFN-I signaling, thereby facilitating its continued proliferation. Prior research has demonstrated that certain viral proteins can suppress the host immune response. SGIV VP131 negatively regulates the IFN response by promoting the degradation of STING and TBK1 through the autophagy-lysosomal and ubiquitin–proteasome pathways [28]. Furthermore, SGIV VP149 circumvents host immune responses by specifically targeting the STING-TBK1 complex [75].

The manipulation of Rab1 by bacteria, particularly Legionella pneumophila, has already been reported and characterized [76–78]. Rab1 is directly targeted and tightly regulated by a series of Legionella effectors during establishment of the mature Legionella-containing vacuole (LCV). DrrA/SidM recruits Rab1 from the Rab1–GDI complex, transfers it to the LCV using its GEF domain, and catalyzes the AMPylation of Rab1 to block the interaction with GAPs, which maintains Rab1 in its activated state [77, 79, 80]. SidD is a deAMPylase that removes the AMP moiety from Rab1 and promotes LepB to bind Rab1 [81, 82]. LepB acts as a GAP that promotes GTP hydrolysis, converting Rab1 into its inactive GDP-bound state [83, 84]. AnkX mediates phosphocholination of Rab1, which stabilizes Rab1 in its nucleotide-bound state and interferes with interactions with Rab1 regulators [80, 85, 86]. Lem3 reverses this modification by removing the phosphocholine group [85], while LidA preferentially binds GTP-bound Rab1 and facilitates the tethering of ER-derived vesicles [87]. Collectively, these effectors precisely regulate the cycling of Rab1 between its GTP- and GDP-bound states. In our study, we also investigated the interaction between VP20 and different conformational states of Rab1. The results showed that VP20 can bind to both GTP-state and GDP-state Rab1. Notably, the interaction with GTP-bound Rab1 exhibited the strongest binding affinity, suggesting that VP20 may induce post-translational modifications on Rab1 that impede its inactivation, thereby stabilizing Rab1 in the active state and enhancing VP20’s functional efficacy. Additionally, IRF3 degradation via autophagy indicates that VP20 exploits EcRab1-mediated autophagy. Rab1 manipulation also influences autophagy in Salmonella infection. Specifically, the Salmonella effector proteins SseF and SseG directly interact with host Rab1, disrupting the initiation of Rab1-mediated autophagy to promote bacterial survival [88]. This evidence suggests that hijacking Rab1 represents a conserved strategy among intracellular pathogens.

Conclusion

In conclusion, we propose a working model that describes the multiple functions of EcRab1 during SGIV infection (Fig. 10). EcRab1 plays a dual role in viral pathogenesis and host defense: it is essential for viral entry and trafficking to EEs, while also exerting antiviral effects by positively regulating the IFN-I response and autophagy. However, VP20 counteracts these protective roles by competing with STING for binding to EcRab1, thereby suppressing STING signaling activation. Moreover, VP20 promotes IRF3 degradation through EcRab1-mediated autophagy. These data provide novel mechanistic insights into how SGIV disrupts host Rab1-mediated pathways to promote infection; however, further work is needed to determine how these mechanisms operate in vivo and to assess whether similar strategies are conserved in other iridoviruses. Such studies will refine our understanding of virus-host interactions and may ultimately aid in the development of antiviral strategies targeting Rab1.

Fig. 10.

Schematic model showing EcRab1 regulation of SGIV transport and VP20 hijacking of EcRab1 to inhibit the host innate immune response (by Figdraw). (i) EcRab1 is essential for viral entry and early endosomal trafficking; (ii) EcRab1 positively influences IFN signaling, facilitates shuttling between the ER and Golgi apparatus, mediates STING trafficking, and enhances the binding of STING and TBK1; (iii) SGIV VP20 and STING exhibit competitive binding to EcRab1, thereby inhibiting the activation of STING and the subsequent immune response; (iv) SGIV VP20 promotes the fusion of EcRab1 with autophagosomes and enhances the autophagic degradation of IRF3

Abbreviations

NCLDVs

Nucleocytoplasmic large DNA viruses

SGIV

Singapore grouper iridovirus

GS

Grouper spleen

ER

Endoplasmic reticulum

EEs

Early endosomes

dsDNA

Double stranded DNA

IFN-I

Interferon-I

ISG

Interferon-stimulated gene

TM

Transmembrane

cGAMP

Cyclic GMP-AMP

LC3

Light chain 3

Authors’ contributions

L. Guan, S. Wang and Q. Qin designed experiments. L. Guan, X. Zhang, Z. Xu, Y. Li, L. Zhang, H. Wang, Z. Zhang, X. Wei and Y. Liu performed experiments or analyzed the data. L. Guan, S. Wang and Q. Qin drafted the manuscript, all authors read and approved the final version of the article.

Funding

This work was supported by grants from the National Key Research and Development Program of China (2023YFD2402300), National Natural Science Foundation of China (42476088, 41976104), and the Science and Technology Projects in Guangzhou (2025A04J4668).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This study received approval from the Animal Care Committee of South China Agricultural University (Approval ID: 2020g009). All study procedures and animal care activities adhered to the guidelines provided in the Guide for the Care and Use of Laboratory Animals, as issued by the Ministry of Science and Technology of the People’s Republic of China.

Consent for publication

All authors have read the manuscript and agree with submission for publication.

Competing interests

The authors declare no competing interests.