Skip to main content
Frontiers in Cellular and Infection Microbiology logoLink to Frontiers in Cellular and Infection Microbiology
. 2026 Jan 16;15:1725219. doi: 10.3389/fcimb.2025.1725219

Effects of mutations in multiple Ethionamide-resistance-associated genes among Mycobacterium tuberculosis clinical isolates from China

Wei Wang 1,, Xiang-long Bo 1,, Ma-chao Li 1,, Shi-qiang Lin 2, Hai-can Liu 1, Xue-ting Fan 1, Xiu-qin Zhao 1, Kang-Lin Wan 1, Li-li Zhao 1,*
PMCID: PMC12855482  PMID: 41625156

Abstract

Objectives

The growing burden of drug-resistant tuberculosis (TB) constitutes a major public health challenge. Ethionamide (ETH), a second-line anti-TB drug, plays an important role in the treatment of multidrug-resistant tuberculosis (MDR-TB). However, the molecular mechanisms underlying ETH resistance remain incompletely elucidated. Thus, this study aimed to evaluate the effects of mutations in ETH resistance-associated genes (inhA, ethA, ethR, and mshA) on ETH resistance levels among Mycobacterium tuberculosis (MTB) isolates from China.

Methods

A total of 137 MTB isolates from China were tested for ETH minimum inhibitory concentrations (MICs) pusing Sensititre® plates, and the sequences of four ETH resistance-associated genes were analyzed based on genomic and PCR sequencing data.

Results

Our results showed that 95.1% (39/41 isolates) of ETH-resistant isolates harbored at least one mutation in these four ETH resistance-associated genes. Most mutations were found in the inhA and ethA (including 5’ untranslated region). Mutations in inhA region were mainly concentrated at the -777C>T site, whereas those in the ethA region were relatively scattered. Notably, multiple mutations were common in high-level ETH-resistant strains and were significantly associated with high-level resistance (P = 0.012). Furthermore, several novel single mutations in ETH-resistant strains, including inhA -100C>A, ethA -31G>A, and mshA Tyr155Ser, were detected.

Conclusion

Different individual mutations and multiple concurrent mutations in ETH resistance-associated genes are associated with varying levels of ETH resistance. These results broaden our understanding of the molecular characteristics of ETH resistance in China.

Keywords: Ethionamide, mutation, mutidrug resistance, Mycobacterium tuberculosis, resistance

Introduction

Tuberculosis (TB), a disease caused by the pathogen Mycobacterium tuberculosis (MTB), remains a major global health threat. According to estimates from the World Health Organization (WHO), there were approximately 10.8 million new cases and 1.25 million deaths worldwide in 2023 (World Health Organization, 2024). The persistent challenge of drug-resistant TB remains particularly pressing, as multidrug-resistant/rifampicin-resistant tuberculosis (MDR/RR-TB) accounts for 3.7% (400,000 cases) of all new tuberculosis cases globally. This statistic underscores the urgent need for advanced diagnostic tools and refined therapeutic regimens (World Health Organization, 2024).

Ethionamide (ETH) is a second-line anti-tuberculosis (TB) drug that is routinely used in combination with other anti-TB agents for the treatment of drug-resistant TB, particularly MDR/RR-TB (World Health Organization, 2019). Disturbingly, a substantial proportion (10.8%-56.3%) of MDR-TB isolates have been shown to exhibit ETH resistance (Dalal et al., 2015; Günther et al., 2015; Rueda et al., 2015). Thus, the rapid detection of ETH susceptibility is essential for optimizing an appropriate treatment regimen and preventing treatment failure. However, ETH resistance is currently detected via phenotypic susceptibility tests, as the molecular resistance mechanisms remain only partially elucidated.

Reports showed that ETH shares mechanistic similarities with isoniazid (INH): both act as prodrugs that require distinct enzymatic activation and their active forms exert anti-TB activity by inhibiting mycolic acid biosynthesis (Banerjee et al., 1994; Vilchèze and Jacobs, 2014; Rueda et al., 2015). EthA, a FAD-dependent monooxygenase, activates ETH (DeBarber et al., 2000; Fraaije et al., 2004). The activated form of ETH then reacts with nicotinamide adenine dinucleotide (NAD+) to form an ETH-NAD adduct. This adduct binds to and inhibits enoyl-acyl carrier protein reductase (InhA), a key enzyme in fatty acid biosynthesis (Wang et al., 2007). Inhibiting InhA reduces the conversion of unsaturated acyl carrier protein (ACP) to saturated ACP, disrupts the fatty acid synthase II (FAS-II) complex, and thereby blocks mycolic acid biogenesis, ultimately resulting in bacterial death (Ushtanit et al., 2022).

Based on previous studies, ETH resistance is primarily attributed to mutations in four genes, including ethA, inhA, ethR, and mshA. Loss-of-function mutations in ethA gene, which encodes the monooxygenase EthA, prevent ETH from being converted to its bioactive form, thereby conferring ETH resistance (Anand et al., 2022). Mutations in the inhA gene can induce structural changes in its encoded protein (InhA), reducing the binding affinity of the ETH-NAD+ adduct for InhA and consequently weakening the drug’s inhibitory effect on MTB (Leung et al., 2006; Vilchèze et al., 2006; Zhang et al., 2022). Mutations in the inhA promoter region can drive overexpression of InhA, which overwhelms the drug’s capacity to inhibit mycolic acid synthesis and resulting in ETH resistance (Vilchèze et al., 2006; Ando et al., 2014). EthR, a transcriptional repressor encoded by ethR, negatively regulates ethA expression by binding to the ethA-ethR intergenic region. This impaired regulatory effect compromises drug activation and ultimately leads to ETH resistance (Engohang-Ndong et al., 2004). One study demonstrated that cyclic di-GMP (c-di-GMP) directly binds to EthR, enhancing its affinity for the ethA promoter, repressing EthA expression, and ultimately conferring ETH resistance (Zhang et al., 2017). Additionally, mshA encodes a glycosyltransferase involved in mycothiol biosynthesis. Given that mycothiol is known to enhance EthA activity, loss-of-function mutations in mshA may contribute to ETH resistance (Vilchèze et al., 2008). However, emerging studies support that mshA is a key player in an alternative ETH bioactivation pathway independent of ethA and ethR (Ang et al., 2017).

However, there are still some clinical strains that do not harbor mutations in these associated genes. This suggests that the mechanisms underlying ETH resistance are complex and diverse, requiring further detailed investigation to clarify. In this study, we examined mutations in ETH-resistance-associated gene regions, including inhA and its 5’ untranslated region (5’UTR), ethA and its 5’UTR, ethR, and mshA, among MTB isolates from China, as well as their impacts on the phenotypic level of ETH resistance.

Materials and methods

Ethics statement

The studies involving human participants was conducted in accordance with the ethical standards of the Declaration of Helsinki and received approval from the Ethics Committee of the National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention (Ethical approval number: ICDC-2019002). All TB patients included in this study were enrolled only after providing informed consent.

Mycobacterium tuberculosis isolates

In this study, a total of 137 MTB isolates were collected from 137 patients with pulmonary tuberculosis across seven regions in China, namely Fujian (10 isolates), Gansu (14 isolates), Hunan (9 isolates), Anhui (64 isolates), Inner Mongolia (10 isolates), Xinjiang (20 isolates), and Tibet (10 isolates). All these isolates were resistant to INH. Of these, 125 isolates were also resistant to rifampicin and thus classified as MDR-TB. The resistance profiles of these isolates to INH and RIF had been confirmed previously using the proportion method based on Lowenstein-Jensen (L-J) medium.

All isolates were cultured on L-J medium and subjected to fresh subculture prior to drug susceptibility testing and DNA extraction. H37Rv (ATCC 27294) served as the reference strain. All manipulations involving live MTB isolates were conducted in accordance with relevant biosafety standards, with the implementation of appropriate engineering controls and personal protective equipment.

Phenotypic drug susceptibility testing (DST)

DST was performed to determine the MICs of ETH for each isolate, using Sensititre® plates (Thermo Fisher Scientific Inc., Cleveland, Ohio, USA). All procedures were carried out in accordance with the manufacturer’s instructions, and H37Rv (ATCC 27294) was included as a quality control strain in each batch of DST. Briefly, suspensions of MTB strains were adjusted to 0.5 McFarland standard using sterile normal saline. The standardized suspensions were then diluted 100-fold with Middlebrook 7H9-OADC broth (0.2% glycerol, 10% Middlebrook oleic acid-albumin-dextrose-catalase, and 0.05% Tween 80) and inoculated into the 96-well plates at a volume of 100 μL per well. The plates were subsequently incubated at 37°C for 10–21 days, and results were read using the Vizion Digital viewing System (Thermo Fisher Scientific Inc., Cleveland, Ohio, USA) (He et al., 2022). The ETH concentration range in the Sensititre® plates was 0.3–40 μg/mL (Hall et al., 2012; He et al., 2022). Based on previous studies (MaChado et al., 2013; Rueda et al., 2015; Cao et al., 2023), a strain was considered susceptible if its MIC was ≤5 μg/mL, low-level resistant (LLR) if its MIC was >5 μg/mL and ≤10 μg/mL, and high-level resistant (HLR) if its MIC was ≥20 μg/mL.

DNA extraction and whole-genome sequencing

The mutation data presented in this study were derived from whole-genome sequencing of the strains. We used cetyltrimethyl ammonium bromide (CTAB) method described in a previous report (Cao et al., 2023) to extract genomic DNA from fresh cultures grown on Lowenstein-Jensen (L-J) medium; the extracted DNA was then stored at −20°C for subsequent whole-genome sequencing and PCR amplification. Sequencing libraries were prepared from genomic DNA samples following the kit instructions and subsequently used for high-throughput sequencing on the DNBSEQ platform. Raw sequencing data were processed into clean data using SOAPnuke software (BGI, Shenzhen, China) and aligned against the reference genome of H37Rv (GenBank accession number: NC_000962.3) to identify single-nucleotide polymorphism (SNP) sites.

PCR amplification and DNA sequencing

All novel mutations identified in this study, as well as mutations present in ETH-susceptible strains, were validated via PCR and DNA sequencing. Four ETH resistance-associated regions were amplified by PCR: inhA and its 5’UTR, ethA and its 5’UTR, ethR, mshA. The primer sequences and amplicon positions are provided in Table 1. The PCR amplification protocol was as follows: an initial denaturation step at 94°C for 5 min; followed by 35 cycles of denaturation at 95°C for 30 s, primer annealing at 60°C for 30 s, and extension at 72°C for 1 min; and a final extension step at 72°C for 10 min. The DNA sequences of the PCR products were verified using Sanger sequencing, and all sequence data were aligned against the reference genome of H37Rv (GenBank accession number: NC_000962.3) using BioEdit v7.05.3 (https://bioedit.software.informer.com). The sequencing data were submitted to the NCBI Sequencing Read Archive (SRA) with the accession number: PRJNA1372000.

Table 1.

Primers used in PCR amplification and DNA sequencing.

Resistance gene Primer Sequence (5’ to 3’) Nucleotide position
ethA EthAF1 AGTTCACGATCGTCGCCGGAC 4326739-4327628
EthAR1 CGCAGCACGTTCTTCCACCGTA
EthAF2 GCTCACCCACCTACATCGTGTCGC 4325927-4326855
EthAR2 GATATCGCCTACAGCGACGACGA
ethR EthRF AGTCAGGCTTCGCTGCCT 4327567-4328197
EthRR AGCGGTTCTCGCCGTAAATG
mshA MshAF TGTCACTTCGGTTCCTGCAAGG 575322-576025
MshAR CGAAATCACTTGCCTGGCTTCA
inhA InhAF1 CGAAGTGTGCTGAGTCACACC 1673303-1674191
InhAR1 GTGTTGTGTCAGTGGCCCATAC
InhAF2 TGCAATTTATCCCAGCGAAGCG 1674047-1674770
InhAR2 GCAACGAGATTCGAACGCACA

Statistical analysis

All data analyses were conducted using SAS v9.3 (SAS Institute, Cary, NC, USA). Descriptive statistics, including frequencies, percentages, and ranges, were calculated as appropriate for the data type. Intergroup comparisons were performed using the chi-square test, with statistical significance defined as a P < 0.05.

Results

ETH MICs result

The ETH MICs results for the 137 INH-resistant MTB isolates were summarized in Table 2. Based on these MIC values, the isolates were stratified into three groups, with 96 (70.1%) classified as ETH-susceptible, 18 (13.1%) as LLR, and 23 (16.8%) as HLR. Overall, 41 (29.9%) of the 137 isolates were identified as ETH-resistant. Additionally, among the 125 MDR-TB isolates, 33 (26.4%) exhibited ETH resistance.

Table 2.

Mutations in inhA、ethA、ethR、mshA among 137 Mycobacterium tuberculosis isolate.

Mutations in: No of isolates
Ethionamide MIC (µg/ml)f
inhA and its 5'UTRg ethA and its 5'UTR ethR mshA ≤0.3 0.6 1.2 2.5 5 10 20 40 >40
c-777tcd 0 0 0 1 1 8 1 0 2
c-777t;Ser94Alae 0 0 0 0 0 0 0 0 1
c-777t;Asn139Serα 0 0 0 0 0 1 0 0 0
c-777t His4Glnα 0 0 0 0 0 1 0 0 0
c-777t Leu62Proα 0 0 0 0 0 0 0 2 0
c-777t Ile161Valα 0 0 0 0 0 1 0 0 0
c-777t Val243Alaα 0 0 0 0 0 0 2 0 0
c-777t 958_959insGTα 0 0 0 0 0 0 0 0 1
t-770ace 0 0 0 1 0 0 0 0 1
t-770a Glu400Lys Thr182Alaα 0 0 0 0 0 2 0 0 0
t-770cce Arg259Cysα 0 0 0 0 1 0 0 0 0
g-750tαc 0 1 0 0 0 0 0 0 0
g-154ae 0 0 0 0 0 1 0 0 0
g-154a Cys137Glyα 0 0 0 0 0 0 0 1 0
g-154a Phe64Serα 0 0 0 0 0 0 0 1 0
c-100aαc 0 0 0 0 0 0 0 0 1
a-17cαc 1 0 0 0 0 0 0 0 0
Ile194Thr 0 0 0 0 0 1 0 0 0
g-31aαc 0 0 0 0 0 1 0 0 0
t-35cαc His178Argα 0 0 0 0 0 0 0 0 1
Gly13Argα 0 0 0 0 3 1 0 0 0
Ala33Glyα 0 0 0 1 0 0 0 0 0
Gly43Ser 0 0 0 0 0 0 1 0 0
Asp56Glu 0 0 0 1 0 0 0 0 0
Thr61Alaα 0 0 0 0 1 0 0 0 0
Thr84Xα 0 0 0 0 1 0 0 0 0
Tyr173Xα 0 0 0 0 1 0 0 0 0
Asp219Glyα 0 0 0 1 0 0 0 0 0
Trp256Xα 0 0 0 0 0 1 1 0 1
Ala304Val 0 0 0 0 0 0 1 2 0
Thr342Proα 0 0 0 1 0 0 0 0 0
Met409Valα 0 0 1 0 0 0 0 0 0
Tyr155Serα 0 0 0 0 0 0 0 0 1
NMb NMb NMb NMb 14 32 22 6 5 0 1 0 1

αMutation not previously reported.

bNM, no mutation.

cMutations were located in the 5'UTR of inhA or ethA.

dGroup 1 mutations, associated with resistance.

eGroup 2 mutations, associated with resistance-interim.

fSusceptible, MIC≤5 μg/mL. Low-level resistant, 5 μg/mL<MIC≤ 10 μg/mL. High-level resistant, MIC≥ 10 μg/mL.

g5'UTR, 5' untranslated region.

ETH mutations

To specifically investigate mutations associated with ETH resistance, we excluded lineage-specific mutations and synonymous mutations from our analysis. Among the 137 clinical isolates, 56 carried non-synonymous mutations, while one harbored an insertion. Notably, 2 high-level ETH-resistant isolates still showed no mutation in the regions analyzed in this study. Detailed information on the mutations is provide in Table 2.

Most mutations in ETH resistance-related genes were detected in inhA and its 5’UTR. A total of 34 isolates, comprising 28 ETH-resistant isolates and 6 ETH-susceptible isolates, harbored at least one mutation in inhA or its 5’UTR. Thirty-two isolates (94.1%) carried a single mutation, whereas 2 (5.9%) isolates had double mutations. Notably, 91.7% (33/36) of the mutations were localized in the 5’UTR of the inhA gene. Among these mutations, the -777C>T (n=20) was predominant, which was detected in 18 ETH-resistant and 2 ETH-susceptible strains. This was followed by the -770T>A (n=4), -154G>A (n=3), -770T>C (n=1), -750G>T (n=1), -100C>A (n=1), and -17A>C mutations (n=1). Furthermore, the novel mutation -100C>A was exclusively observed in ETH HLR strains and occurred without concurrent mutations in other ETH resistance-associated gene regions. Three types of mutations were identified in the inhA coding region, located at codons 94 (Ser94Ala), 139 (Asn139Ser), and 194 (Ile194Thr). Among these, the mutations at codons 94 and 139 co-occurred with the -777C>T mutation, while the remaining one was a single mutation. These three mutations in the inhA coding region were exclusively detected in ETH-resistant strains. Additionally, six ETH-susceptible strains carried mutations in inhA 5’UTR.

The next most common mutation region was ethA and its 5’UTR. In total, 33 isolates, including 21 ETH-resistant isolates and 12 ETH-susceptible isolates, harbored mutations within this region. Of these mutations, two (-35T>C and -31G>A) were localized to the ethA 5’UTR, while the remainder were scattered throughout the ethA coding region. In ETH-resistant strains, most of these mutations co-occurred with additional mutations in other ETH resistance-related genes, particular inhA. Notably, nine ETH-resistant strains carried mutations exclusively in this gene region, including -31G>A, Gly13Arg, Gly43Ser, Trp256X, and Ala304Val. Additionally, 12 ETH-susceptible strains harbored mutations in ethA and its 5’UTR.

Furthermore, this study identified one novel mutation in the ethR gene (Thr182Ala) and two novel mutations in the mshA gene (Tyr155Ser in one isolate and His178Arg in another). All these mutations were exclusively detected in ETH-resistant strains.

Association between the mutations and ETH MIC

Among the 137 MTB isolates, 41 harbored single mutations in ETH resistance-associated genes, while 15 carried multiple mutations. Isolates with exclusive mutations in inhA and its 5’UTR predominantly exhibited low-level ETH resistance. In contrast, single mutations in ethA and its 5’UTR were more frequently detected in ETH-susceptible strains, with the MIC of these susceptible strains mostly ranging from 2.5 to 5 μg/ml. Most multiple mutations were observed in isolates with high-level ETH resistance. Of the 23 ETH high-level resistant isolates, 9 (39.1%) harbored two or more mutations in ETH resistance-related regions. This proportion was significantly higher than that among low-level ETH-resistant isolates (27.8%, 5/18 isolates) and ETH susceptible isolates (1.0%, 1/96 isolates). Statistics analysis further confirmed that multiple mutations were associated with high-level ETH resistance (P = 0.012) (Table 3).

Table 3.

The relation between the phenotypic ETHb susceptibility results of MTB isolates and the occurrence of mutations in different ETH-associated resistance genes.

ETH resistance related regions Susceptible ETH resistance P value
Low level ETH resistance High level ETH resistance
inhAα(single mutation) 5 10 5
inhAα(multiple mutations) 0 1 1
ethAα 11 3 6
mshA 0 0 1
inhAα+ ethAα 1 2 7
inhAα+ ethAα+ethR 0 2 0
ethAα+mshA 0 0 1
Single mutation 16 13 12 0.012
multiple mutations 1 5 9

αincluding its 5' untranslated region.

b

Ethionamide.

Agreement between phenotypic DST and DNA sequencing

Table 4 summarizes the concordance between phenotypic and genotypic assays for ETH resistance detection, where the genotypic test involved DNA analysis targeting different ETH resistance associated regions. In this study, screening of inhA and its 5’UTR achieved the optimal predictive performance (accuracy = 86.1%). Although incorporating detection of ethA and its 5’UTR, mshA, and ethR improved predictive sensitivity, it reduced predictive specificity. Thus, overall predictive accuracy was not enhanced. Of note, a distinct discrepancy was observed in 17 isolates: phenotypic susceptibility testing confirmed these isolates to be ETH-susceptible, yet they harbored at least one mutation in an ETH resistance-associated region.

Table 4.

Summary of sequence analysis of mutated locus and phenotypic drug susceptibility testing.

Locus No. of isolates P value Sensitivity (%) Specificity (%) Accuracy (%)
Resistant Susceptible
Mutation No mutation Mutation No mutation
inhA α 28 13 6 90 0.000b 68.29 93.75 86.13
ethAα 21 20 12 84 0.000b 51.22 87.50 76.64
ethR 2 39 0 96 0.088 4.88 100.00 71.53
mshA 2 39 0 96 0.088 4.88 100.00 71.53
inhAα +ethAα 38 3 17 79 0.000b 92.68 82.29 85.40
inhAα +ethAα +ethR 38 3 17 79 0.000b 92.68 82.29 85.40
inhAα +ethAα + mshA 39 2 17 79 0.000b 95.12 82.29 86.13
inhAα + ethAα + ethR + mshA 39 2 17 79 0.000b 95.12 82.29 86.13

α including its upstream region.

bP<0.001.

Discussion

In this study, we determined the ETH MICs of 137 INH-resistant MTB from China and analyzed mutations in four ETH resistance-associated genomic regions. Of these 137 isolates, 41 were ETH-resistant, including 18 with low-level ETH resistance and 23 with high-level ETH resistance. Among MDR-TB strains, the frequency of ETH resistance was 26.4%, which is lower than the 52.5% reported in India (Dalal et al., 2015) and 31.75% in Russia (Ushtanit et al., 2022), but higher than the 15% documented in Thailand (Boonaiam et al., 2010).

Previous studies have showed that most mutations conferring ETH resistance in clinical strains localized to the inhA and ethA genes (Ushtanit et al., 2022). Consistent with this finding, among the 41 ETH-resistant isolates, 28 (68.3%) harbored mutations in inhA and its 5’UTR, while 21 (51.2%) carried mutations in ethA and its 5’UTR.

The frequency of mutations in inhA and its UR has been reported to range from at least 13.8% to 100.0% among ETH- and INH-resistant clinical MTB isolates across different geographical regions (Boonaiam et al., 2010; MaChado et al., 2013; Rueda et al., 2015; Liu et al., 2022). This study confirmed inhA mutations in 68.3% of ETH- and INH-resistant clinical isolates. The -777T>C mutation in the inhA 5’UTR was the most prevalent mutation among ETH-resistant strains (Guo et al., 2006). This finding has been reported in numerous studies and is consistent with our results (Guo et al., 2006; MaChado et al., 2013; Sandoval et al., 2020; Sarin et al., 2021). According to the ETH mutation catalogue recommended by the World Health Organization (WHO), this mutation is classified as Group 1 mutation. It is commonly referred to as -15C>T in the promoter region of the inhA-fabG1 operon and is thought to contribute to ETH resistance (World Health Organization, 2023). The established resistance mechanism involves this mutation driving overexpression of the InhA protein, which in turn confers ETH resistance. We also identified additional mutations, including -770T>A, -770T>C, and -154G>A, which fall into Group 2 ETH mutations (World Health Organization, 2023). Importantly, these mutations were detected not only in ETH-resistant strains but also in ETH-susceptible strains. Mutations in the inhA coding region were rare and exclusively detected in ETH-resistant strains. Among these coding region mutations, Ser94Ala and Asn139Ser co-occurred with the -777C>T mutation. Previous reports have revealed that single mutations in inhA or its 5’UTR are associated with low-level ETH resistance (Guo et al., 2006). Consistent with this finding, single mutations in the inhA region identified in our study were also predominantly concentrated in isolates with low-level ETH resistance.

In line with the previous reports, approximately 51.2% (21/41) of the ETH-resistant isolates harbored mutations in ethA and its 5’UTR (Brossier et al., 2011; Maitre et al., 2022; Cao et al., 2023). These ethA mutations were dispersed across the entire gene with no discernible hotspot. This distribution pattern can potentially be explained by functional redundancy within the monooxygenase family: the MTB genome encodes over 30 monooxygenases, and it is plausible that one or more of these enzymes could compensate for reduced or lost ETH-related activity (Morlock et al., 2003).

Mutations in inhA and ethA among ETH-susceptible strains were well documented (Brossier et al., 2011; Maitre et al., 2022; Ushtanit et al., 2022; Cao et al., 2023), and this observation is further supported by the results of the present study. Interestingly, the MICs of these strains ranged from 2.5 to 5 μg/mL, which are close to the clinical critical concentration. For one thing, DST for ETH inherently poses certain reproducibility challenges. Variations in testing methodologies or critical concentration thresholds may lead to discrepancies in results, suggesting that genotypic testing is more robust for strains with susceptibility values near the critical threshold (Ushtanit et al., 2022). For another, this phenomenon suggests that these specific mutations may represent an intermediate or preliminary step in the evolution of ETH resistance: they might confer a subtle fitness advantage by slightly elevating the MIC, without exceeding the threshold required for clinical classification as resistant (Nonghanphithak et al., 2020). This finding also supports the notion that ETH resistance development may potentially proceed in a stepwise manner, given that it is not uncommon for isolates to harbor multiple resistance mechanisms that presumably exert additive effects (Gygli et al., 2019; Nonghanphithak et al., 2020; World Health Organization, 2023).

Multiple mutations in ETH resistance-associated regions were detected more frequently in isolates with high-level ETH resistance. Statistical analysis further confirmed a significant association between these mutations and high-level resistance. These results indicate that the mechanism underlying high-level ETH resistance is more complex, involving mutations in one or more genes. Moreover, in this study, multiple mutations typically included at least one mutation in the inhA or ethA region, and this observation further underscores the critical role of these two regions in ETH resistance development.

Compared with the phenotypic susceptibility results, the accuracy of detecting ETH resistance via DNA analysis of the inhA region was 86.13% in our study. Incorporating ethA, ethR, or mshA into the molecular diagnostic panel did not improve the test accuracy. Although current rapid molecular diagnostic tools, such as the Xpert MTB/XDR assay (Pillay et al., 2022), identify ETH resistance by detecting two mutations in the inhA promoter region, our study provides crucial data that complements and refines this diagnostic paradigm. Notably, two ETH-resistant isolates still had no mutations detected in the analyzed regions. This suggests that these isolates may either carry mutations outside regions examined or develop resistance through alternative mechanisms, such as those involving efflux pumps (Rodriguez et al., 2023).

Furthermore, several novel mutations were identified in this study. Only a small number of single mutations, including inhA -100C>A、ethA -31G>A and mshA Tyr155Ser, were detected in ETH-resistant isolates. These mutations may serve as novel entry points for future research into ETH resistance mechanisms, and could provide potential targets for developing new diagnostic approaches and treatment strategies against ETH-resistant strains. The remaining novel mutations co-occurred with known mutations in either the inhA or ethA regions. The role of these novel mutations in ETH resistance mechanism remains unclear and requires further functional validation.

In conclusion, the mutations conferring ETH resistance in 137 MTB isolates from China exhibit complexity and diversity. Specifically, different mutations in ETH resistance-associated gene regions are associated with varying levels of ETH resistance. These findings will enhance our understanding of the mechanisms underlying ETH resistance in China, which is turn supports the development of molecular diagnostics tools and the optimization of therapeutic management strategies.

Funding Statement

The author(s) declared that financial support was received for this work and/or its publication. This study was supported by the projects from National Key Research and Development Program of China (No. 2023YFC2307204), and National Key Program of Mega Infectious Diseases (Grant No. 2018ZX10302302). The funder had no role in the study design, data collection and analysis, decision to publish, or manuscript preparation.

Footnotes

Edited by: Michael Marceau, Université Lille Nord de France, France

Reviewed by: Srinivasan Vijay, Texas A and M University, United States

Noha Salah Soliman, Cairo University, Egypt

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/supplementary material.

Author contributions

WW: Investigation, Data curation, Validation, Writing - original draft, Formal analysis. X-LB: Validation, Software, Data curation, Formal analysis, Writing – original draft. M-CL: Validation, Writing – original draft, Investigation. S-QL: Writing – review & editing. H-CL: Writing – original draft, Data curation. X-TF: Investigation, Writing – original draft. X-QZ: Investigation, Writing – original draft. K-LW: Writing – review & editing. L-LZ: Funding acquisition, Data curation, Writing – review & editing.

Conflict of interest

The authors declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  1. Anand P. K., Kumar A., Saini A., Kaur J. (2022). Mutation in Eth A protein of Mycobacterium tuberculosis conferred drug tolerance against enthinoamide in Mycobacterium smegmatis mc(2)155. Comput. Biol. Chem. 98, 107677. doi:  10.1016/j.compbiolchem.2022.107677, PMID: [DOI] [PubMed] [Google Scholar]
  2. Ando H., Miyoshi-Akiyama T., Watanabe S., Kirikae T. (2014). A silent mutation in mabA confers isoniazid resistance on Mycobacterium tuberculosis. Mol. Microbiol. 91, 538–547. doi:  10.1111/mmi.12476, PMID: [DOI] [PubMed] [Google Scholar]
  3. Ang M. L. T., Zainul Rahim S. Z., de Sessions P. F., Lin W., Koh V., Pethe K., et al. (2017). EthA/R-independent killing of mycobacterium tuberculosis by ethionamide. Front. Microbiol. 8, 710. doi:  10.3389/fmicb.2017.00710, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Banerjee A., Dubnau E., Quemard A., Balasubramanian V., Um K. S., Wilson T., et al. (1994). inhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis. Science. 263, 227–230. doi:  10.1126/science.8284673, PMID: [DOI] [PubMed] [Google Scholar]
  5. Boonaiam S., Chaiprasert A., Prammananan T., Leechawengwongs M. (2010). Genotypic analysis of genes associated with isoniazid and ethionamide resistance in MDR-TB isolates from Thailand. Clin. Microbiol. Infect. 16, 396–399. doi:  10.1111/j.1469-0691.2009.02838.x, PMID: [DOI] [PubMed] [Google Scholar]
  6. Brossier F., Veziris N., Truffot-Pernot C., Jarlier V., Sougakoff W. (2011). Molecular investigation of resistance to the antituberculous drug ethionamide in multidrug-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 55, 355–360. doi:  10.1128/aac.01030-10, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cao B., Mijiti X., Deng L. L., Wang Q., Yu J. J., Anwaierjiang A., et al. (2023). Genetic characterization conferred co-resistance to isoniazid and ethionamide in mycobacterium tuberculosis isolates from southern xinjiang, China. Infect. Drug Resist. 16, 3117–3135. doi:  10.2147/idr.S407525, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dalal A., Pawaskar A., Das M., Desai R., Prabhudesai P., Chhajed P., et al. (2015). Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time. PloS One. 10, e0116798. doi:  10.1371/journal.pone.0116798, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. DeBarber A. E., Mdluli K., Bosman M., Bekker L. G., Barry C. E. 3rd. (2000). Ethionamide activation and sensitivity in multidrug-resistant Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U.S.A. 97, 9677–9682. doi:  10.1073/pnas.97.17.9677, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Engohang-Ndong J., Baillat D., Aumercier M., Bellefontaine F., Besra G. S., Locht C., et al. (2004). EthR, a repressor of the TetR/CamR family implicated in ethionamide resistance in mycobacteria, octamerizes cooperatively on its operator. Mol. Microbiol. 51, 175–188. doi:  10.1046/j.1365-2958.2003.03809.x, PMID: [DOI] [PubMed] [Google Scholar]
  11. Fraaije M. W., Kamerbeek N. M., Heidekamp A. J., Fortin R., Janssen D. B. (2004). The prodrug activator EtaA from Mycobacterium tuberculosis is a Baeyer-Villiger monooxygenase. J. Biol. Chem. 279, 3354–3360. doi:  10.1074/jbc.M307770200, PMID: [DOI] [PubMed] [Google Scholar]
  12. Günther G., van Leth F., Alexandru S., Altet N., Avsar K., Bang D., et al. (2015). Multidrug-resistant tuberculosis in europe, 2010-2011. Emerg. Infect. Dis. 21, 409–416. doi:  10.3201/eid2103.141343, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Guo H., Seet Q., Denkin S., Parsons L., Zhang Y. (2006). Molecular characterization of isoniazid-resistant clinical isolates of Mycobacterium tuberculosis from the USA. J. Med. Microbiol. 55, 1527–1531. doi:  10.1099/jmm.0.46718-0, PMID: [DOI] [PubMed] [Google Scholar]
  14. Gygli S. M., Keller P. M., Ballif M., Blöchliger N., Hömke R., Reinhard M., et al. (2019). Whole-genome sequencing for drug resistance profile prediction in mycobacterium tuberculosis. Antimicrob. Agents Chemother. 63, e02175–18. doi:  10.1128/aac.02175-18, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hall L., Jude K. P., Clark S. L., Dionne K., Merson R., Boyer A., et al. (2012). Evaluation of the Sensititre MycoTB plate for susceptibility testing of the Mycobacterium tuberculosis complex against first- and second-line agents. J. Clin. Microbiol. 50, 3732–3734. doi:  10.1128/jcm.02048-12, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. He W., Tan Y., Liu C., Wang Y., He P., Song Z., et al. (2022). Drug-resistant characteristics, genetic diversity, and transmission dynamics of rifampicin-resistant mycobacterium tuberculosis in hunan, China, revealed by whole-genome sequencing. Microbiol. Spectr. 10, e0154321. doi:  10.1128/spectrum.01543-21, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Leung E. T., Ho P. L., Yuen K. Y., Woo W. L., Lam T. H., Kao R. Y., et al. (2006). Molecular characterization of isoniazid resistance in Mycobacterium tuberculosis: identification of a novel mutation in inhA. Antimicrob. Agents Chemother. 50, 1075–1078. doi:  10.1128/aac.50.3.1075-1078.2006, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu D., Huang F., Zhang G., He W., Ou X., He P., et al. (2022). Whole-genome sequencing for surveillance of tuberculosis drug resistance and determination of resistance level in China. Clin. Microbiol. Infect. 28, 731. doi:  10.1016/j.cmi.2021.09.014, PMID: [DOI] [PubMed] [Google Scholar]
  19. Machado D., Perdigão J., Ramos J., Couto I., Portugal I., Ritter C., et al. (2013). High-level resistance to isoniazid and ethionamide in multidrug-resistant Mycobacterium tuberculosis of the Lisboa family is associated with inhA double mutations. J. Antimicrob. Chemother. 68, 1728–1732. doi:  10.1093/jac/dkt090, PMID: [DOI] [PubMed] [Google Scholar]
  20. Maitre T., Morel F., Brossier F., Sougakoff W., Jaffre J., Cheng S., et al. (2022). How a PCR sequencing strategy can bring new data to improve the diagnosis of ethionamide resistance. Microorganisms. 10, 1463. doi:  10.3390/microorganisms10071436, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Morlock G. P., Metchock B., Sikes D., Crawford J. T., Cooksey R. C. (2003). ethA, inhA, and katG loci of ethionamide-resistant clinical Mycobacterium tuberculosis isolates. Antimicrob. Agents Chemother. 47, 3799–3805. doi:  10.1128/aac.47.12.3799-3805.2003, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Nonghanphithak D., Kaewprasert O., Chaiyachat P., Reechaipichitkul W., Chaiprasert A., Faksri K. (2020). Whole-genome sequence analysis and comparisons between drug-resistance mutations and minimum inhibitory concentrations of Mycobacterium tuberculosis isolates causing M/XDR-TB. PloS One. 15, e0244829. doi:  10.1371/journal.pone.0244829, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Pillay S., Steingart K. R., Davies G. R., Chaplin M., De Vos M., Schumacher S. G., et al. (2022). Xpert MTB/XDR for detection of pulmonary tuberculosis and resistance to isoniazid, fluoroquinolones, ethionamide, and amikacin. Cochrane Database Syst. Rev. 5, Cd014841. doi:  10.1002/14651858.CD014841.pub2, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Rodriguez R., Campbell-Kruger N., Gonzalez Camba J., Berude J., Fetterman R., Stanley S. (2023). MarR-Dependent Transcriptional Regulation of mmpSL5 Induces Ethionamide Resistance in Mycobacterium abscessus. Antimicrob. Agents Chemother. 67, e0135022. doi:  10.1128/aac.01350-22, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Rueda J., Realpe T., Mejia G. I., Zapata E., Rozo J. C., Ferro B. E., et al. (2015). Genotypic analysis of genes associated with independent resistance and cross-resistance to isoniazid and ethionamide in mycobacterium tuberculosis clinical isolates. Antimicrob. Agents Chemother. 59, 7805–7810. doi:  10.1128/aac.01028-15, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Sandoval R., Monteghirfo M., Salazar O., Galarza M. (2020). Cross-resistance between isoniazid and ethionamide and its strong association with mutation C-15T in Mycobacterium tuberculosis isolates from Peru. Rev. Argent Microbiol. 52, 36–42. doi:  10.1016/j.ram.2019.03.005, PMID: [DOI] [PubMed] [Google Scholar]
  27. Sarin R., Bhalla M., Kumar G., Singh A., Myneedu V. P., Singhal R. (2021). Correlation of inhA mutations and ethionamide susceptibility: Experience from national reference center for tuberculosis. Lung India. 38, 520–523. doi:  10.4103/lungIndia.lungIndia_120_21, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ushtanit A., Kulagina E., Mikhailova Y., Makarova M., Safonova S., Zimenkov D.. (2022). Molecular determinants of ethionamide resistance in clinical isolates of mycobacterium tuberculosis. Antibiotics (Basel). 11, 133. doi:  10.3390/antibiotics11020133, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Vilchèze C., Av-Gay Y., Attarian R., Liu Z., Hazbón M. H., Colangeli R., et al. (2008). Mycothiol biosynthesis is essential for ethionamide susceptibility in Mycobacterium tuberculosis. Mol. Microbiol. 69, 1316–1329. doi:  10.1111/j.1365-2958.2008.06365.x, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Vilchèze C., Jacobs W. R., Jr. (2014). Resistance to isoniazid and ethionamide in mycobacterium tuberculosis: genes, mutations, and causalities. Microbiol. Spectr. 2, Mgm2–0014-2013. doi:  10.1128/microbiolspec.MGM2-0014-2013, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Vilchèze C., Wang F., Arai M., Hazbón M. H., Colangeli R., Kremer L., et al. (2006). Transfer of a point mutation in Mycobacterium tuberculosis inhA resolves the target of isoniazid. Nat. Med. 12, 1027–1029. doi:  10.1038/nm1466, PMID: [DOI] [PubMed] [Google Scholar]
  32. Wang F., Langley R., Gulten G., Dover L. G., Besra G. S., Jacobs W. R. Jr, et al. (2007). Mechanism of thioamide drug action against tuberculosis and leprosy. J. Exp. Med. 204, 73–78. doi:  10.1084/jem.20062100, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. World Health Organization (2019). WHO consolidated guidelines on drug-resistant tuberculosis treatment (Geneva: World Health Organization; ). [PubMed] [Google Scholar]
  34. World Health Organization (2023). Catalogue of mutations in Mycobacterium tuberculosis complex and their association with drug resistance (Geneva: World Health Organization; ). [Google Scholar]
  35. World Health Organization (2024). Global tuberculosis report 2024 (Geneva: World Health Organization; ). [Google Scholar]
  36. Zhang H. N., Xu Z. W., Jiang H. W., Wu F. L., He X., Liu Y., et al. (2017). Cyclic di-GMP regulates Mycobacterium tuberculosis resistance to ethionamide. Sci. Rep. 7, 5860. doi:  10.1038/s41598-017-06289-7, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang Q., Yang Y., Gong X., Zhao N., Zhang Y., Liu H. (2022). Thermodynamic integration combined with molecular dynamic simulations to explore the cross-resistance mechanism of isoniazid and ethionamide. Proteins. 90, 1142–1151. doi:  10.1002/prot.26295, PMID: [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/supplementary material.


Articles from Frontiers in Cellular and Infection Microbiology are provided here courtesy of Frontiers Media SA

RESOURCES