LncRNA AC040169.1 is regulated by m6A modification and suppresses ferroptosis via SLC7A11 to promote ovarian cancer progression

Abstract

Background

Ovarian cancer (OC) is a common malignant tumour of the female reproductive system. Long noncoding RNAs (lncRNAs) and m6A modifications play important regulatory roles in tumour cells. Ferroptosis is closely related to tumour development, but the function and molecular mechanism of lncRNAs in ferroptosis are still unclear.

Methods

The expression of AC040169.1 was detected in OC cells and tissues. The molecular mechanism by which METTL14 and YTHDC2 up-regulate the level of AC040169.1 with m6A modification is investigated. Furthermore, the biological functions of AC040169.1 and ferroptosis in OC cells were investigated in vivo and in vitro.

Results

In the present study, the expression of AC040169.1, a lncRNA, was first shown to be upregulated in OC. Mechanistically, low levels of METTL14 reduced the m6A modification of AC040169.1 and increased the stability of AC040169.1, mainly via the decreased recognition and binding abilities of the “reader” YTHDC2. The subsequently enhanced downstream target SLC7A11 promoted the malignancy and inhibited ferroptosis of OC cells.

Conclusions

our findings reveal that m6A modification upregulates lncRNA AC040169.1 expression, which inhibits ferroptosis and promotes OC progression. These findings provide both theoretical and experimental evidence supporting lncRNA AC040169.1 as an epigenetic biomarker and potential therapeutic target for OC.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13048-025-01922-w.

Introduction

Globally, ovarian cancer (OC) is the seventh most common cancer and the eighth leading cause of cancer-related deaths in women [1, 2]. Due to the lack of early screening and diagnostic indicators, approximately 75% of patients are diagnosed at advanced stages, and more than 70% relapse within 2 years and become chemotherapy resistant, thus posing a significant threat to the lives and health of women [3]. Therefore, it is particularly important to identify the key molecules related to the occurrence and development of OC.

Long noncoding RNAs (lncRNAs) are a class of RNAs > 200 nt in length that do not encode proteins or peptides [4, 5].However, they play a crucial role in the occurrence and development of cancer [6–8]. An increasing number of lncRNAs are being shown to function as oncogenes or tumour suppressors, playing regulatory roles in OC [9–12]. In recent years, some studies have shown that N6-methyladenine (m6A) can extensively modify lncRNAs, causing changes in the structural stability and expression level of such lncRNAs and downstream genes and promoting or inhibiting the occurrence and development of tumours [13]. As reported by Lyu et al., a hypoxic microenvironment was able to induce an increase in the expression of the m6A demethylase ALKBH5, which led to a decrease in the methylation and an increase in the stability of the lncRNA RMRP, thus promoting malignant phenotypes in OC cells [14].

Ferroptosis is a form of cell death that differs from apoptosis and other types of regulated cell death. Iron-dependent cell death is driven by an overload of lipid peroxides on the cell membrane [15]. Ferroptosis occurs when the cellular activities promoting ferroptosis obviously exceed the antioxidant buffering capacity provided by the ferroptosis defence system [16]. Accumulating studies have shown that ferroptosis synergizes with chemotherapy, radiotherapy and immunotherapy to inhibit the growth of OC cells and that targeting ferroptosis-related molecules in OC may be a new therapeutic approach [17, 18].

In this study, we identified the lncRNA AC040169.1 through bioinformatics analysis and demonstrated its upregulation in both OC cells and tissues. Furthermore, we revealed that the m6A “writer” METTL14 and the “reader” YTHDC2 are involved in the m6A modification of AC040169.1. More importantly, we discovered that AC040169.1 mediates SLC7A11 to promote ferroptosis and suppress the malignant phenotype of ovarian cancer cells.

Methods

Tissue samples collection

Thirty patients who were diagnosed as ovarian cancer (15 high-grade serous, 2 mucinous, 5 endometrioid and 8 clear cell carcinomas) in our hospital were enrolled in the present study. None of the patients had been treated by chemotherapy or radiation therapy before resection of the primary ovarian cancer. The study was approved by the Ethics Committee of the Second Affiliated Hospital of Kunming Medical University (2023 − 240), and informed consent was obtained from all patients. Tumor samples and according normal tissues were immediately frozen in liquid nitrogen and saved at − 80 ℃.

Cell culture and reagents

The human normal ovarian epithelial cell line IOSE80 and the human ovarian cancer cell OVCAR3 were obtained from the Kunming Institute of Zoology, Chinese Academy of Sciences (Kunming, China), and the human ovarian cancer cell lines A2780 and SKOV3 were purchased from the Sebachem Cell Bank (Shanghai, China). All cells were cultured in DMEM medium (Gibco, USA) supplemented with 10% foetal bovine serum (FBS) (Gibco, USA) and 1% penicillin/streptomycin (Gibco, USA) and incubated at 37 °C with 5% CO₂. All cells were subjected to short tandem repeat spectrometry for cell line identification and routine mycoplasma detection. Erastin (HY-15763), RAS-selective lethal 3 (RSL3, HY-100218 A), ActinomycinD (ActD, HY-17559) and 3-Deazaadenosine (3-DAA, HY-W013332A) were purchased from the MedChemExpress (Shanghai, China). Ferrostatin-1 (Fer-1, MB4718) and Chloroquine (CQ, MB1668) were purchased from the Meilunbio (Liaoning, China).

Cell transfection

For mechanism studies, interference fragments of LncAC040169.1 and YTHDC2 as well as overexpression fragments of METTL14 and SLC7A11 were transfected into cultured OVCAR3 cells using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s instructions. si-LncAC040169.1 (VB230730) and oe-METTL14 (VB2300823) were provided by VectorBuilder (Guangzhou, China), si-YTHDC2 (stB005681C) and oe-SLC7A11 (stB009681C) were purchased from RiboBio (Guangzhou, China). The siRNA sequences are as follows:

Gene	Position	SS Sequence	AS Sequence
si-AC040169.1-1	483	CAAGAAUAAAUGUGUUAAACU	UUUAACACAUUUAUUCUUGUU
si-AC040169.1-2	1369	ACAGAGACAUGUCUCUAUAGU	UAUAGAGACAUGUCUCUGUUG
si-AC040169.1-3	1590	GCUCCUAUAUGAUUCAAUAUG	UAUUGAAUCAUAUAGGAGCCG
si-YTHDC2-1	3268	CCUCAGAAGUACAAAGAUAGA	UAUCUUUGUACUUCUGAGGUG
si-YTHDC2-2	789	GCAAGAAGAGAAACAACAAAC	UUGUUGUUUCUCUUCUUGCUG
si-YTHDC2-3	1144	AGUCAAGUAGAACAGUUAAUC	UUAACUGUUCUACUUGACUUG

Reverse transcription quantitative real-time PCR (RT-qPCR)

Total RNA was extracted from tissues and cells using Trizol reagent (Vazyme) and all samples were reverse transcribed to cDNA. ChamQ SYBR qPCR Master Mix Kit (LABSELECT) and 7500 fluorescence quantitative PCR reactor (ABI, USA) were used for RT-qPCR. β-actin was used as an internal control gene. The expression of mRNA in the samples was calculated by the formula Folds = 2^−ΔΔCT. The primers were as follows:

Gene	Primer sequences
Lnc AC040169.1	F:5’ AGTCTGTGGCGGGAGGAT 3’
	R:5’ TAGGAGCCGAGCACTTTATG 3’
METTL14	F:5’ AAATGCTGGACTTGGGATG 3’
	R:5’ CCGTCTGTGCTACGCTTCA 3’
YTHDC2	F:5’CAGGGAAGACCATTTGAAGTA 3’
	R:5’ATCACCACCATCATCCAGTAA 3’
SLC7A11	F:5’ TCTGAGCGGCTACTGGGAAA 3’
	R:5’GAATAACCTGGAGACAGCAAACAC 3’
β-actin	F:5’ CGTGGACATCCGCAAAG 3’
	R:5’ AAGGTGGACAGCGAGGC 3’

Western blot assay

The cells were lysed in RIPA lysis buffer (Solarbio) containing PMSF and then quantified using a bicinchoninic acid (BCA) kit (Solarbio). Aliquots of protein samples were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a PVDF membrane (MerckMillipore). The membrane was blocked and incubated with anti-METTL14 (E2G9A, CST), anti-SLC7A11 (D2M7A, CST) and anti-βactin (D10A8, CST) overnight, and then incubated with the corresponding secondary antibodies Anti-Mouse IgG, HRP-linked (SA00001-1, Proteintech), Anti-Rabbit IgG, HRP-linked (SA00001-2, Proteintech), β-Actin Mouse mAb (HRP Conjugate) (66009-1-Ig, Proteintech). Finally, ImageJ software was selected to analyse the grey scale values of the protein bands.

Cell counting kit-8 assay

The cell viability was determined using Cell Counting Kit-8 (CCK-8, Uelandy). 2000 cells per well were cultured in 96-well plates with 3 replicate wells. Each well was spiked with 10 µl of CCK-8 reagent. After incubation for 1 h, the absorbance at 450 nm was detected by an enzyme labeller (ELX800).

Colony formation assay

The cells were made into cell suspension, and 200 cells per dish were added to the petri dish, placed in 37℃, 5% CO₂ incubator for culture, when visible clones appeared in the petri dish, the culture was terminated, and the culture solution was discarded, and the cells were washed with PBS (MeilunBio) for 3 times. 4% paraformaldehyde (Aladdin) was fixed for 30 min, and the cells were washed with PBS for 2 times, and the cells were stained with 0.1% crystal violet dye (Solarbio) for 10 min, and then washed off the dye with running water slowly and dried with air. Photographs were taken under a microscope (ECLIPSE, Nikon, Japan), image processing software using ImageJ.

Wound healing assay

The cells were inoculated in 6-well plates, cultured for 24 h and then transfected, after that, the culture was continued for 24 h, the tip of a 200 µl pipette was scratched in the center area of the 6-well plate, the cells were washed by PBS for 3 times, the scratched cells were removed, complete serum medium was added, and the cells were placed in 37℃ 5% CO₂ incubator. Photographs were taken under 100x microscope (ECLIPSE, Nikon, Japan) according to 0 h, 24 h,48 h time points. Image processing software using ImageJ.

Transwell assay

The upper chamber surface of the membrane at the bottom of the Transwell was coated with a 50 mg/L Matrigel 1:8 (250 µl) dilution, the basement membrane was hydrated, a cell suspension of 3 × 10⁴ cells/200 µl was taken and added to the transwell chamber, and the lower chamber of the 24-well plate was filled with 500 µl of complete medium containing FBS, and the cells were incubated in a 37 °C incubator for 24 h, after which 4% paraformaldehyde was added for fixation, stained with 0.1% crystal violet stain and photographed by microscope (ECLIPSE, Nikon, Japan). Image processing software using ImageJ.

Flow cytometric analysis

When OVCAR3 cells grew to 70% confluence, the cells in suspension were collected, and the cells on the dish were digested into single-cell suspension by trypsin (Hyclon, Logan, Utah, USA). All cells were collected and mixed with 5 µL Annexin V-FITC and 5 µL propidium iodide (PI) solution (KeyGEN, Nanjing, China) for 15 min at room temperature in the dark. Apoptosis rates were determined by a BD flow cytometer (Franklin Lakes, NJ, USA). For detection of cell cycle distribution, cells were digested, washed, and labeled with 5 µL PI solution and incubated in the dark for 30 min and then measured the cell cycle distribution with a BD flow cytometer (Franklin Lakes, NJ, USA).

Assessment of ferroptosis

To assess the level of ferroptosis in OC cells and tissues, we evaluated the reactive oxygen species (ROS) levels, Fe²⁺ content, total iron content, and mitochondrial morphological changes in cells. Precisely, ROS levels in cells were detected using the reactive oxygen species fluorescent probe DHE (Keygentec) and fluorescence microscopy (Nikon, Japan); cellular iron content assay kit (BC5315, Solarbio) and cellular ferrous ion assay kit (BC5415, Solarbio) according to the manufacturer’s instructions for detection of Fe²⁺, total iron concentration; Transmission electron microscopy (JEM-1400flash, Japan) was used to observe the morphological changes of mitochondria in transplanted tumor tissues of nude mice.

Methylated RNA Immunoprecipitation sequencing (MeRIP-seq)

Total RNA was isolated and purified using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND-1000 (NanoDrop, Wilmington, DE, USA), and the RNA integrity was assessed by Bioanalyzer 2100 (Agilent, CA, USA). Poly (A) RNA was purified from 50 µg total RNA using Dynabeads Oligo (dT) 25–61005 (Thermo Fisher, CA, USA) by two rounds of purification. Then the poly (A) RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module (NEB, cat.e6150, USA) under 86℃ 7 min. The cleaved RNA fragments were incubated for 2 h at 4℃ with m6A-specific antibody (No. 202003, Synaptic Systems, Germany) in IP buffer (50 mM Tris-HCl, 750 mM NaCl and 0.5% Igepal CA-630). The IP RNA was reverse-transcribed to cDNA by SuperScript™ II Reverse Transcriptase (Invitrogen, cat. 1896649, USA), which was next used to synthesise U-labeled second-stranded DNAs with E. coli DNA polymerase I (NEB, cat.m0209, USA), RNase H (NEB, cat.m0297, USA) and dUTP Solution (Thermo Fisher, cat. R0133, USA). An A-base was added to the blunt ends of each strand, preparing for ligation to the indexed adapters. Dual-index adapters were ligated to the fragments, and size selection was performed with AMPureXP beads. After the heat-labile UDG enzyme (NEB, cat.m0280, USA) treatment of the U-labeled second-stranded DNAs, the ligated products were amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 s, annealing at 60℃ for 15 s, and extension at 72℃ for 30 s; and then final extension at 72℃ for 5 min. At last, we performed paired-end sequencing (PE150) on an Illumina Novaseq^TM6000 platform following the vendor’s recommended protocol.

RNA immunoprecipitation (RIP)

RIP assay was performed using the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Magna,17–700) according to the instructions. In brief, the cells were washed with PBS, RIPA lysis buffer was added, extracts were collected and incubated with YTHDC2 antibody and protein A/G beads overnight at 4 °C. Once specific proteins were captured, we obtained protein-RNA complexes and digested all cell samples with proteinase K to extract their RNA molecules. Finally, we isolated the RNA samples and performed PCR to detect the expression of the target lncRNA.

OC nude mice xenograft model

10 BALB/c (nu-nu) female nude mice (21d) were randomly divided into two groups (NC group and si-AC040169.1 group). For the xenograft tumor model, OVCAR3 cells were divided into two experimental groups: (1) the negative control group (si-NC) transfected with non-targeting control siRNA, and (2) the knockdown group (si-AC040169.1) transfected with AC040169.1-targeting siRNA. Cells (1 × 10⁷ cells/ml, 0.1 ml suspension) from each group were subcutaneously injected into the right axilla of nude mice to establish the transplantation tumor model. Tumor weight and volume were measured weekly. After 4 weeks of incubation, the tumor tissues were taken and the weight was measured. All operations on laboratory animals were performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Animal Ethics Committee of the Second Affiliated Hospital of Kunming Medical University (kyfey2023069).

Immunohistochemical (IHC) analysis

The tissue samples were embedded, sectioned into 5 μm thick slices and stained with SLC7A11 primary antibody (1:100, CST). All immunohistochemical staining procedures were performed according to standard protocols. Stained sections were examined and imaged using a microscope. The degree of staining was scored under the light microscope, taking into account the proportion of positively stained cells and the intensity of staining. Scoring was based on the proportion of positively stained cells (0 = negative, 1 = 1–25% of cells, 2 = 26–50% of cells, 3 = 51–75% of cells, and 4 = 76–100% of stained cells) and the intensity of staining (no staining 0, weakly staining 1, moderately staining 2, strongly staining 3). The final score was positive cell score × staining intensity.

Statistics

All data represent at least three independent experiments. Statistical analyses were performed using GraphPad Prism (version 9.1.0) software. All data were expressed as mean ± SD. T-test was used for comparison of two groups. One-way analysis of variance ANOVA followed by Dunnett’s post hoc test were used for multiple comparisons. P < 0.05 was considered statistically significant.

Results

The expression of AC040169.1 is increased in OC, METTL14 and YTHDC2 are its potential interacting proteins

To investigate potential lncRNAs with regulatory roles in OC, we first mined the TCGA database (https://portal.gdc.cancer.gov/, TCGA-OV cohort) and identified 10 lncRNAs that were differentially expressed in normal ovarian tissues and OC. The expression levels of AL035810.1, AC015912.3, and AC040169.1 were significantly elevated and not systematically reported. Among them, AC040169.1 had the most obvious elevated expression level (|LogFC|=1.35) (Fig. 1A and S1A), so we chose it as the target lncRNA for further study. Subsequently, we used RT‒qPCR to assess AC040169.1 expression and found that AC040169.1 expression was significantly increased in all the tested OC cell lines (OVCAR3, SKOV3, A2780) and OC tissues (Fig. 1B‒C). Survival analysis revealed no significant difference in overall survival between patients with high or low AC040169.1 expression (Fig. 1D). AC040169.1 is located on the long arm of chromosome 16 (Figure S1B). Using the lncATLAS database, we predicted that AC040169.1 would localize primarily to the cytoplasm of cells (Figure S1C). To identify m6A-related interacting proteins of AC040169.1, we first compiled 21 m6A regulators from literature [19] (Table 1) and 7,255 °C differentially expressed genes (DEGs) (|logFC|≥1) from UCSC Xena (Fig. 1E). Intersection analysis yielded 13 °C-associated m6A regulators (Fig. 1F), with IGF2BP2, YTHDF1 and YTHDF2 upregulated and others downregulated (Fig. 1G). Pearson analysis revealed negative correlations between AC040169.1 and six regulators (METTL14, METTL16, WTAP, HNRNPA2B1, YTHDC1, YTHDC2; P < 0.05) but no correlation with others (P > 0.05) (Figure S1D). RPISeq database prediction identified METTL14 and YTHDC2 as potential AC040169.1-interacting proteins (RF/SVM scores > 0.5) (Fig. 1H).

Fig. 1.

Elevated expression of AC040169.1 in OC and its association with m6A regulators. A Volcano map of differentially expressed genes (DEGs) in OC in TCGA database. B RT-qPCR was used to detect AC040169.1 expression in normal ovarian epithelial cell line IOSE80 and OC cell lines OVCAR3, SKOV3, and A2780. C RT-qPCR was used to detect AC040169.1 expression in normal ovarian tissues and OC tissues. D Survival analysis of AC040169.1 in the TCGA database. E OC DEGs from UCSC Xena database. F Venn diagram of OC DEGs and 21 m6A-related regulators. G Expression patterns of 13 m6A regulators in OC. H RPISeq-based prediction of potential AC040169.1-interacting proteins (METTL14 and YTHDC2).(^*P < 0.05,^**P < 0.01,^***P < 0.001)

Table 1.

Literature-reported m6A RNA methylation regulators (n = 21)

Gene	Ensembl ID	Type
METTL3	ENSG00000165819	Writers
METTL14	ENSG00000145388	Writers
METTL16	ENSG00000127804	Writers
ZC3H13	ENSG00000123200	Writers
WTAP	ENSG00000146457	Writers
RBM15	ENSG00000162775	Writers
VIRMA	ENSG00000164944	Writers
RBMX	ENSG00000147274	Readers
YTHDC1	ENSG00000083896	Readers
YTHDC2	ENSG00000047188	Readers
YTHDF1	ENSG00000149658	Readers
YTHDF2	ENSG00000198492	Readers
YTHDF3	ENSG00000185728	Readers
IGF2BP1	ENSG00000159217	Readers
IGF2BP2	ENSG00000073792	Readers
IGF2BP3	ENSG00000136231	Readers
HNRNPC	ENSG00000092199	Readers
HNRNPA2B1	ENSG00000122566	Readers
FTO	ENSG00000140718	Erasers
ALKBH3	ENSG00000166199	Erasers
ALKBH5	ENSG00000091542	Erasers

METTL14 promotes the m6A methylation of AC040169.1 and regulates AC040169.1 expression

METTL14 is an m6A methyltransferase that enables target RNA to undergo m6A methylation modification [20]. Studies have revealed that METTL14 is aberrantly expressed in various cancers and participates in tumorigenesis and progression through multiple mechanisms [21]. We used RT‒qPCR and Western blot assays to assess the METTL14 expression level. Compared to that in normal ovarian cells, METTL14 expression was significantly lower in OVCAR3、SKOV3 cell lines (Fig. 2A-B). Next, we investigated the upstream regulator of AC040169.1 and how it works. Then, we generated a transcriptome-wide m6A map of control and oe-METTL14 groups using MeRIP-seq and RNA-seq. We found that 42.3% of the control genes and 41.4% of the experimental genes had only one m6A peak, whereas a small proportion of the genes had two or more m6A peaks in both groups (Figure S2A). We analysed the most prominent peaks in each group, the GGAC motif was highly enriched at m6A sites (Fig. 2C). Then, we analysed the distribution pattern of m6A throughout the transcriptome and found that most of the m6A reads appeared in untranslated regions (UTRs) near the start and stop codons (Figure S2B); the metagene profiles of the m6A peaks were investigated, and similar results were obtained (Figure S2C). Then, by mapping the IGV peaks through the Integrated Genomics Viewer, we found that the m6A methylation level of the AC040169.1 coding sequence (CDS) significantly increased after METTL14 overexpression (Fig. 2D). Moreover, three m6A modification sites in AC040169.1 were predicted using IGV (Fig. 2E), and the AGACT motif at position 380 was consistent with that predicted in the online database SRMAP (http://www.cuilab.cn/sramp) (Fig. 2F and Figure S2D). According to the combined MeRIP-seq and RNA-seq analysis, the level of AC040169.1 m6A methylation was greater and the AC040169.1 transcription level was lower in the oe-METTL14 group than in the control group (Fig. 2G).

Fig. 2.

METTL14-mediated m6A modification suppresses AC040169.1 expression in OC. RT-qPCR (A) and WB (B) were used to detect METTL14 expression in normal ovarian epithelial cell line IOSE80 and OC cell lines OVCAR3, SKOV3, and A2780. C Consensus motif map with MeRIP-seq peaks identified by HOMER in OVCAR3 cells after METTL14 overexpression. D IGV map from MeRIP-seq showed that AC040169.1 m6A methylation levels were significantly increased in OVCAR3 cells overexpressing METTL14. E IGV software predicted the m6A modification site of AC040169.1. F The online database SRMAP predicted the m6A modification site of AC040169.1. G Four-quadrant diagram of the conjoint analysis of MeRIP-seq and RNA-seq. H lncAC040169.1 levels in OVCAR3 cells treated with different concentrations (0.3µM, 0.6µM, 1.2µM, 2.4µM) of 3-DAA were detected by RT-qPCR. (I) METTL14 was overexpressed in OVCAR3 cells and AC040169.1 level was detected by RT-qPCR. (^*P < 0.05,^**P < 0.01,^***P < 0.001)

To validate the above results, we assessed AC040169.1 expression by RT‒qPCR after treatment with different concentrations of the methylation inhibitor 3-DAA, which blocks m6A modification of RNAs by decreasing S-adenosyl-L-methionine (SAM) [22, 23]. The results showed that AC040169.1 expression increased with increasing concentrations of 3-DAA (Fig. 2H). In addition, AC040169.1 expression was assessed after METTL14 overexpression (Figure S2E); as expected, AC040169.1 expression was significantly reduced in the oe-METTL14 group (Fig. 2I). Thus, we concluded that METTL14 reduces the expression of AC040169.1, likely through m6A methylation-dependent mechanisms, as supported by the increased m6A methylation peaks in AC040169.1 and the upregulation of AC040169.1 expression upon 3-DAA treatment.

YTHDC2 can bind and reduce the expression of AC040169.1

YTHDC2 is a well-known “reader” that determines the fate of m6A modifications and can recognize, selectively bind and interact with RNA containing m6A modifications, thereby regulating RNA fate and function [24, 25]. Bioinformatics data showed that YTHDC2 was negat ively correlated with AC040169.1 (Fig. 1D). We then used RT‒qPCR to assess AC040169.1 expression. YTHDC2 knockdown efficiency is shown in Figure S3A. YTHDC2 knockdown significantly increased AC040169.1 expression (Fig. 3A). Moreover, we assessed AC040169.1 levels at 0 h, 4 h, and 8 h after treatment with actD (0.4 µM), which inhibits intracellular RNA synthesis. The results showed that YTHDC2 knockdown significantly reduced the degradation rate of AC040169.1 (Fig. 3B). These results suggested that YTHDC2 was able to degrade AC040169.1, thus reducing its stability. To better understand the recognition and binding of YTHDC2 to AC040169.1 after METTL14-mediated m6A modification, we used RIP followed by RT‒qPCR. As expected, the binding of YTHDC2 to AC040169.1 significantly increased after METTL14 overexpression (Fig. 3C). Finally, we concurrently upregulated METTL14 expression and downregulated YTHDC2 expression, and RT‒qPCR was used to assess AC040169.1 expression. The results showed that the reduction in the AC040169.1 level caused by METTL14 overexpression could be reversed by YTHDC2 knockdown (Fig. 3D). Taken together, the above data revealed that METTL14 can increase the m6A methylation level of AC040169.1, which leads to an increase in the recognition and binding of AC040169.1 by the “reader” YTHDC2, thus reducing the expression level of AC040169.1.

Fig. 3.

YTHDC2 binds to m6A-modified AC040169.1 and promotes its degradation in OC. A YTHDC2 was knocked down in OVCAR3 cells and the level of AC040169.1 was detected by RT-qPCR. B The level of AC040169.1 was detected in each group by RT-qPCR at 0 h,4 h,8 h after treated with actD (0.4 µM). C RIP assay was performed to detect the binding of YTHDC2 and lncAC040169.1 upon overexpression of METTL14. D METTL14 was up-regulated while YTHDC2 was down-regulated, and then the expression of AC040169.1 was detected by RT-qPCR. (ns: not significant, ^*P < 0.05,^***P < 0.001,^##P < 0.01,^###P < 0.001)

AC040169.1 can promote cancer malignancy in OC cells

To further investigate the biological functions of AC040169.1 in OC, we employed CCK8, colony formation, Transwell and wound healing assays to explore various OC biological behaviours using OVCAR3 cells as a research model. AC040169.1 knockdown efficiency is shown in Figure S4A, and the best interference efficiency, si-AC040169.1-1, was selected for subsequent experiments. As shown in Fig. 4A, CCK-8 assays revealed that AC040169.1 knockdown significantly reduced cell viability compared to the control group. Similarly, colony formation assays demonstrated a marked decrease in the number of colonies formed by AC040169.1-knockdown cells (Fig. 4B), indicating impaired proliferative capacity. Furthermore, Transwell assays showed that AC040169.1 knockdown significantly suppressed cell invasion (Fig. 4C), while wound healing assays revealed a notable reduction in cell migration ability (Fig. 4D). These in vitro findings were further supported by in vivo experiments using a xenograft mouse model. As depicted in Fig. 4E, knockdown of AC040169.1 led to a significant slowdown in tumor growth, accompanied by a reduction in both tumor weight and volume. Collectively, these results demonstrate that AC040169.1 plays a critical role in promoting OC cell proliferation, invasion, migration, and tumor growth, suggesting its potential as a therapeutic target in OC.

Fig. 4.

Knockdown of AC040169.1 suppresses proliferation, invasion, migration, and tumor growth in OC. CCK8 (A), colony formation (B), Transwell (C) and wound healing (D) assays to detect the cell viability, colony formation, invasion, and migration ability of OVCAR3 cells in Control, si-NC, and si-AC040169.1 groups; (E) Representative images of xenografts, tumor weights and tumor volumes in nude mice 28 days after subcutaneous injection of OVCAR3 cells with si-AC040169.1 or si-NC (n = 5 per group). The tumor volumes were measured every 7 days. ༈ns: not significant, ^*P < 0.05,^***P < 0.001༉

AC040169.1 can inhibit ferroptosis in OC cells

To explore the effect of AC040169.1 on the mode of cell death in OC cells, we performed GO and KEGG analyses and further revealed that the differentially expressed genes (DEGs) between the AC040169.1 high- and low-expression groups were related to mitochondrial respiratory chain complex assembly, translation and oxidative phosphorylation (Fig. 5A-B). Studies have shown that changes in mitochondrial morphology and function are closely related to cell death [26]. To identify the mode of cell death induced by AC040169.1, we constructed OC cell lines with low expression of AC040169.1, OVCAR3 cell viability was assessed after treatment with different concentrations of the ferroptosis inhibitor Ferrostatin-1 (Fer-1) and the autophagy inhibitor Chloroquine (CQ). The results show that the decrease in cell viability induced by AC040169.1 knockdown was reversed by Fer-1, and cell viability increased with increasing concentrations of the inhibitor (Fig. 5C), however, this phenomenon was not observed in CQ-treated cells (Figure S5A). Therefore, we hypothesized that knockdown of AC040169.1 in OC cells could enable the cells to undergo ferroptosis. To further confirm this speculation, we measured intracellular ROS, Fe²⁺ and total iron levels in OVCAR3 cells after treatment with the ferroptosis inducer erastin (2µM); as expected, AC040169.1 knockdown significantly increased these levels (Fig. 5D-F). In addition, we used transmission electron microscopy to observe mitochondria in the tumour cells of nude mice, and the results showed that cells in the si-AC040169.1 group underwent ferroptosis-like mitochondrial destruction, including a significant increase in mitochondrial membrane density, mitochondrial crista breakage, reduction or disappearance, and a reduction in mitochondrial volume (Fig. 5G). Moreover, the Fe²⁺ and total iron concentrations were significantly greater in the si-AC040169.1 group (Fig. 5H-I). These data clearly suggested that AC040169.1 could inhibit ferroptosis in OC.

Fig. 5.

AC040169.1 knockdown promotes ferroptosis in OC cells. GO (A) and KEGG (B) analyses of DEGs in high and low expression groups of AC040169.1 in TCGA database. (C) Cells were treated with different concentrations (0.5µM, 1µM, 2µM, 4µM) of Fer-1, cell viability was detected by CCK8 assay after 1 h; (D) Cells were treated with 2µM of erastin, and fluorescence microscopy to detect ROS levels in different groups of cells. Cells were treated with 2µM of erastin, and an iron assay kit was used to detect cellular Fe²⁺ (E) and total iron concentrations (F). G Representative transmission electron micrographs of nude mice transplanted tumor tissues. Iron assay kit was used to detect nude mice transplanted tumor tissues for Fe²⁺ (H) and total iron concentrations (I) (^**P < 0.01,^***P < 0.001)

AC040169.1 can mediate SLC7A11, promote malignancy and inhibit ferroptosis in OC cells

Among the DEGs in the TCGA-OV cohort, we found that ferroptosis-related SLC7A11 expression was increased in OC tissues and was positively correlated with AC040169.1 (Figure S6A-B). We used RT‒qPCR and Western blot assays to assess the SLC7A11 expression level. Compared to that in normal ovarian cells, SLC7A11 expression was higher in OC cell lines (Fig. 6A-B). After knocking down AC040169.1, mRNA and protein levels of SLC7A11 were significantly reduced (Fig. 6C). Similarly, in vivo, IHC analysis revealed that SLC7A11 expression decreased after AC040169.1 was knocked down (Fig. 6D). These data suggested that AC040169.1 could upregulate the expression of SLC7A11 in OC. Then, we performed CCK-8, colony formation, Transwell, wound healing and flow cytometry assays. Validation of SLC7A11 overexpression is shown in Figure S6C. The results confirmed that the effects of AC040169.1 knockdown on cell viability, migration, invasion, and apoptosis and the cell cycle could be reversed by SLC7A11 overexpression (Fig. 6E-J). These results suggested that AC040169.1 could upregulate SLC7A11 expression to promote malignant phenotypes in OC. Finally, a CCK-8 assay was used to assess cell viability in different groups after treatment with the ferroptosis inducers erastin (2 µM) and RSL3 (100 nM). The results showed that cell viability was significantly greater in the si-AC040169.1 + oe-SLC7A11 group than in the si-AC040169.1 group (Fig. 6K). Consistently, we found that the increases in ROS, Fe²⁺ and total iron content induced by AC040169.1 knockdown could be reversed by SLC7A11 overexpression (Fig. 6L-M). These results demonstrate that lncRNA AC040169.1 suppresses ferroptosis by upregulating SLC7A11 expression, thereby promoting malignant behaviors including migration and invasion in OC cells.

Fig. 6.

AC040169.1 upregulates SLC7A11 to inhibit ferroptosis and promote malignant progression in OC. RT-qPCR (A) and WB (B) were used to detect SLC7A11 expression in normal ovarian epithelial cell line IOSE80 and OC cell lines OVCAR3, SKOV3, and A2780. C RT-qPCR and WB were used to detect the mRNA and protein levels of SLC7A11 in OVCAR3 cells. D Representative images of SLC7A11 protein staining of tumor tissue sections of nude mice in si-NC and si-AC040169.1 groups by immunohistochemistry, scale bars = 20 µM. E CCK8 assay to detect cell viability of OVCAR3 cells. F Colony formation assay to detect clone forming ability of OVCAR3 cells. G Transwell assay to detect invasive ability of OVCAR3 cells. H Wound healing assay to detect migratory ability of OVCAR3 cells at 0 h, 24 h, 48 h. I Flow cytometry to detect apoptosis. J Flow cytometry to detect cell cycle. K Cells were treated with erastin (2µM) and RSL3(100nM) respectively, then cell viability was detected by CCK8 assay. L Fluorescence microscopy to detect cellular ROS levels in different groups. M Iron assay kit to detect cellular Fe²⁺ and total iron concentration. (^*P < 0.05,^**P < 0.01,^***P < 0.001,^##P < 0.01,^&&P < 0.01)

Discussion

OC is the most lethal malignancy of the female reproductive system, with 75% of patients diagnosed at an advanced stage (FIGO III–IV) and presenting with distant metastases [27, 28]. The global five-year survival rate remains as low as 30%–40%, posing a significant threat to women’s health and lives [29]. Thus, there is an urgent need to identify reliable early diagnostic approaches and develop novel therapeutic strategies for ovarian cancer. lncRNAs are RNA molecules that are more than 200 nucleotides in length. They play a dynamic role in gene expression and various physiological and pathological processes as emerging regulators, despite having no or limited protein-coding capacity [4]. There is mounting evidence that lncRNAs play a crucial role in cancer development and progression by acting as either oncogenes or tumour suppressors; they regulate various aspects of cancer cells, including proliferation, differentiation, invasion, metastasis, chemoresistance, and metabolic reprogramming. As a result, lncRNAs have the potential to be targets for cancer therapy [30]. For example, the expression of the lncRNA RAF157-AS1 is upregulated in OC and promotes the proliferation, invasion and migration of OC cells [31]. The lncRNA SPOCD1-AS, found in OC extracellular vesicles, remodels mesothelial cells and promotes the peritoneal metastasis of OC by interacting with G3BP1 [32]. The lncRNA UCA1 regulates the response of OC to chemotherapy by controlling the level of UBE2N through direct binding to miR-27a-5p [33]. In this study, we identified that lncRNA AC040169.1 was significantly upregulated in OC cells and tissues. Functionally, AC040169.1 acted as an oncogene to promote OC cell proliferation, invasion, and migration. In vivo, AC040169.1 knockdown markedly suppressed tumor growth, accompanied by reduced tumor weight and volume. This finding aligns with the work of Hua et al. (2022) [34], who identified AC040169.1 as a homologous recombination deficiency (HRD)-associated lncRNA in epithelial ovarian cancer (EOC) and highlighted its prognostic potential for predicting responses to PARP inhibitors and immunotherapy. However, our survival analysis using TCGA OC data showed that while patients with high AC040169.1 expression tended to have poorer outcomes compared to low-expression groups, this trend did nt reach statistical significance (P = 0.24). Several factors may explain this discrepancy: tumor heterogeneity across diverse OC subtypes (e.g., high-grade serous vs. endometrioid) potentially diluting the prognostic effect, context-dependent regulation through protein interactions or subcellular localization that may override expression-level effects, and technical variables including RNA-seq batch effects or follow-up duration differences in TCGA data. Despite the lack of statistical significance in the TCGA cohort, our functional assays unequivocally demonstrate AC040169.1’s tumor-promoting effects, suggesting its clinical relevance may extend beyond pure expression-survival correlations. Further studies with larger, subtype-stratified cohorts are needed to clarify its prognostic utility. Together, these findings underscore AC040169.1’s potential as a therapeutic target and highlight the complexity of lncRNA-mediated regulation in cancer progression.

N6-methyladenosine (m6A) is the most common RNA modifier found in eukaryotes and plays a crucial role in RNA translation, transportation, stability, degradation, splicing and processing [34]. Recent studies have shown that m6A has a wide range of modifying effects on lncRNAs. These modifications cause changes in the structural stability and expression levels of lncRNAs and downstream target genes; as a result, they affect cell growth and differentiation and can promote or inhibit tumorigenesis and progression [13, 35, 36]. m6A modifies and affects lncRNAs through dynamic interactions between three homologous factors, writers (methyltransferases), readers (binding proteins), and erasers (demethylases) [20]. METTL14 acts as the “writer” of m6A modification and is a core component of the METTL3-METTL14 methyltransferase complex, which contributes to m6A methylation of target RNAs [37]. Several studies have reported that decreased levels of METTL14 in tumours result in reduced levels of lncRNA m6A methylation, which regulates the levels of lncRNAs and downstream target genes in a m6A-modified manner. For example, LIU et al. reported that the expression of METTL14 was decreased in renal cancer, resulting in a decrease in the m6A level of the lncRNA NEAT1. This, in turn, led to a decrease in the recognition of the m6A-modified lncRNA NEAT1 by YTHDF2, causing a decrease in degradation and an increase in the expression of the lncRNA NEAT1, consequently promoting the growth and metastasis of renal cancer cells [38]. Yang et al. reported similar results in colorectal cancer, where the downregulation of METTL14 expression led to the increased expression of the lncRNA XIST, which promoted tumour proliferation and metastasis [39]. Similar to previous findings, we observed downregulated METTL14 expression in OC cells. Overexpression of METTL14 enhanced m6A methylation of lncRNA AC040169.1, leading to its reduced expression.

YTHDC2 promotes target mRNA translation by recognizing m6A residues in the protein-coding region (via YTH motifs), while it mediates mRNA deadenylation and reduces RNA stability/abundance by binding m6A sites in the 3’UTR [40]. Thus, the regulatory outcome of YTHDC2 on target transcripts is determined by the positional context of its bound m6A sites. In our study, we demonstrated that YTHDC2 binds to lncRNA AC040169.1, and METTL14 enhances this interaction, leading to increased degradation, reduced stability, and decreased expression of AC040169.1. We identified a predicted m6A modification site “AGACU” in AC040169.1, though whether YTHDC2 recognizes this site to promote its degradation requires further investigation. Collectively, we propose that elevated AC040169.1 levels in OC cells result from METTL14 downregulation, which reduces m6A methylation, thereby diminishing YTHDC2-mediated recognition, binding, and degradation of AC040169.1, ultimately increasing its stability and expression.

In addition, we demonstrated both in vivo and in vitro that AC040169.1 was able to prevent ferroptosis in OC cells. Ferroptosis is a novel type of programmed cell death characterized by lipid peroxidation, the abnormal accumulation of excess iron and altered mitochondrial morphology [41]. Emerging evidence has demonstrated that several lncRNAs participate in the regulation of ferroptosis, thereby modulating tumor progression [42–45]. Solute Carrier Family 7 Member 11 (SLC7A11) is a multichannel transmembrane protein that mediates the activity of cystine/glutamate anti-transporter proteins, which can transport cystine into cells for glutathione biosynthesis, thus achieving antioxidant defence and inhibiting cellular ferroptosis [46]. SLC7A11 is overexpressed in a variety of human cancers and promotes tumour cell growth by inhibiting ferroptosis [47–50]. In line with existing reports, we observed SLC7A11 overexpression in OC. LncRNA AC040169.1 was found to upregulate SLC7A11, which suppressed ferroptosis and subsequently enhanced oncogenic behaviors (proliferation/migration) and tumor progression. However, the precise molecular mechanism by which lncRNA AC040169.1 upregulates SLC7A11 remains to be elucidated and warrants further investigation.

However, this study has several limitations that should be acknowledged. First, during the overexpression and knockdown experiments of METTL14 and YTHDC2, we only assessed transfection efficiency by RT-qPCR without examining protein levels by WB. Future studies should incorporate these additional protein-level validations. Second, the functional experiments were performed only in the OVCAR3 cell line, which may limit the generalizability of our findings to other OC models. While this approach allowed us to maintain experimental consistency and focus on mechanistic depth, future studies should validate these results in additional cell lines or patient-derived models to confirm broader applicability. Additionally, although we identified that AC040169.1 upregulates SLC7A11 expression, the precise molecular mechanism remains unclear and warrants further investigation. We are actively pursuing these follow-up investigations to address this gap.

Conclusions

In summary, our study revealed that the downregulation of the m6A methyltransferase METTL14 leads to reduced recognition and binding of the reader protein YTHDC2 to the LncRNA AC040169.1, resulting in increased stability and consequently elevated expression of LncRNA AC040169.1 in OC. LncRNA AC040169.1 mediates SLC7A11, promoting malignant phenotypes, while inhibiting ferroptosis in OC cells. This study provides a theoretical basis and experimental foundation for considering AC040169.1 as a potential new epigenetic marker of OC tumours and potential target for the treatment of OC.

Abbreviations

OC

Ovarian cancer

lncRNAs

Long noncoding RNAs

m6A

N6-methyladenosine

FBS

Foetal bovine serum

RSL3

RAS-selective lethal 3

ActD

ActinomycinD

3-DAA

3-Deazaadenosine

Fer-1

Ferrostatin-1

CQ

Chloroquine

RT-qPCR

Reverse transcription quantitative real-time PCR

BCA

Bicinchoninic acid

CCK-8

Cell Counting Kit-8 assay

PBS

Phosphate buffer saline

ROS

Reactive oxygen species

MeRIP-seq

Methylated RNA immunoprecipitation sequencing

RIP

RNA immunoprecipitation

IHC

Immunohistochemical

TCGA

The Cancer Genome Atlas

UTRs

Untranslated regions

CDs

Coding sequence

IGV

Integrative Genomics Viewer

Authors’ contributions

Huilin Yang performed most of the experiments and analysed the data. Longyan Zhu carried out the animal experiments. Ying Dong helped design experiments and provided technical assistance. Rongji Li conducted bioinformatics analysis and performed part of the experiments. Lihua Yang conceived the project, directed the research. Huilin Yang and Ying Dong co-wrote the manuscript. Ying Dong and Lihua Yang accessed and verified the data. Lihua Yang was responsible for the decision to submitthe manuscript. All authors read and approved the final version of the manuscript.

Funding

This study was supported by grants of the Second Affiliated Hospital of Kunming Medical University External Collaborative Research Project (No.2022dwhz06), the National Natural Science Foundation of China (No.82360579), the Kunming Medical University Joint Special Project - Key Project (No.202401AY070001-053), Yunnan Revitalization Talent Support Program (No.YNWR-MY-2019-037), Kunming Medical University graduate Student Innovation Fund (No.2024S282).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The study using clinical samples was approved by the Ethics Committee of the Second Affiliated Hospital of Kunming Medical University (2023 − 240). Informed consent was obtained from all patients or their relatives. All operations on laboratory animals were performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Animal Ethics Committee of the Second Affiliated Hospital of Kunming Medical University (kyfey2023069).

Consent for publication

All authors agree with the manuscript content.

Competing interests

The authors declare no competing interests.