Abstract
BACKGROUND
The WX gene encodes the granule‐bound starch synthase I or waxy protein, which is the sole enzyme responsible for amylose synthesis in wheat seeds. Wild einkorn wheat (Triticum monococcum L. ssp. aegilopoides Link em. Thell.) could be an important source of variation for this gene.
RESULTS
This study assessed the WX gene variability in 14 accessions representative of the variation for waxy proteins detected in a collection of 170 accessions and compared their nucleotide sequences with the Wx‐A1a allele of common wheat (cv. Chinese Spring). Thirteen different alleles were found in this species, of which 11 were novel (Wx‐A m 1c to Wx‐A m 1m). A comparison between the deduced proteins from the novel alleles and the Wx‐A1a protein showed that there were up to 35 amino acid changes in both the transit peptide and the mature protein; some of them exhibited deleterious effects on the enzymatic function of these proteins.
CONCLUSION
The results obtained in the present study show that this species could be a potential source of new waxy variants. © 2025 The Author(s). Journal of the Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.
Keywords: amylose content, genetic polymorphism, waxy proteins, wild einkorn
INTRODUCTION
Wheat is a staple food in the human diet. 1 The qualities of the products developed from it are the result of the interaction of different grain components and characteristics, particularly the seed storage proteins, starch and grain hardness (determined by the puroindolines). 2 , 3 , 4 Among these components, starch is the main grain component in cereals and their relatives, and its composition (amylose/amylopectin ratio) clearly influences flour properties such as starch gelatinization, pasting and gelation. 5 This ratio is closely related to the amylose synthesis; therefore, the activity of the granule‐bound starch synthase (GBSS or waxy protein; EC 2.4.1.21), the sole enzyme involved in the amylose synthesis, is key in this process. 6
Waxy proteins are synthesized by the WX genes, located on the short arm of chromosome 7 of each wheat genome, with the exception of the WX‐B1 gene, which is located on chromosome 4AL as a result of a translocation generated during the wheat polyploidization. 7 The variation in these proteins has a clear influence on the amylose content of the grain and, consequently, on the starch properties. 8 , 9 This variation may be due to the total or partial absence of the enzyme by the deletion of the WX gene. However, in some cases, the genomic sequence is conserved but this is untranslated because of the presence of stop codons or the insertion of transposon‐like sequences through the coding sequence. 2 Furthermore, although less frequent, modifications in the quantity or functionality of this enzyme because of aberrant splicing have also been found. 10
In common wheat, the variation for each WX gene is clearly asymmetric, with variation high being for the WX‐B1 gene, medium for the WX‐A1 gene and low for the WX‐D1 gene. 2 Consequently, the search for additional variation with respect to this gene in old materials or wheat relatives could be useful. Among these wild wheat relatives, the diploid species of the Triticum genus are good candidates as variant donors for interesting genes. 11 The main species of wild diploid wheat are Triticum monococcum L. ssp. aegilopoides (Link) Thell. (syn. Triticum boeoticum Boiss.), ancestor of cultivated einkorn (Triticum monococcum L. spp. monococcum L.), and Triticum urartu Thum. ex Gandil., which is the A genome donor in the polyploid wheats. 12 Both species diverged 0.5–1 million years ago from a common ancestor, 13 and each species now has a different genome: Am for T. monococcum ssp. aegilopoides and Au for T. urartu. For this reason, the hybrids between both species are almost sterile. 14 In parallel, both cultivated and wild einkorn show low crossability with durum and common wheat, 15 probably as a result of the notable differences generated during the evolution and domestication events between the Am and Au genomes.
An alternative means for the introgression of the interesting traits from these species into polyploid wheats has been the development of amphiploids by crossing and chromosome duplication with tetraploid wheats 16 , 17 , 18 : ‘durococcum’ when the species used is durum wheat [Triticum turgidum ssp. durum (Desf.) Husn.] or ‘timococcum’ if it is timophevi wheat [Triticum timopheevii (Zhuk.) Zhuk ssp. timopheevii]. These synthetic hexaploid wheats present some interesting traits and could be used as a bridge to transfer characteristics to other hexaploid wheats. 11 , 19 However, before developing these synthetic wheats, it is necessary to identify and characterize the variability from the diploid parent that could be transferred. Therefore, the evaluation and characterization of the allelic variants present in cultivated or wild einkorn would be essential for the success of this process.
In a previous study, 20 with the aim of determining the potential of this species for wheat quality improvement, 170 wild einkorn accessions were evaluated to determine the variation for three grain components that define grain quality: seed storage proteins, starch synthases and puroindolines. This evaluation allowed the development of a mini‐core collection of 14 accessions representative of the variability detected for these three grain components. The characterization of this variability allowed the determination of the potential properties of each detected variant and an evaluation of its usefulness, prior to its introgression into cultivated wheat.
The main goal of the present study was the characterization of the allelic variants from the WX gene presented in wild einkorn wheat (Triticum monococcum ssp. aegilopides).
MATERIALS AND METHODS
Plant material
Fourteen wild einkorn accessions representative of the variation detected for seed storage proteins, waxy proteins and puroindolines in 170 accessions by Huertas‐García et al. 20 were analyzed. These materials were kindly supplied by the National Small Grain Collection (Aberdeen, ID, USA). The common wheat cultivar Chinese Spring (Wx‐A1a allele) was used as standard for comparison.
DNA extraction and PCR amplification
For DNA extraction, approximately 100 mg of young leaf tissue was excised, immediately frozen in liquid nitrogen and stored at −80 °C. Genomic DNA was extracted using the CTAB method. 21
Because of the length and structure of the Wx gene, approximately 2800 bp with 11 introns and 12 exons, three fragments were amplified using primers designed by Guzmán and Alvarez. 22 The first fragment includes the first to third exon (Wx1Fw/Wx1Rv); the second extends from the third to the sixth exon (Wx2Fw/Wx2Rv); and the last fragment covers the region spanning the sixth to the elevnth exon (Wx3Fw/Wx3Rv). In addition, the 5′‐untranslated region (UTR) was amplified with the primers (P1 and P2) designed by Li et al. 23 along with the 3′‐UTR region using the primers (SUN1EF and SUN1R) designed by Shariflou and Sharp. 24
All amplifications were performed in final volume of 20 μL, containing 50 ng of genomic DNA, 1.25 mm MgCl2, 0.2 mm for each dNTPs, 0.4 μm for each primer, 1× PCR buffer and 0.75 U of GoTaq® G2 Flexi DNA polymerase (Promega, Madison, WI, USA). The PCR conditions as well as primer sequences are available in Table 1.
Table 1.
Description of PCR primers pairs for amplifying the Wx genes
| Primers designed by Guzmán and Alvarez 22 | ||||
| Wx1 |
Fw: 5′‐TTGCTGCAGGTAGCCACACC‐3′ Rv: 5′‐CCGCGCTTGTAGCAGTGGAA‐3′ |
|||
| Wx2 |
Fw: 5′‐ATGGTCATCTCCCCGCGCTA‐3′ Rv: 5′‐GTTGACGGCGAGGAACTTGT‐3′ |
|||
| Wx3 |
Fw: 5′‐GGCATCGTCAACGGCATGGA‐3′ Rv: 5′‐TTCTCTCTTCAGGGAGCGGC‐3′ |
|||
| Primers designed by Li et al. 23 | ||||
| P1 | 5′‐AGCGAGCGGGCGAGTACAAATAA‐3′ | |||
| P2 | 5′‐AAACCTGCACGCCGGAACCTGT‐3′ | |||
| Primers designed by Shariflou and Sharp 24 | ||||
| SUN1EF | 5′‐GCGTACCATGAGATGGTCAAGA‐3′ | |||
| SUN1R | 5′‐ATAGGCACAACCCCTAAC‐3′ | |||
| PCR conditions | ||||
| Initial denaturation = 5 min at 95 °C | ||||
| Pair | Denaturation | Annealing | Extension | |
| Wx1 [Fw/Rv] | 35 cycles | 40 s at 94 °C | 30 s at 64 °C | 1 min at 72 °C |
| Wx2 [Fw/Rv] | 30 s at 94 °C | 30 s at 66 °C | 1 min 30 s at 72 °C | |
| Wx3 [Fw/Rv] | 40 s at 94 °C | 30 s at 64 °C | 1 min 30 s at 72 °C | |
| P1/P2 | 45 s at 94 °C | 45 s at 68 °C | 35 s at 72 °C | |
| SUN1EF/SUN1R | 45 s at 94 °C | 30 s at 64 °C | 1 min 40 s at 72 °C | |
| Final extension = 10 min at 72 °C. | ||||
All amplification products were fractionated in vertical polyacrylamide gel electrophoresis gels at 8% (w/v C: 1.28%). In all the cases, the bands were stained with GelRed nucleic acid staining (Biotium, Fremont, CA, USA) and visualized under UV light.
Cloning and sequencing analysis
PCR products were excised and purified by separation in 1% agarose gel, ligated into pSpark®‐TA Done vector (Canvax, Valladolid, Spain) and then transformed into Escherichia coli CVX5α competent cells (Canvax). The inserts of at least three different clones were sequenced. The sequences were analyzed and compared to the sequence of cv. Chinese Spring (Wx‐A1: AB019622) using Geneious Pro, version 5.0.4 (Biomatters Ltd, Auckland, New Zealand). The novel sequences are available in the Genbank database (NCBI ID: PV854202‐PV854212).
Statistical analysis
DNA analyses were performed with DnaSP, version 5.0 and parameters such as total number of mutations (η), average number of nucleotide differences (k) and number of polymorphic sites(s) were calculated. 25 Nucleotide diversity was estimated as theta (θ), the number of segregating (polymorphic) sites, 26 and pi (π), the average number of nucleotide differences per site between two sequences. 27 Neutrality tests were performed using Tajima's D statistic, a population genetics test calculated as the difference between two measures of genetic diversity: π and θ. Tajima's D test was used to determine whether the obtained waxy genes had evolved randomly (neutrally) or through a non‐random process. 28
Phylogenetic tree was constructed with MEGA 6 29 using the complete coding regions of the obtained sequences together with the sequences of the WX genes of common wheat cv. Chinese Spring (WX‐A1: AB019622), durum wheat cv. Mexicali (WX‐A1: AB029063), emmer (T. turgidum ssp. dicoccum; Wx‐A1: HM751941), wild emmer (T. turgidum ssp. dicoccoides; WX‐A1: AB029061), einkorn (T. monococcum ssp. monococcum; Wx‐A m 1a: KF612977) and T. urartu (Wx‐A u 1a: JN857937; Wx‐A u 1b: KF612973; Wx‐A u 1c: KF612974; Wx‐A u 1d: KF612975; Wx‐A u 1e: KF612976). A neighbour‐joining cluster was generated with all analyzed sequences using the maximum composite likelihood method for nucleotide sequences 30 with one bootstrap consensus of 1000 replicates. 31 Nei's genetic distances (D Nei) were calculated between the sets of evaluated species.
RESULTS
WX gene variation and nucleotide diversity
The WX‐A m 1 gene from the wild einkorn accessions evaluated was amplified using specific primers (Table 1). In each case, the complete sequence between the promoter end and the poly‐A region (5′‐UTR → 3′‐UTR) was obtained. Up to 11 different nucleotide sequences were detected; two of them were present in more than one accession (Table 2). These new alleles were named in sequential progression between the Wx‐A m 1c and Wx‐A m 1m according to Guzmán and Alvarez. 3
Table 2.
WX‐A1 alleles detected in the accessions from wild einkorn (T. monococcum ssp. aegilopides) used in the present study
| Allele a | Accession b | NCBI n | Untranslated regions (bp) | Translated regions (bp) | |||
|---|---|---|---|---|---|---|---|
| 5′UTR | 3′UTR | CDS | Total introns | Total exons | |||
| Wx‐A m 1c | PI 427453 | PV854202 | 719 | 195 | 2779 | 961 | 1818 |
| Wx‐A m 1d |
PI 427497 PI 427498 PI 427575 |
PV854203 | 745 | 201 | 2776 | 958 | 1818 |
| Wx‐A m 1e | PI 427622 | PV854204 | 710 | 203 | 2785 | 967 | 1818 |
| Wx‐A m 1f | PI 427629 | PV854205 | 710 | 203 | 2785 | 967 | 1818 |
| Wx‐A m 1g | PI 427804 | PV854206 | 716 | 195 | 2766 | 948 | 1818 |
| Wx‐A m 1h |
PI 427963 PI 470713 |
PV854207 | 721 | 195 | 2761 | 943 | 1818 |
| Wx‐A m 1i | PI 470720 | PV854208 | 713 | 195 | 2803 | 985 | 1818 |
| Wx‐A m 1j | PI 538544 | PV854209 | 730 | 199 | 2803 | 985 | 1818 |
| Wx‐A m 1k | PI 554504 | PV854210 | 716 | 213 | 2783 | 965 | 1818 |
| Wx‐A m 1l | PI 554548 | PV854211 | 975 | 195 | 2776 | 958 | 1818 |
| Wx‐A m 1m | PI 554559 | PV854212 | 733 | 195 | 2804 | 986 | 1818 |
According with Wheat Gene Catalogue.
PI: National Small Grain Collection (Aberdeen, ID, USA). All accessions were from Turkey.
The DNA polymorphism summarized in Table 3 indicated the presence of 105 polymorphic sites and 89 of out them were detected in the translated region (42 in exons and 47 in introns). All sequences showed the same size for the exonic regions (1818 bp), but presented differences for the rest of the regions analyzed (Table 2). The most notable change was detected in the Wx‐A m 1l allele within the 5′‐UTR region with a size of 975 bp as the result of a 252‐bp insertion between the positions 582 and 834. For the other sequences, this region varied between 710 and 745 bp. Furthermore, this region showed the peculiarity of including the untranslated exon 1 of the WX gene along with two uORFs (upstream open reading frames). Two variants were found for the first uORF named as 6.1 and 6.2, respectively. However, the second uORF had a more conservative sequence, with one single SNP (C → T) in the Wx‐A m 1g allele, which would not affect its hypothetical deduced amino acid sequence. The insertion of the Wx‐A m 1l allele was located between both uORFs (Fig. 1). Furthermore, one of the main differences detected within the nucleotide sequence of the exon 1 was the presence of a microsatellite (SSR), consisting of tandem repetition of the AGA sequence between seven and 12 times (Fig. 1).
Table 3.
DNA polymorphism and test statistics for selection of novel 11 sequences detected from Triticum monococcum ssp. aegilopoides
| Region | Complete | Translated region | Coding region | Transit peptide | Mature protein |
|---|---|---|---|---|---|
| η | 106 | 90 | 42 | 15 | 27 |
| k | 28.96 | 24.56 | 10.65 | 4.64 | 7.46 |
| s | 105 | 89 | 42 | 15 | 27 |
| h | 11 | 11 | 10 | 5 | 9 |
| SS | – | – | 32 | 11 | 21 |
| NSS | – | – | 10 | 4 | 6 |
| θ × 10−3 | 9.90 | 11.14 | 7.90 | 22.46 | 5.29 |
| π × 10−3 | 8.00 | 9.00 | 5.87 | 22.08 | 4.65 |
| D | −0.958 | −0.960 | −1.207 | −0.069 | −0.517 |
Note: η, total number of mutations; k, average number of nucleotide differences; s, number of polymorphic sites; h, number of haplotypes; SS, synonymous substitutions; NSS, non‐synonymous substitutions; θ, Watterson's estimate; π, nucleotide diversity; and D, Tajima's estimate D‐test.
Figure 1.

Alignment of the variants found in the 5′‐UTR region of the evaluated Wx‐A m 1 alleles, along with the SSR detected in exon 1. Exon 1 and the beginning of exon 2 are shown in yellow, whereas the two uORFs (domains 6.2 and 7) are shown in purple.
Variation at the other end of the sequence (3'‐UTR) was minor. A single SNP (A → G) was detected at position 4 after the TGA codon, along with a microsatellite [(AT)4‐13‐A‐(AT)3] (see Supporting information, Fig. S1). This microsatellite is the responsible of the differences in the size of this region (195–213 bp) between the different alleles (Table 2).
The translated/transcript sequence of these alleles, corresponding to the nucleotides between the position 39 within the exon 2 and the TGA codon at the end of exon 12, ranged from 2761 bp for the Wx‐A m 1h allele to 2804 bp for the Wx‐A m 1m allele. This variation in size is a result of the introns being constant with respect to the size of the exons for all sequences (Table 2). The coding sequence (exons) shows two different domains. The first 213 nucleotides correspond to the transit peptide, being the rest of the mature protein. This transit peptide is located in the exon 2 and presents notable changes with respect to the Wx‐A1a allele (cv. Chinese Spring) used as a reference (Fig. 2). Up to 28 SNPs (15 transversions and 13 transitions) were detected, together with two insertions located at positions 136–138 for the WX‐A m 1d allele, as well as positions 163–165 for the rest of the wild einkorn alleles. In both cases, these insertions were duplications of the previous codons: GTC and CAA, respectively. Fifteen of these polymorphic sites were common to the wild einkorn sequences, being generally synonymous changes with the exception of four of them: T14C, G40A, G73C and G215A (Fig. 2).
Figure 2.

Alignment of the nucleotide sequence of the variants detected in the transit peptide of wild einkorn wheat, compared to the Wx‐A1a allele of common wheat (cv. Chinese Spring).
The variation in the nucleotide sequence encoding the mature protein was also high, with 72 polymorphic sites (50 synonymous + 22 non‐synonymous) when the wild einkorn sequences were compared with the Wx‐A1a sequence of cv. Chinese Spring. This variation was less sensitive among the 11 alleles detected in wild einkorn (32 polymorphic sites: 23 synonymous and nine non‐synonymous). Based on this region, only nine different haplotypes were found among the accessions evaluated here, with 27 polymorphic sites (21 synonymous + 6 non‐synonymous) (Table 3).
Two statistics (π and θ) were used to estimate the nucleotide diversity, showing similar values between both statistics for all regions evaluated (Table 3). This, together with the non‐significant Tajima's D values, suggests that the differences between these nucleotide sequences could be associated to a drift‐mutation balance.
Waxy deduced proteins
Previous analysis separation by sodium dodecyl sulfate–polyacrylamide gel electrophoresis, 20 showed that all these new alleles encoded a protein present in the grain endosperm. This was confirmed in the present study, where the deduced proteins from the obtained nucleotide sequences do not present a premature stop codon, being presumably functional. In all cases, a 605‐residue polypeptide was obtained, divided into two clear domains: a 71‐residue transit peptide and a 534‐residue mature protein (see Supporting information, Table S1). The molecular weight was similar in most of the analyzed sequences (MW: 7477 Da), with the exception of three cases (Wx‐Am1d, Wx‐Am1i and Wx‐Am1k) that showed a slightly lower molecular weight (see Supporting information, Table S1). By contrast, the pI was similar in all transit peptides with the exception of Wx‐Am1i variant. This trend was also high for the mature proteins (see Supporting information, Table S1), where the molecular weight was constant (MW: 58 886 Da), except in three variants (Wx‐Am1e, Wx‐Am1j and Wx‐Am1k), being similar in the first two of these exceptions.
Comparison of these deduced protein sequences against the Wx‐A1a variant of cv. Chinese Spring used as a reference showed some important differences both in transit peptide as in the mature protein (Table 4). Furthermore, these sequences were compared with the Wx‐Am1a variant defined as the ‘wild type’ for this species (Table 4). Up to 10 amino acid changes were found in the transit peptide when comparing the wild einkorn sequences with the WX‐A1a variant of cv. Chinese Spring. These changes were common to all wild einkorn sequences; however, an additional change (Val5Ala) was detected in the Wx‐Am1k variant. By contrast, the Wx‐Am1d showed two differences with respect to the rest of the wild einkorn sequences at positions 14 and 25, being similar in both cases to the Wx‐A1a of cv. Chinese Spring. The wild einkorn variants present an additional residue compared to Wx‐A1a because of the previously described InDels. This implied a Val at position 45 only present in Wx‐Am1d and absent in both Wx‐A1a and the rest of wild einkorn sequences. On the other hand, at position 55, the rest of the wild einkorn sequences present an additional Gln, absent in Wx‐A1a and in Wx‐Am1d (Table 4).
Table 4.
Amino acid comparison between Wx‐A1a allele from cv. Chinese Spring and the WX genes detected in Triticum monococcum ssp. aegilopoides
| Position | 5 | 14 | 17 | 18 | 25 | 30 | 34 | 45 | 55 | 59 | 62 | 63 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Wx‐A1a | Val | Thr | Ser | Val | Pro | Leu | Asn | – | – | Pro | Phe | Asp |
| Wx‐A m 1a | – | Ala | Gly | Ile | Ala | Val | Ser | – | Gln | Ala | Gly | Thr |
| Wx‐A m 1b | – | Ala | Gly | Ile | Ala | Val | Ser | – | Gln | Ala | Gly | Thr |
| Wx‐A m 1c | – | Ala | Gly | Ile | Ala | Val | Ser | – | Gln | Ala | Gly | Thr |
| Wx‐A m 1d | – | – | Gly | Ile | – | Val | Ser | Val | – | Ala | Gly | Thr |
| Wx‐A m 1e | – | Ala | Gly | Ile | Ala | Val | Ser | – | Gln | Ala | Gly | Thr |
| Wx‐A m 1i | – | Ala | Gly | Ile | Ala | Val | Ser | – | Gln | Ala | Gly | Thr |
| Wx‐A m 1j | – | Ala | Gly | Ile | Ala | Val | Ser | – | Gln | Ala | Gly | Thr |
| Wx‐A m 1k | Ala | Ala | Gly | Ile | Ala | Val | Ser | – | Gln | Ala | Gly | Thr |
| Position | 69 | 72 | 76 | 106 | 134 | 139 | 140 | 142 | 152 | 179 | 192 | 215 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Wx‐A1a | Met | Arg | Ser | Ala | Ile | Val | Val | Arg | Tyr | Tyr | Gln | His |
| Wx‐A m 1a | Val | – | – | Pro | Val | – | Ala | Glu | Phe | – | Leu | Tyr |
| Wx‐A m 1b | Val | – | – | Pro | Val | – | Ala | Glu | Phe | – | Leu | Tyr |
| Wx‐A m 1c | Val | – | – | Pro | Val | – | Ala | Glu | Phe | – | Leu | Tyr |
| Wx‐A m 1d | Val | – | – | Pro | Val | – | Ala | Glu | Phe | – | Leu | Tyr |
| Wx‐A m 1e | Val | – | – | Pro | Val | – | Ala | Glu | Phe | Cys | Leu | Tyr |
| Wx‐A m 1i | Val | His | – | Pro | Val | – | Ala | Glu | Phe | – | Leu | Tyr |
| Wx‐A m 1j | Val | – | – | Pro | Val | – | Ala | Glu | Phe | – | Leu | Tyr |
| Wx‐A m 1k | Val | – | Gly | Pro | Val | Ile | Ala | Glu | Phe | – | Leu | Tyr |
| Position | 222 | 228 | 359 | 362 | 365 | 369 | 378 | 452 | 455 | 576 | 600 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Wx‐A1a | Glu | Cys | Ile | Lys | Thr | Asp | Ala | Thr | Trp | Asp | Leu |
| Wx‐A m 1a | – | – | Thr | – | – | – | Val | Ser | Arg | His | Met |
| Wx‐A m 1b | – | – | Thr | Asn | – | Asn | Val | Ser | Arg | His | Met |
| Wx‐A m 1c | – | – | Thr | – | – | – | – | Ser | Arg | His | Met |
| Wx‐A m 1d | – | – | Thr | – | – | – | – | Ser | Arg | His | Met |
| Wx‐A m 1e | Val | Tyr | Thr | – | – | – | – | Ser | Arg | His | Met |
| Wx‐A m 1i | – | – | Thr | – | – | – | – | Ser | Arg | His | Met |
| Wx‐A m 1j | – | – | Thr | – | Ala | – | – | Ser | Arg | His | Met |
| Wx‐A m 1k | – | – | Thr | – | Ala | – | – | Ser | Arg | His | Met |
The amino acid changes in the mature proteins were numerous, although only 12 out of them were common to all wild einkorn sequences (Table 4). Seven of them were non‐conservative changes (Arg142Glu, Tyr152Phe, Gln192Leu, His215Tyr, Ile359Thr, Trp455Arg and Asp576His) that could have effects on the hydrophobic/hydrophilic properties or polar exchange in these proteins. The other 10 changes were only present in individual sequences (Table 4). All mature proteins had Arg as the first amino acid residue (position 72), whereas the Wx‐Am1i starts with His. The Wx‐Am1b showed three changes with respect to the Wx‐A1a (Lys362Asn, Asp369Asn and Ala378Val), one of them (Ala378Val) being common with Wx‐Am1a, which is absent in the rest of wild einkorn sequences and could be a deleterious effect according with the findings of Ortega et al. 34 Other changes were detected in Wx‐Am1k which also have three changes compared to Wx‐A1a and Wx‐Am1a (Ser76Gly, Val139Ile and Thr365Ala), whereas Wx‐Am1e showed two changes: Glu222Val and Cys278Tyr.
The changes in the mature protein could affect the protein activity, especially if they appear in any of the five highly conserved regions involved in the ADP glucose binding site and the catalytic site, which can affect the protein activity. 35 Two of the changes observed in the waxy variants of wild einkorn were detected within these regions: the change Ile359Thr was found in Motif III, and Ala378Val was found in Motif IV.
Phylogenetic relations
The sequences obtained in the present study, along with other WX‐A1 genes sequences present in databases, were used to construct a phenogram based on the maximum composite likelihood method (Fig. 3). All sequences were organized into two groups with high bootstrap level. Thus, the new wild einkorn sequences showed a high level of relatedness to the other WX‐A1 sequences previously identified in diploid wheat, mainly in T. urartu (Fig. 3). When these diploid sequences were compared with the WX‐A1 variants in polyploid wheats (tetra‐ and hexaploid), the differences were clear, grouping all them in one cluster separated from the diploid wheat group (D Nei = 0.069).
Figure 3.

Neighbour‐joining tree based on the maximum composite likelihood method of Wx gene sequences in the evaluated diploid wheat accessions (bold), together with other previous sequences. Numbers in nodes indicate bootstrap estimates from 1000 replications.
DISCUSSION
In the cereal sector, crop diversification through the development of new species has increased over the last century. Current climatic conditions could justify the search for new genomic combinations that are well‐adapted to this new landscape. However, this should be achieved without compromising technological and nutritional quality. In this regard, various species from the three wheat‐related gene pools have been used to develop new amphiploids or wheat cultivars. 36 , 37 Traditionally, wheat breeders have been reluctant to use this strategy because of the ‘linkage drag’ associated with the wild components of these genetic sources 38 ; however, new biotechnological tools could overcome this circumstance. 39 In this context, the previous evaluation of the genes related to quality properties would be fully justified, highlighting among them the grain storage proteins, mainly the high‐molecular‐weight glutenin subunits, related to the gluten properties, along with the puroindolines associated with the grain texture and the starch synthases, which influence the quantity and properties of the main grain component: starch. 40 This strategy has led to the development of some materials with different gluten properties, 41 as well as the establishment of durum wheat cultivars with soft grain texture. 42
On the other hand, the search of new allelic variants for the WX gene has been carried out in wild species more or less related to wheat. In general, the studies have been more academic than applied because this gene, as a result of its ubiquity in the plants, is considered as an excellent marker for establishing phylogenetic relationships between species. 43 In some cases, amphiploids have been developed between these wild species and durum wheat and their starch properties have been evaluated. 44 , 45 , 46 In the case of diploid wheat, because of the proximity of its genome (Am or Au) to the A subgenome of polyploid wheat (durum or common wheat), the detected variation could be transferred by introgression to this subgenome.
The WX variability detected in the main diploid wheat species (wild and cultivated einkorn, and T. urartu) has been highly uneven, with the wild species (wild einkorn and T. urartu) being more prominent than cultivated ones. 47 , 48 , 49 This could be associated with events of genetic drift that fixed only some alleles during the domestication process. In this sense, the nucleotide diversity was higher in T. urartu 34 or wild einkorn (present study) than in einkorn 50 or in polyploid wheat. 51 , 52
The molecular structure of the WX genes is highly conservative among all species evaluated with 12 exons and 12 introns, 3 with little difference in exon size. The coding sequence comprising the last 12 exons has a constant size of 605 amino acids (1818 bp, including the stop codon). However, the exon 1 included in the 5′‐UTR region shows notable size variations in the wild einkorn sequences because of the presence of SSRs. By contrast, the intron sizes tend to be more variable because of the presence of numerous InDels, which have been detected in most of the species evaluated, 23 , 34 , 53 and were also found in the present study. However, the most notable change was detected in the 5′‐UTR region of one of the new alleles found in wild einkorn (WX‐A m 1l), which shows one large insertion (252 bp) that was not detected in other WX alleles.
Although the exons in the coding sequence were the same size, the deduced proteins showed some differences in their amino acid composition. All the new proteins had one additional amino acid compared to the Wx‐A1a protein of cv. Chinese Spring: all of them had an extra glutamine residue at position 55, except for Wx‐Am1d, which had a valine residue at position 45. This was also detected by Ortega et al. 31 when they analyzed the waxy variation in T. urartu. Both changes have an unequal distribution, while the glutamine insertion is common in waxy proteins of the B genome or those related to it (e.g. the S genome), the additional valine residue is only detected in one protein variant of T. urartu (Wx‐Au1c) and in the Wx‐Am1d variant found in the present study. This insertion seems to be responsible for the enlargement of the third β strand in the transit peptide.
Numerous amino acid changes were detected when comparing the WX variants described in the present study with the Wx‐A1a variant from cv. Chinese Spring. These changes could affect the hydrophilic/hydrophobic properties of these proteins and affect to their enzymatic function. In this regard, Yamamori and Guzmán 54 reported that a single amino acid substitution in a key residue can modify the waxy protein's ability to synthesize amylose. Specifically, some of these changes were common to other diploid wheats and were classified as potentially detrimental by Ortega et al. 34 Obviously, further studies would be needed to evaluate the expression and effect of these new alleles when introduced into the modern wheat genetic background; however, the variation observed in both the transit peptide and the mature protein could alter the processing of the polypeptide and, consequently, its enzymatic activity, modifying the amount of amylose produced. 34 , 35 , 54
Among the diploid wheats, both T. urartu and einkorn have been proposed as putative donors of the A genome of polyploid wheats, although the most likely candidate is T. urartu. 12 , 13 , 55 However, the phylogenetic studies carried out with the WX gene have shown a significant distance between the WX gene of both species and the WX‐A1 gene of polyploid wheats (Ortega et al. 34 ; present study). A possible explanation on this was suggested by Brandolini et al., 13 in the sense that only a limited part of the variation present in the diploid gene pool is present in the polyploid wheats, which generated the current WX‐A1 variation by point mutation followed by genetic drift events. By contrast, the wild materials such as T. urartu or wild einkorn showed high variability. Ortega et al.34 detected up to five different alleles among 30 accessions analyzed, and 11 new alleles were found in the present study.
In conclusion, the waxy variants from diploid wheat are a potential source for expanding the variation range in the amylose/amylopectin ratio in modern cultivated wheat. This could boost the development of new durum or common wheat cultivars adapted to new uses in the food industry. In this regard, as mentioned earlier, the development of amphiploids such as ‘durococcum’ or ‘timococcum’, could serve as a bridge to transfer the quality characteristics of these diploid wheats to hexaploid wheats; without excluding other biotechnological tools such as transgenesis or gene editing.
AUTHOR CONTRIBUTIONS
JBA and CG were involved in conceptualization. JBA and CG were involved in supervision. JBA and CG were involved in project administration, funding acquisition and reviewing and editing. JBA and LC were involved in formal analysis. JBA was involved in writing the original draft. LC was involved in investigations.
FUNDING
This research was supported by grant PID2021‐122530OB‐I00 from the Spanish State Research Agency (Spanish Ministry of Science, Innovation and Universities) – MCIN/AEI/10.13039/50110001103, co‐financed with the ERDF/EU (10.13039/501100008530 ‐ European Regional Development Fund from the European Union).
Supporting information
Table S1. Biochemical characteristics of the deduced amino acid sequences of the WX‐Am1 variants detected in wild einkorn.
Figure S1. Nucleotide sequence of the 3'‐UTR region. The yellow rectangle indicates the SSR detected.
ACKNOWLEDGEMENTS
We thank to the National Small Grain Collection (Aberdeen, ID, USA) for supplying the analyzed materials. Funding for open access charge: Universidad de Cordoba/CBUA.
DATA AVAILABILITY STATEMENT
The data that supports the findings of this study are available in the supplementary material of this article.
REFERENCES
- 1. Shewry PR and Hey SJ, The contribution of wheat to human diet and health. Food Energy Secur 4:178–202 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Wrigley C, Békés F and Bushuk W, Gliadin and Glutenin: The Unique Balance of Wheat Quality. AACC International Press, St. Paul, MN: (2006). [Google Scholar]
- 3. Guzmán C and Alvarez JB, Wheat waxy proteins: polymorphism, molecular characterization and effects on starch properties. Theor Appl Genet 129:1–16 (2016). [DOI] [PubMed] [Google Scholar]
- 4. Morris CF, Puroindolines: the molecular genetic basis of wheat grain hardness. Plant Mol Biol 48:633–647 (2002). [DOI] [PubMed] [Google Scholar]
- 5. Zeng M, Morris CF, Batey IL and Wrigley CW, Sources of variation for starch gelatinization, pasting, and gelation properties in wheat. Cereal Chem 74:63–71 (1997). [Google Scholar]
- 6. Echt CS and Schwartz D, Evidence for the inclusion of controlling elements within the structural gene at the waxy locus in maize. Genetics 99:275–284 (1981). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Yamamori M, Nakamura T, Endo TR and Nagamine T, Waxy protein deficiency and chromosomal location of coding genes in common wheat. Theor Appl Genet 89:179–184 (1994). [DOI] [PubMed] [Google Scholar]
- 8. Nakamura T, Yamamori M, Hirano H, Hidaka S and Nagamine T, Production of waxy (amylose‐free) wheats. Mol Gen Genet 248:253–259 (1995). [DOI] [PubMed] [Google Scholar]
- 9. Miura H and Sugawara A, Dosage effects of the three Wx genes on amylose synthesis in wheat endosperm. Theor Appl Genet 93:1066–1070 (1996). [DOI] [PubMed] [Google Scholar]
- 10. Guzmán C, Caballero L, Yamamori M and Alvarez JB, Molecular characterization of a new waxy allele with partial expression in spelt wheat. Planta 235:1331–1339 (2012). [DOI] [PubMed] [Google Scholar]
- 11. Alvarez JB and Guzmán C, Interspecific and intergeneric hybridization as a source of variation for wheat grain quality improvement. Theor Appl Genet 131:225–251 (2018). [DOI] [PubMed] [Google Scholar]
- 12. Dvorak J, McGuire PE and Cassidy B, Apparent sources of the a genomes of wheats inferred from polymorphism in abundance and restriction fragment length of repeated nucleotide sequences. Genome 30:680–689 (1988). [Google Scholar]
- 13. Brandolini A, Vaccino P, Boggini G, Ozkan H, Kilian B and Salamini F, Quantification of genetic relationships among a genomes of wheats. Genome 49:297–305 (2006). [DOI] [PubMed] [Google Scholar]
- 14. Johnson BL and Dhaliwal HS, Reproductive isolation of Triticum boeoticum and Triticum urartu and the origin of the tetraploid wheats. Am J Bot 63:1088–1094 (1976). [Google Scholar]
- 15. Bhagyalakshmi K, Vinod KK, Kumar M, Arumugachamy S, Prabhakaran AJ and Raveendran TS, Interspecific hybrids from wild × cultivated Triticum crosses‐a study on the cytological behaviour and molecular relations. J Crop Sci Biotechnol 11:257–262 (2008). [Google Scholar]
- 16. Goncharov NP, Bannikova SV and Kawahara T, Wheat artificial amphiploids involving the Triticum timopheevii genome: their studies, preservation and reproduction. Genet Resour Crop Evol 54:1507–1516 (2007). [Google Scholar]
- 17. Mikó P, Megyeri M, Farkas A, Molnár I and Molnár‐Láng M, Molecular cytogenetic identification and phenotypic description of a new synthetic amphiploid, Triticum timococcum (AtAtGGAmAm). Genet Resour Crop Evol 62:55–66 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Li H, Liu X, Zhang M, Feng Z, Liu D, Ayliffe M et al., Development and identification of new synthetic T. Turgidum–T. Monococcum amphiploids. Plant Genet Resour Charact Util 16:555–563 (2018). [Google Scholar]
- 19. Mujeeb‐Kazi A and Kimber G, The production, cytology and practically of wide hybrids in the Triticeae. Cereal Res Commun 13:111–124 (1985). [Google Scholar]
- 20. Huertas‐García AB, Castellano L, Guzmán C and Alvarez JB, Potential use of wild einkorn wheat for wheat grain quality improvement: evaluation and characterization of Glu‐1, Wx and Ha loci. Agronomy 11:816 (2021). [Google Scholar]
- 21. Stacey J and Isaac PG, Isolation of DNA from plants, in Protocols for Nucleic Acid Analysis by Nonradioactive Probes, ed. by Isaac PG. Humana Press, Totowa, NJ, pp. 9–15 (1994). [Google Scholar]
- 22. Guzmán C and Alvarez JB, Molecular characterization of a novel waxy allele (Wx‐Au1a) from Triticum urartu Thum. Ex Gandil. Genet Resour Crop Evol 59:971–979 (2012). [Google Scholar]
- 23. Li W, Gao Z, Xiao W, Wei YM, Liu YX, Chen GY et al., Molecular diversity of restriction enzyme sites, Indels and upstream open reading frames (uORFs) of 5′ untransalted regions (UTRs) of waxy genes in Triticum L. and Aegilops L species. Genet Resour Crop Evol 59:1625–1647 (2012). [Google Scholar]
- 24. Shariflou MR and Sharp PJ, A polymorphic microsatellite in the 3′ end of ‘waxy’ genes of wheat, Triticum aestivum. Plant Breed 118:275–277 (1999). [Google Scholar]
- 25. Librado P and Rozas J, DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451–1452 (2009). [DOI] [PubMed] [Google Scholar]
- 26. Watterson GA, On the number of segregating sites in genetic models without recombination. Theor Popul Biol 7:256–276 (1975). [DOI] [PubMed] [Google Scholar]
- 27. Nei M, Molecular Evolutionary Genetics. Columbia University Press, New York, Chichester, West Sussex: (1987). [Google Scholar]
- 28. Tajima F, Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585–595 (1989). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S, MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Tamura K, Nei M and Kumar S, Prospects for inferring very large phylogenies by using the neighbor‐joining method. Proc Natl Acad Sci USA 101:11030–11035 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Felsenstein J, Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791 (1985). [DOI] [PubMed] [Google Scholar]
- 32. Murai J, Taira T and Ohta D, Isolation and characterization of the three waxy genes encoding the granule‐bound starch synthase in hexaploid wheat. Gene 234:71–79 (1999). [DOI] [PubMed] [Google Scholar]
- 33. Yan L, Bhave M, Fairclough R, Konik C, Rahman S and Appels R, The genes encoding granule‐bound starch synthases at the waxy loci of the A, B, and D progenitors of common wheat. Genome 43:264–272 (2000). [DOI] [PubMed] [Google Scholar]
- 34. Ortega R, Guzmán C and Alvarez JB, Wx gene in diploid wheat: molecular characterization of five novel alleles from einkorn (Triticum monococcum L. ssp. monococcum) and T. Urartu . Mol Breed 34:1137–1146 (2014). [Google Scholar]
- 35. Leterrier M, Holappa L, Broglie K and Beckles D, Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications. BMC Plant Biol 8:98 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. King J, Dreisigacker S, Reynolds M, Bandyopadhyay A, Braun H‐J, Crespo‐Herrera L et al., Wheat genetic resources have avoided disease pandemics, improved food security, and reduced environmental footprints: a review of historical impacts and future opportunities. Glob Chang Biol 30:e17440 (2024). [DOI] [PubMed] [Google Scholar]
- 37. Sertse D, Kassa MT, McCallum BD, von Wettberg EJB and McCartney CA, Enhancing the breeding gene pool of wheat using accessions in gene banks as demonstrated by the Watkins collection. Theor Appl Genet 138:109 (2025). [DOI] [PubMed] [Google Scholar]
- 38. Kashyap A, Garg P, Tanwar K, Sharma J, Gupta NC, Ha PTT et al., Strategies for utilization of crop wild relatives in plant breeding programs. Theor Appl Genet 135:4151–4167 (2022). [DOI] [PubMed] [Google Scholar]
- 39. Zhang S, Zhang R, Gao J, Song G, Li J, Li W et al., CRISPR/Cas9‐mediated genome editing for wheat grain quality improvement. Plant Biotechnol J 19:1684–1686 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Guzmán C, Ibba MI, Alvarez JB, Sissons M and Morris C, Wheat quality, in Wheat Improvement: Food Security in a Changing Climate, ed. by Reynolds MP and Braun H‐J. Springer International Publishing, Cham, pp. 177–193 (2022). [Google Scholar]
- 41. Wang D, Li F, Cao S and Zhang K, Genomic and functional genomics analyses of gluten proteins and prospect for simultaneous improvement of end‐use and health‐related traits in wheat. Theor Appl Genet 133:1521–1539 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Morris CF, Development of soft kernel durum wheat. Front Agr Sci Eng 6:273–278 (2019). [Google Scholar]
- 43. Mason‐Gamer RJ, Weil CF and Kellogg EA, Granule‐bound starch synthase: structure, function, and phylogenetic utility. Mol Biol Evol 15:1658–1673 (1998). [DOI] [PubMed] [Google Scholar]
- 44. Li W, Chen ZY, Li Z, Zhao XF, Pu ZE, Chen GY et al., Characterization of starch synthetic genes and starch granule during seeds development between synthetic hexaploid wheat and its parents. Cereal Res Commun 46:275–286 (2018). [Google Scholar]
- 45. Klimushina MV, Kroupin PY, Bazhenov MS, Karlov GI and Divashuk MG, Waxy gene‐orthologs in wheat × Thinopyrum amphidiploids. Agronomy 10:963 (2020). [Google Scholar]
- 46. Li Q, Zhang X, Lin N, Carlos G, Lan J, Tang H et al., Analysis of the starch properties in tetraploid wheat–Aegilops sharonensis amphidiploid. Cereal Res Commun 49:529–537 (2021). [Google Scholar]
- 47. Guzmán C, Caballero L and Alvarez JB, Variation in Spanish cultivated einkorn wheat (Triticum monococcum L. ssp monococcum) as determined by morphological traits and waxy proteins. Genet Resour Crop Evol 56:601–604 (2009). [Google Scholar]
- 48. Rodriguez‐Quijano M, Vazquez JF and Carrillo JM, Waxy proteins and amylose content in diploid Triticeae species with genomes a, S and D. Plant Breed 123:294–296 (2004). [Google Scholar]
- 49. Urbano M, Margiotta B, Colaprico G and Lafiandra D, Waxy proteins in diploid, tetraploid and hexaploid wheats. Plant Breed 121:465–469 (2002). [Google Scholar]
- 50. Liu YX, Li W, Wei YM, Chen GY and Zheng YL, Molecular characterization of the waxy gene in einkorn wheat. J Plant Sci 4:114–121 (2009). [Google Scholar]
- 51. Guzmán C, Caballero L, Martín LM and Alvarez JB, Waxy genes from spelt wheat: new alleles for modern wheat breeding and new phylogenetic inferences about the origin of this species. Ann Bot 110:1161–1171 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Huang XQ and Brule‐Babel A, Sequence diversity, haplotype analysis, association mapping and functional marker development in the waxy and starch synthase IIa genes for grain‐yield‐related traits in hexaploid wheat (Triticum aestivum L.). Mol Breed 30:627–645 (2012). [Google Scholar]
- 53. Ortega R, Alvarez JB and Guzmán C, Characterization of the Wx gene in diploid Aegilops species and its potential use in wheat breeding. Genet Resour Crop Evol 61:369–382 (2014). [Google Scholar]
- 54. Yamamori M and Guzmán C, SNPs and an insertion sequence in five Wx‐A1 alleles as factors for variant Wx‐A1 protein in wheat. Euphytica 192:325–338 (2013). [Google Scholar]
- 55. Dvořák J, Terlizzi P, Zhang H‐B and Resta P, The evolution of polyploid wheats: identification of the a genome donor species. Genome 36:21–31 (1993). [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1. Biochemical characteristics of the deduced amino acid sequences of the WX‐Am1 variants detected in wild einkorn.
Figure S1. Nucleotide sequence of the 3'‐UTR region. The yellow rectangle indicates the SSR detected.
Data Availability Statement
The data that supports the findings of this study are available in the supplementary material of this article.
