Abstract
Background
Osteoporotic fractures (OPF) cause pain and trigger physical and mental health problems for patients. However, the underlying mechanism of OPF remains unclear. This study aims to investigate the diagnostic value and inhibitory effect on fracture healing of miR-204 in OPF.
Methods
A total of 104 osteoporosis patients and 119 OPF patients were included from the clinic. The RT-qPCR was performed to detect serum miR-204 level. The ROC curves were plotted based on miR-204 expression. Correlations between miR-204 and clinical factors were analyzed by the chi-square test in the OPF group. Independent risk factors were analyzed by multivariate logistic regression. The effect of miR-204 on fracture healing was explored in vitro experiments on BMSCs cells. The expression of miR-204 and TGF-β1 was assayed by the RT-qPCR in BMSCs transfected with miR-204 mimic NC, mimic, inhibitor NC, and inhibitor. The CCK-8 was applied to detect cell proliferation.
Results
Serum miR-204 level was significantly increased in the OPF group. The ROC curve confirmed the diagnostic value of miR-204 for OPF. The levels of Ca2+, β-CTX, 25(OH)D3, and T-score were correlated with miR-204 expression. The levels of Ca2+, miR-204, and T-score were identified as risk factors for OPF. miR-204 overexpression inhibited the proliferation of BMSCs, reduced the expression of osteogenic differentiation factors (ALP and BSP), and decreased the expression of factors (TGF-β1 and BMP) that promote fracture healing.
Conclusion
Elevating miR-204 promotes OPF development and impairs BMSC-mediated osteogenic differentiation and repair of fractures, warranting further in vivo validation. Inhibition of miR-204 may enhance osteogenic differentiation and fracture healing, representing a potential avenue for future therapeutic investigation in OPF.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13018-025-06652-9.
Keywords: miR-204, Osteoporotic fractures, Osteogenic bone differentiation, Fracture healing, Biomarker, BMSCs
Background
Osteoporotic fractures (OPF) are a secondary complication of osteoporosis [1]. OP is characterized by decreased bone mass, decreased bone stiffness, bone microstructural damage, and increased bone fragility [2, 3]. A T-score ≤ -2.5 in the hip or lumbar spine is considered osteoporosis [4]. OPF can occur at low forces. As the global population ages, OPF incidence is rising globally. OPF commonly affects the spine, hip, humerus, and radius, with hip fracture mortality reaching 20% [5]. Serious cases may result in acute and multiple osteoporotic vertebral compression fractures [6]. The treatment of OP mainly relies on clinical drugs, but the long-term use of these drugs may lead to adverse reactions [7]. OPF can lead to severe pain and disability, with up to 50% of patients experiencing permanent disability. This not only seriously reduces the quality of life of the patients but also brings a heavy burden to their families and society as a whole. Several potential biomarkers have been identified for OPF [8–10], but the diagnosis of osteoporotic fracture is still biased in clinical practice [11]. The key to preventing OPF is to identify individuals who are at high risk of OPF, so the discovery of more sensitive diagnostic molecular substances is needed for OPF.
Bone remodeling is the result of the interplay between osteoclasts and osteoblasts. Osteoclasts mainly make an impact on bone resorption, while osteoblasts mainly play the role of bone formation [12, 13]. The dynamic balance between the osteoclasts and osteoblasts can prevent osteoporosis. MicroRNAs (miRNAs) have caught the attention of a great deal of researchers due to their involvement in multicellular signaling regulation, particularly in musculoskeletal disorders [1, 14–21]. For instance, overexpression of miR-217 inhibits the expression of osteoprotegerin (OPG), promoting cell apoptosis and suppressing osteogenic differentiation [22]. Downregulation of miR-106-5p reduces phosphatase and tensin homolog (PTEN) level and alleviates postmenopausal osteoporosis [23]. In a recent review, Bottani et al. discussed the potential application of circulating miRNAs as biomarkers for OPF [24]. Accumulating evidence indicate that miRNAs regulate the proliferation and differentiation of osteoblasts and osteoclasts to affect bone metabolism [25, 26]. Factors that promote the proliferation of osteoblasts can facilitate fracture healing. Additionally, miRNAs also regulate the gene expression related to osteogenesis that affects the ossification of collagen fibre matrix [27, 28], highlighting their critical role in osteoporotic disorders.
miR-204 is an important bone regulator. For example, increased differentiation of bone marrow mesenchymal stem cells (BMSCs) to adipocytes in OP patients with high miR-204 expression, while suppressing BMSCs osteogenic potential. Conversely, reduced miR-204 levels yield the opposite effects [29]. Ingenuity Pathway Analysis revealed that miR-204 by targeting SOX11 was involved in osteoblast differentiation during osteoarthritis (OA), showing that the miR-204-5p/SRY-box transcription factor 11 (SOX11) axis plays a central role in osteogenesis [30]. The miR-204 expression was notably elevated in cartilage tissues of OA patients. miR-204 overexpression inhibited chondrocyte viability and proliferation rate and promoted chondrocyte apoptosis [31]. However, the role of miR-204 in OPF has not been elucidated to date, and we hypothesized that high miR-204 expression contributes to the pathogenesis of OPF. Therefore, this study aimed to investigate the function of miR-204 in OPF.
Methods and materials
Sample size calculation
The sample size estimation in this study is used to formulate the plan for recruiting volunteers and to ensure the persuasiveness of the area under the ROC curve (AUC). G*Power software was used for sample size calculation. Through a systematic literature review [32–34], an effect size of 0.5 was selected. The methodological standards research on sample size and statistical power in orthopedic studies further verified the robustness of effect size = 0.5 [35, 36]. When the parameters are set as effect size = 0.5, α = 0.05, and power = 0.95, the total number of patients calculated is 176.
Subjects
A total of 223 patients (OP patients: 104, OPF patients: 119) were included from Xuzhou Central Hospital between 2022 and 2024. Among the OPF cohort, hip fractures accounted for approximately 34.08%, totaling 41 cases. Vertebral fractures accounted for about 46.19%, with a total of 55 cases. Wrist fractures accounted for 8.97%, with a total of 10 cases. Fractures in other areas accounted for 10.76%, with a total of 13 cases. The diagnostic criteria for OP were in accordance with criteria promulgated by the American Bone Health Alliance Task Force Position Statement [37]. Eligible OPF patients included individuals with fractures attributable to osteoporosis, with no restrictions on specific fracture sites. All patients were tested for bone mineral density (BMD) by dual-energy X-ray absorptiometry (DXA) in the radiology department. According to the T-value criteria established by the World Health Organization (WHO), normal bone mass: T-score ≥ -1.0, reduced bone mass: T-score between -1.0 and -2.5, osteoporosis: T-score ≤ -2.5 [38]. All patients were drawn 10 ml of venous blood after an 8-h fast. The patient’s venous blood was collected within 24 h after the fracture occurred and before the surgical intervention.
Exclusion criteria for patients: 1. Injurious fractures caused by non-osteoporotic factors, such as traffic accidents, violent collisions. 2. Long-term use of medications that affect bone density. 3. History of long-term hormonal and anti-osteoporotic drug use. 4. Abnormal thyroid and parathyroid function, severe cardiopulmonary and renal insufficiency. 5. Systemic endocrine diseases or malignant tumors.
Ca2+, β-C-telopeptides of type I collagen (β-CTX), and 25-hydroxy vitamin D3 (25(OH)D3) were obtained by the Clinical Laboratory Department of our hospital. All patients were informed about the purpose of our experiment, and the patients agreed to participate in the experiment by signing an informed consent form. All the procedures of this study were in accordance with the normative guidelines of the ethics committee of Xuzhou Central Hospital.
Cell culture and transfection
BMSCs obtained from ATCC were used for in vitro experiments. BMSCs have a multi-differentiation function, which can differentiate into osteoblasts, osteoclasts, chondrocytes, and adipocytes. BMSCs were cultured in α-MEM medium (Thermo, USA) containing 10% fetal bovine serum (FBS) (Excellbio, China) and 1% penicillin–streptomycin (PS) (Beyotime, China), placed in an incubator containing 5% CO2 and a temperature of 37 °C.
BMSCs were subjected to transfection experiments and seeded into 24-well plates until the cell density reached 70%. Mimic, mimic NC, inhibitor, and inhibitor NC of miR-204 were transfected into BMSCs by Lipofectamine 3000 (Thermo, USA). The transfection medium was replaced with fresh complete medium 6 h post-transfection, and cells were further incubated for 24 h before subsequent experiments. Related sequences: miR-204 mimic: UUCCCUUUGUCAUCCUAUGCCU, miR-204 mimic NC: UUCUCCGAACGUGUCACGU, miR-204 inhibitor: AGGCAUAGGAUGACAAAGGGAA, miR-204 inhibitor NC: CAGUACUUUUGUGUAGUACAA.
RNA extraction and RT-qPCR
Serum miRNA extraction was performed with a specialized miRNA extraction kit (TIANGEN, China). Cellular RNA was extracted with TRIzol (Thermo, USA). Successfully extracted RNA samples were subjected to a 260/280 test, with a standard value of 1.8–2.1. Qualified RNA samples were used to synthesize cDNA for the RT-qPCR assay. All samples were repeated three times to ensure data accuracy. The internal reference for serum miRNA was 5S because 5S is more stable. The internal references used for cellular experiments were U6 and β-actin. All sequences and primers for this experiment were synthesized through Generalbiol (Anhui, China). Primer sequences were as follows:
5S: GCGGTCTCCCATCCAAGTAC.
U6: CTCGCTTCGGCAGCACATATACT.
miR-204: GCCGAGTTCCCTTTGTCATC.
β-actin: F: AGTGTGACGTTGACATCCGT, R: GCAGCTCAGTAACAGTCCGC.
ALP: F: GCTGATGATGCCAATGTGGTT, R CCAGTCAGAGTGGCACATCTTG.
BSP: F: TCTTGAGGGAACAGGTGGCAG, R: GCATCATCCCTCCCTAGG.
BMP: F: ATGGATCCATGGTGGCCGGGACCCGCT, R: ATGAATTCTCAGCGACACCCACACCAC. TGF-β1: F: CACCATCCATGACATGAACC, R: TCATGTTGGACAACTGCTCC.
MG63 and BMSCs co-culture assay
Osteogenic differentiation induction assay of BMSCs was co-cultured with MG63 (an osteosarcoma cell line, obtained from ATCC). The results of the pre-test indicated that, compared with BMSCs cultured alone, the relative expression levels of ALP, BSP, TGF-β1, and BMP in BMSCs co-cultured with MG63 were significantly increased (Supplementary Fig. 1A-D). Cytokines secreted by MG63 promoted osteogenic differentiation of BMSCs [39]. The pore size of the Transwell was chosen to be 0.4 μm in order to ensure that the cells could only communicate through the secreted factors. MG63 and BMSCs that were transfected and cultured for 24 h were collected to make a cell suspension. MG63 was inoculated in the lower chamber of the Transwell, and BMSCs were inoculated in the upper chamber. MG63 and BMSCs were co-cultured for 48 h and collected for RNA extraction. Transwell penetrable cell culture chambers were obtained from Corning (USA).
Cell proliferation assay
BMSCs were inoculated into 96-well plates (900 cells per well) after transfection for 24 h. Cell proliferation was assessed using the CCK-8 kit according to the instructions. CCK-8 reagent was added to the cells at 12, 24, 48, and 72 h after cell inoculation, and the cells continued to be incubated for 4 h, respectively. After 4 h of incubation, absorbance at 450 nm was measured using a microplate reader (Bio-Rad, USA). The same treated samples were repeated three times, and each sample was assayed twice.
Dual luciferase reporter gene assay
The bone morphogenetic protein receptor type 1A (BMPR1A) reporter plasmid includes the wild-type sequence reporter plasmid (WT-BMPR1A) and the mutant sequence reporter plasmid (MUT-BMPR1A) synthesized by GenePharma (Shanghai, China). According to the experimental design, the miR-204-related oligonucleotide sequences and the reporter plasmid were co-transfected into BMSCs cells and cultured for 24 h. After 24 h, the cells were collected to prepare the cell suspension. After adding the firefly luciferase substrate and the Renilla luciferase substrate, the results were read on the microplate reader.
Statistical data
The software used for data analysis was SPSS 26.0 (USA) and GraphPad Prism 9 (USA). Experimental data were presented as mean ± standard deviation (SD). One-way ANOVA with post-hoc tests was used for comparisons among three or more cell groups, while independent samples t-tests were applied for two-group comparisons. Correlations between miR-204 expression and each clinical characteristic were analyzed by the chi-square test in patients with OPF. Independent risk factors for OPF were analyzed by multivariate logistic regression. P value of less than 0.05 was considered statistically significant.
Result
miR-204 level was significantly elevated in the serum of OPF patients
Firstly, the clinical parameters of 104 osteoporosis patients and 119 OPF patients were compared. The comparison revealed that in OPF patients, the Ca2+ and 25(OH)D3 levels were lower, whereas the β-CTX levels were markedly higher, and the T-score was significantly lower than OP patients (Table 1). This suggests enhanced bone resorption and decreased bone mineral density in patients with OPF. The miR-204 expression in the serum of osteoporosis and OPF patients was examined by RT-qPCR. It was found that the miR-204 expression in OPF patients was significantly higher than that of osteoporosis patients (Fig. 1A). The ROC curves were plotted based on miR-204 expression. The ROC curve showed that miR-204 has diagnostic value for OPF (AUC = 0.862). When the cut-off value was greater than 1.205, the sensitivity percentage was 72.27% and the specificity percentage was 88.46%. To further validate the diagnostic value of miR-204 for OPF, the ROC curves of β-CTX and T-score, as well as the combined diagnostic curve, were supplemented (Fig. 1B). The results showed that the AUC values of miR-204, β-CTX, T-score, and the combined diagnostic curve were "0.862, 0.640, 0.641, and 0.895", respectively. The cut-off values, sensitivity%, and specificity% of the ROC curve of miR-204, β-CTX, T-score, and combined diagnosis were statistically processed and organized (Supplementary Table 1). It was easy to find that the efficacy of miR-204 as a diagnostic marker was superior to that of β-CTX and T-score. However, the combined curve data indicated that the combined diagnostic efficacy of the three was the best.
Table 1.
General clinical information about the subjects
| Characteristics | Subjects | P value | |
|---|---|---|---|
| OP(n = 104) | OPF(n = 119) | ||
| Age (years) | 68.88 ± 4.53 | 69.07 ± 4.79 | 0.393 |
| Gender (female/male) | 83/31 | 92/27 | 0.229 |
| BMI (kg/m2) | 23.36 ± 2.97 | 24.18 ± 3.16 | 0.276 |
| Ca2+ (mmol/ml) | 2.13 ± 0.58 | 1.92 ± 0.71 | < 0.001 |
| β-CTX (ng/ml) | 0.58 ± 0.28 | 0.64 ± 0.32 | < 0.001 |
| 25(OH)D3 (ng/ml) | 22.67 ± 2.62 | 18.84 ± 2.98 | < 0.001 |
| T-score | -2.43 ± 0.62 | -2.97 ± 0.98 | < 0.001 |
| Fractured part (n, %) | / | ||
| Hip fractures | / | 41 (34.08%) | |
| Vertebral fractures | / | 55 (46.19%) | |
| Distal forearm fractures | / | 10 (8.97%) | |
| Other parts | / | 13 (10.76%) | |
OP: Osteoporosis, OPF: Osteoporotic fractures, BMI: Body Mass Index, β-CTX: β-C-telopeptides of type I collagen, 25(OH)D3: 25-hydroxy vitamin D3
Data were expressed as mean ± standard deviation. P < 0.05 indicated statistical significance
Fig. 1.
miR-204 expression was detected in osteoporosis and OPF, and ROC curves. A. miR-204 expression in serum of osteoporosis and OPF patients. ***P < 0.001. B. ROC curve of β-CTX, T-score, miR-204, and combined diagnostic curve
The levels of Ca2+, β-CTX, 25(OH)D3, and T-score were correlated with miR-204 expression
The correlation between miR-204 expression and clinical indicators was analyzed by the chi-square test in the group of OPF patients. It was found that Ca2+, β-CTX, 25(OH)D3, and T-score were correlated with miR-204 expression (Table 2). To more accurately analyze the correlation between continuous variables and miR-204, the data were analyzed for polymorphism distribution through the Shapiro–Wilk test. Since Ca2+ (P = 0.016) and β-CTX (P < 0.001) did not follow a normal distribution, the correlation analysis between miR-204 and the continuous clinical factors was analyzed using Spearman’s rank correlation analysis. The results indicated that miR-204 was significantly negatively correlated with Ca2+ (rs = -0.597, P < 0.001), 25(OH)D3 (rs = -0.625, P < 0.001), and T-score (rs = -0.500, P < 0.001), and was significantly positive correlated with β-CTX (rs = 0.520, P < 0.001) (Supplementary Table 2). This implied that miR-204 affected the development of OPF, possibly by acting through influencing the levels of Ca2+, β-CTX, 25(OH)D3, and T-score, which ultimately led to an increase in bone fragility.
Table 2.
Correlation between miR-204 and clinical features in patients with osteoporotic fractures
| Characteristics | miR-204 high expression(n = 66) | miR-204 low expression(n = 53) | P value |
|---|---|---|---|
| Age (years) | 0.195 | ||
| ≥ 68 | 39 | 25 | |
| < 68 | 27 | 28 | |
| Gender | 0.924 | ||
| Male | 14 | 13 | |
| Female | 52 | 40 | |
| BMI (kg/m2) | 0.196 | ||
| ≥ 25 | 34 | 21 | |
| < 25 | 32 | 32 | |
| Ca2+ (mmol/ml) | 0.025 | ||
| ≥ 2 | 21 | 34 | |
| < 2 | 45 | 19 | |
| β-CTX (ng/ml) | 0.015 | ||
| ≥ 0.7 | 41 | 21 | |
| < 0.7 | 25 | 32 | |
| 25(OH)D3 (ng/ml) | < 0.001 | ||
| ≥ 19 | 30 | 29 | |
| < 19 | 36 | 24 | |
| T-score | < 0.001 | ||
| ≥ -3 | 22 | 38 | |
| < -3 | 44 | 15 |
BMI: Body Mass Index, β-CTX: β-C-telopeptides of type I collagen, 25(OH)D3: 25-hydroxy vitamin D3
The data were statistically analyzed using the chi-square test, and P < 0.05 was considered statistically significant
Ca2+, miR-204, and T-score were risk factors for OPF
Risk factors for OPF were analyzed by multivariate logistic regression. The results of the analysis identified that Ca2+ (OR = 0.027, 95% CI = 0.003–0.276, P = 0.002), miR-204 expression (OR = 3.553, 95% CI = 1.881–6.712, P < 0.001), and T-score (OR = 0.229, 95% CI = 0.130–0.402, P < 0.001) were risk factors for OPF (Table 3).
Table 3.
Independent risk factors affecting osteoporotic fractures
| Characteristics | OR | 95% CI | P value |
|---|---|---|---|
| Age | 0.480 | 0.087–2.648 | 0.400 |
| Gender | 1.797 | 0.901–2.584 | 0.096 |
| BMI | 0.542 | 0.099–2.979 | 0.481 |
| Ca2+ | 0.027 | 0.003–0.276 | 0.002 |
| β-CTX | 1.688 | 0.495–5.753 | 0.403 |
| 25(OH)D3 | 0.140 | 0.017–1.147 | 0.067 |
| miR-204 expression | 3.553 | 1.881–6.712 | < 0.001 |
| T-score | 0.229 | 0.130–0.402 | < 0.001 |
OR: Odds ratio, CI: Confidence interval, BMI: Body Mass Index, β-CTX: β-C-telopeptides of type I collagen, 25(OH)D3: 25-hydroxy vitamin D3
All variables listed were included in the final regression model
The data were statistically analyzed through multivariate logistic regression. P < 0.05 indicated statistical significance
Osteogenic differentiation and fracture repair of BMSCs were promoted after inhibition of miR-204 expression
To validate the healing effect of miR-204 on OPF, miR-204 mimic, miR-204 mimic NC, miR-204 inhibitor, and miR-204 inhibitor NC were respectively transfected into BMSCs. The results indicated that compared with the negative control group, the expression of miR-204 was significantly upregulated by 1.5-fold after BMSCs were transfected with miR-204 mimic, while the expression of miR-204 was significantly downregulated by 0.5-fold after being transfected with miR-204 inhibitor. This result indirectly confirmed that the transfection operation can effectively alter the expression level of miR-204 (Fig. 2A). The enhancement of BMSCs cell activity is positively correlated with the speed of fracture healing. This study found that the cell proliferation rate in the miR-204 inhibitor group was significantly faster compared to the miR-204 inhibitor NC group; however, proliferation was severely slowed after transfection with miR-204 mimic. The results showed that the highly expressed miR-204 in BMSCs reduced BMSCs cell viability (Fig. 2B). The degree of osteogenic differentiation and the ability to promote fracture healing were further examined in BMSCs co-cultured with MG63. Alkaline phosphatase (ALP) and bone sialoprotein (BSP) are key markers of osteogenic differentiation of BMSCs, while BMSCs promoted fracture healing by secreting TGF-β1 and bone morphogenetic protein (BMP) [40]. RT-qPCR results showed that the expression levels of ALP and BSP were significantly lower in the miR-204 mimic group than in the miR-204 mimic NC group (Fig. 2C-D). Similarly, TGF-β1 and BMP synthesis were reduced in the miR-204 mimic group (Fig. 2E-F). However, the above phenomenon was reversed after transfection with miR-204 inhibitor. This suggests that the transfection efficiency of miR-204 met the experimental requirements. Besides, miR-204 levels are closely related to the bone differentiation and bone repair capacity of BMSCs.
Fig. 2.
Proliferation, osteogenic differentiation factor, and pro-fracture healing factor expression in BMSCs after transfecting miR-204-related oligonucleotide. A. The expression level of miR-204 in BMSCs with transfection of miR-204 mimic and inhibitor. ***P < 0.001. B. The proliferation of BMSCs with transfection of miR-204 mimic and inhibitor. miR-204 inhibitor vs. miR-204 inhibitor NC: *P < 0.05, ***P < 0.001, miR-204 mimic vs. miR-204 mimic NC: ##P < 0.01, ###P < 0.001, **P < 0.01, ***P < 0.001. C-D. The expression level of osteogenic differentiation factor (ALP and BSP) in BMSCs with transfection of miR-204 mimic and inhibitor. ***P < 0.001. E–F. The expression level of pro-fracture healing factor (TGF-β and BMP) in BMSCs with transfection of miR-204 mimic and inhibitor. ***P < 0.001
BMPR1A was a direct target gene of miR-204
The miRDB database predicted that BMPR1A was a target gene of miR-204. BMPR1A was a key receptor in the BMP signaling pathway. The 3’UTR of BMPR1A contained complementary sequences that are complementary to miR-204 (Supplementary Fig. 2A). The results of the luciferase reporter gene assay showed that overexpression of miR-204 significantly reduced the luciferase activity of the wild-type BMPR1A 3’UTR reporter plasmid, and inhibition of miR-204 level significantly increased the luciferase activity of the wild-type BMPR1A 3’UTR reporter plasmid. However, miR-204-related oligonucleotide does not affect the mutant reporter plasmid (Supplementary Fig. 2B). This indicated that BMPR1A was a direct target gene of miR-204. The miR-204-related oligonucleotides were transfected into BMSCs and then co-cultured with MG63. The results showed that the expression level of BMPR1A was significantly downregulated due to the overexpression of miR-204. However, when the level of miR-204 was inhibited, the expression level of BMPR1A was upregulated (Supplementary Fig. 2C). miR-204 may directly target BMPR1A to inhibit osteogenic differentiation and repair.
Discussion
The treatment of OPF is a prolonged process. Clinical treatment focuses on accelerating fracture healing, minimizing complications, reducing mortality, and improving short-term life quality. However, surgical efficacy is frustrating because reduced bone stiffness leads to loosening of the internal fixation, ultimately leading to non-union of the fracture or surgical failure [41]. Literature reports a positive correlation between estrogen levels and the bone content of load-bearing bone and a preventive effect of estrogen on OPF [42]. The probability of osteoporosis occurring in postmenopausal women increases significantly [43], which is associated with the decrease in estrogen level [44]. Nevertheless, a critical concern is that although estrogen has a positive effect on maintaining bone stiffness, the use of estrogen to prevent osteoporosis has not been validated in rigorous clinical trials [45]. The research has found that the polymorphism of the gene at the translation initiation site of the vitamin D receptor is related to the treatment of osteoporosis [46]. Similarly, many biochemical indices of bone strength have low sensitivity and specificity, and their clinical applications are limited [47–49]. The treatment methods of OPF mainly rely on conservative treatment, but they cannot address the fundamental problems of the patients [50, 51]. Vertebroplasty is commonly used for the treatment of vertebral fractures [52–56], but patients may experience severe adverse reactions [53, 57]. Against this backdrop, the present study investigated the diagnostic potential and regulatory role of miR-204 in OPF osteogenesis, aiming to provide an effective therapeutic target for clinical practice.
Emerging evidence indicates that miRNAs mediate bone homeostasis and pathological mechanisms during osteoporosis [58, 59]. Several miRNAs have been identified as key factors regulating osteogenic activity and bone formation in osteoblasts. Among them, elevated levels of miR-214 correlate with reduced degree of bone formation, and inhibition of miR-214 upregulates activating transcription factor 4 (ATF4) to promote osteoblast activity [60]. In addition, a significant association was found between specific circulating miRNA profiles and skeletal lesions [61, 62]. In recent years, miR-204 has been shown to play a regulatory role in various bone diseases. For example, inhibition of miR-204 restores sulfated proteoglycan (PG) synthesis and inhibits inflammatory senescence-associated secretory phenotype (SASP) factor secretion in cartilage, ameliorating symptoms of OA [63]. Transfection of miR-204 mimic inhibits the proliferation and differentiation of C2C12 cells in an experimental model of skeletal muscle injury, which would inhibit skeletal muscle regeneration [64]. These findings collectively suggest that miR-204 plays a role in inhibiting bone activity. Similarly, this study found that miR-204 expression was upregulated in the serum of OPF patients. miR-204 not only exhibited diagnostic significance for OPF but also was identified as a risk factor for OPF. Furthermore, the OPF patients who have high expression of miR-204, the levels of Ca2+, 25(OH)D3, and T-score are lower, while the level of β-CTX is higher. This indicates that miR-204 is involved in the pathological progression of OPF, potentially by modulating key markers of bone metabolism and bone mass.
miR-204 can also regulate the activity of fracture healing-related cells to affect fracture healing. Literature suggests that miR-204 expression inhibited by puerarin promotes the proliferation and differentiation of MC3T3-E1 cells [65]. Consistent with this, our in vitro experiments demonstrated that after miR-204 was overexpressed in BMSCs, the proliferation of BMSCs was slowed, and osteogenic differentiation and promotion of fracture healing were attenuated. However, the results were reversed after administration of the miR-204 inhibitor intervention. This suggests that miR-204 affects fracture healing by attenuating the bone differentiation and osteogenesis of BMSCs. However, some literature studies have found that miRNA-204 can act as an osteoprotective factor; For example, miR-204 inhibits proliferation, migration, invasion, and epithelial-mesenchymal transition of osteosarcoma cells by targeting Sirtuin 1 [66, 67]. Additionally, miR-204 exerts a chondroprotective role in the pathogenesis of OA. miR-204 inhibits SP1- LDL receptor-related protein 1 (LRP1) expression, blocking neural-cartilage interactions and alleviating OA-associated pain [68]. These discrepancies may be caused by tissue specificity (e.g., cartilage versus bone) or differences in disease stages, as has been demonstrated in previous literature.
BMPR1A plays a crucial role in promoting fracture healing. A prior study demonstrated that injecting a BMPR1A antagonist into mice delays cartilage healing and promotes fibrosis [69]. This study found that BMPR1A is a target gene of miR-204. Overexpression of miR-204 can inhibit the expression of BMPR1A. Therefore, miR-204 may affect osteogenic differentiation by influencing BMPR1A level.
Our study found that the expression of miR-204 has diagnostic value for OPF, and in vitro experiments have shown that miR-204 is involved in fracture healing. However, several limitations should be acknowledged. First, the transfection experiment lacks verification of transfection efficiency. Subsequent experiments will verify the transfection efficiency through fluorescence detection or flow cytometry methods. Second, extracellular cell experiments cannot fully represent the complex physiological microenvironment within the body, which will directly affect the translational value of therapeutic claims. Therefore, the therapeutic significance of miR-204 in OPF is cautious. For future in vivo investigations, the model of ovariectomized rats with miR-204 knockdown will be considered an animal model for the subsequent in vivo study. Third, this was a cross-sectional study, and we could not control for other relevant variables of the patients, furthermore, the results of the study are not supported by in vitro and in vivo studies. Fourth, while BMPR1A was a target of miR-204, the underlying mechanisms of this targeting effect have not been fully elucidated. The recent research has found that the Nrf2/autophagy pathway is a key target for the treatment of osteoporosis [70]. In the future, it can be further verified whether miR-204 regulates the downstream targets of the Nrf2/autophagy pathway. Therefore, we will conduct in vitro and in vivo experiments to verify the effects and mechanisms of miR-204 on OPF.
In conclusion, miR-204 expression is upregulated in OPF and contributes to the development of OPF. Overexpression of miR-204 inhibited osteogenic differentiation and delayed fracture healing, and conversely, inhibition of miR-204 exerts the opposite effect.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
Not Applicable.
Author contributions
ZQ C, JJ L, CQ S, J L and JF C conceived and designed the experiments. JJ C, L H, XW J and L S performed the experiments. ZQ C, JJ L, CQ S, J L and JF C contributed sample collection and statistical analysis. JJ C, L H, XW J and L S wrote the manuscript. ZQ C, JJ L and JF C revised it critically for important intellectual content. All authors read and approved the final manuscript.
Funding
No funding was received for conducting this study.
Data availability
Data can be shared upon reasonable request by the corresponding author. The data is in Supplementary Table 3.
Declarations
Ethical approval
The study protocol was approved by The Ethics Committee of Xuzhou Central Hospital and followed the principles outlined in the Declaration of Helsinki.
Consent to participate
Written informed consent was obtained from the patients who agreed to take part in the study.
Conflicts of interest
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Zhiqiang Cheng and Jingjing Liu contributed equally to the study.
References
- 1.Gargano G, Pagano SM, Maffulli N. Circular RNAs in the management of human osteoporosis. Br Med Bull. 2025;153(1). [DOI] [PubMed]
- 2.Migliorini F, Giorgino R, Hildebrand F, et al. Fragility Fractures: risk factors and management in the elderly. Medicina Kaunas. 2021. 10.3390/medicina57101119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Migliorini F, Maffulli N, Colarossi G, et al. Effect of drugs on bone mineral density in postmenopausal osteoporosis: a Bayesian network meta-analysis. J Orthop Surg Res. 2021;16(1):533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Nih Consensus Development Panel on Osteoporosis Prevention D, Therapy. Osteoporosis prevention, diagnosis, and therapy. JAMA. 2001;285(6):785–95. [DOI] [PubMed] [Google Scholar]
- 5.De Souza MJ, Strock NCA, Williams NI, et al. Prunes preserve hip bone mineral density in a 12-month randomized controlled trial in postmenopausal women: the Prune Study. Am J Clin Nutr. 2022;116(4):897–910. [DOI] [PubMed] [Google Scholar]
- 6.Wang F, Sun R, Zhang SD, Wu XT. Similarities in distribution pattern between acute multiple osteoporotic vertebral compression fractures and vertebral fractures cascades. J Orthop Surg Res. 2024;19(1):844. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Migliorini F, Colarossi G, Baroncini A, et al. Pharmacological Management of Postmenopausal Osteoporosis: a Level I Evidence Based - Expert Opinion. Expert Rev Clin Pharmacol. 2021;14(1):105–19. [DOI] [PubMed] [Google Scholar]
- 8.Migliorini F, Maffulli N, Spiezia F, et al. Potential of biomarkers during pharmacological therapy setting for postmenopausal osteoporosis: a systematic review. J Orthop Surg Res. 2021;16(1):351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Migliorini F, Maffulli N, Spiezia F, et al. Biomarkers as therapy monitoring for postmenopausal osteoporosis: a systematic review. J Orthop Surg Res. 2021;16(1):318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Leeyaphan J, Rojjananukulpong K, Intarasompun P, Peerakul Y. Simple clinical predictors for making directive decisions in osteoporosis screening for women: a cross-sectional study. J Orthop Surg Res. 2024;19(1):789. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Vasikaran S, Eastell R, Bruyere O, et al. Markers of bone turnover for the prediction of fracture risk and monitoring of osteoporosis treatment: a need for international reference standards. Osteoporos Int. 2011;22(2):391–420. [DOI] [PubMed] [Google Scholar]
- 12.Zheng XQ, Huang J, Lin JL, Song CL. Pathophysiological mechanism of acute bone loss after fracture. J Adv Res. 2023;49:63–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Li Y, Ye S, Han Z, Wei C, Huang Y. LncRNA CRNDE ameliorates bone fracture by regulating cell viability and apoptosis of osteoblasts. J Orthop Surg Res. 2025;20(1):521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Giordano L, Porta GD, Peretti GM, Maffulli N. Therapeutic potential of microRNA in tendon injuries. Br Med Bull. 2020;133(1):79–94. [DOI] [PubMed] [Google Scholar]
- 15.Oliviero A, Della Porta G, Peretti GM, Maffulli N. MicroRNA in osteoarthritis: physiopathology, diagnosis and therapeutic challenge. Br Med Bull. 2019;130(1):137–47. [DOI] [PubMed] [Google Scholar]
- 16.Gargano G, Oliviero A, Oliva F, Maffulli N. Small interfering RNAs in tendon homeostasis. Br Med Bull. 2021;138(1):58–67. [DOI] [PubMed] [Google Scholar]
- 17.Gargano G, Oliva F, Oliviero A, Maffulli N. Small interfering RNAs in the management of human rheumatoid arthritis. Br Med Bull. 2022;142(1):34–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Gargano G, Asparago G, Spiezia F, Oliva F, Maffulli N. Small interfering RNAs in the management of human osteoporosis. Br Med Bull. 2023;148(1):58–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Yang X, Yin P, Yao X, Zhang J. MicroRNAs in the diagnosis of osteoarthritis: a systematic review and meta-analysis of observational studies. J Orthop Surg Res. 2025;20(1):654. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Zhao C, Li Q, Shen C. Therapeutic potential of miR-204-5p in intervertebral disc degeneration: targeting the SSRP1/NF-kappaB pathway to inhibit apoptosis. J Orthop Surg Res. 2025;20(1):586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Li F, Tan H, Zhang X, et al. LncRNA HCG18 regulates the progression of spinal tuberculosis by modulating the hsa-miR-146a-5p/TGF-beta1/SMADs pathway. J Orthop Surg Res. 2025;20(1):484. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Yang X, Jin Q, Guo L. MiR-217 participates in the progression of postmenopausal osteoporosis by regulating the OPG/RANKL/RANK pathway. J Orthop Surg Res. 2025;20(1):600. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Liu X, Zhang X, Cen M. Dysregulation of miR-106a-5p/PTEN axis associated with progression and diagnostic of postmenopausal osteoporosis. J Orthop Surg Res. 2025;20(1):456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Bottani M, Banfi G, Lombardi G. Perspectives on miRNAs as epigenetic markers in osteoporosis and bone fracture risk: a step forward in personalized diagnosis. Front Genet. 2019;10:1044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Sikora M, Marycz K, Smieszek A. Small and long non-coding RNAs as functional regulators of bone homeostasis, acting alone or cooperatively. Mol Ther Nucleic Acids. 2020;21:792–803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Feng Q, Zheng S, Zheng J. The emerging role of microRNAs in bone remodeling and its therapeutic implications for osteoporosis. Biosci Rep. 2018;38(3). [DOI] [PMC free article] [PubMed]
- 27.Jia B, Zhang Z, Qiu X, et al. Analysis of the miRNA and mRNA involved in osteogenesis of adipose-derived mesenchymal stem cells. Exp Ther Med. 2018;16(2):1111–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Li Z, Hassan MQ, Jafferji M, et al. Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation. J Biol Chem. 2009;284(23):15676–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Huang J, Zhao L, Xing L, Chen D. MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation. Stem Cells. 2010;28(2):357–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Chen YJ, Chang WA, Huang MS, et al. Identification of novel genes in aging osteoblasts using next-generation sequencing and bioinformatics. Oncotarget. 2017;8(69):113598–613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Liu X, Gao F, Wang W, Yan J. Expression of miR-204 in patients with osteoarthritis and its damage to chondrocytes. J Musculoskelet Neuronal Interact. 2020;20(2):265–71. [PMC free article] [PubMed] [Google Scholar]
- 32.Matthews CN, Chen AF, Daryoush T, et al. Does an Elastic Compression Bandage Provide Any Benefit After Primary TKA? Clin Orthop Relat Res. 2019;477(1):134–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Eskimez Z, Demirci PY, Yesilot SB. The effect of pain, fatigue, and sleep quality on activities of daily living in patients with multiple sclerosis by gender: a descriptive study from Turkey. Niger J Clin Pract. 2025;28(1):91–8. [DOI] [PubMed] [Google Scholar]
- 34.Senol DK, Aydin Ozkan S, Agrali C. The effect of the training provided to primiparous pregnant women based on the model on pregnancy risk perception and health literacy. Women Health. 2024;64(3):283–93. [DOI] [PubMed] [Google Scholar]
- 35.Dolan E, Dumas A, Keane KM, et al. The bone biomarker response to an acute bout of exercise: a systematic review with meta-analysis. Sports Med. 2022;52(12):2889–908. [DOI] [PubMed] [Google Scholar]
- 36.Freedman KB, Back S, Bernstein J. Sample size and statistical power of randomised, controlled trials in orthopaedics. J Bone Joint Surg Br. 2001;83(3):397–402. [DOI] [PubMed] [Google Scholar]
- 37.Siris ES, Adler R, Bilezikian J, et al. The clinical diagnosis of osteoporosis: a position statement from the National Bone Health Alliance Working Group. Osteoporos Int. 2014;25(5):1439–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Hu T, Dai S, Yang L, Zhu B. Potential predictive of thoracic CT value and bone mineral density T-value in COPD complicated with osteoporosis. Int J Gen Med. 2024;17:3027–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Zhang X, Wang G, Wang W, et al. Bone marrow mesenchymal stem cells paracrine TGF-beta1 to mediate the biological activity of osteoblasts in bone repair. Cytokine. 2023;164:156139. [DOI] [PubMed] [Google Scholar]
- 40.Li M, Zhang C, Li X, et al. Isoquercitrin promotes the osteogenic differentiation of osteoblasts and BMSCs via the RUNX2 or BMP pathway. Connect Tissue Res. 2019;60(2):189–99. [DOI] [PubMed] [Google Scholar]
- 41.Luo L, Lin J, Ma W, Fan J. Effectiveness of teriparatide in in improving healing rates and bone-turnover markers of osteoporotic hip fracture: a meta-analysis. J Pak Med Assoc. 2024;74(4):741–51. [DOI] [PubMed] [Google Scholar]
- 42.Yoo JE, Shin DW, Han K, et al. Association of female reproductive factors with incidence of fracture among postmenopausal women in Korea. JAMA Netw Open. 2021;4(1):e2030405. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Bao X, Liu C, Liu H, et al. Association between polymorphisms of glucagon-like peptide-1 receptor gene and susceptibility to osteoporosis in Chinese postmenopausal women. J Orthop Surg Res. 2024;19(1):869. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Migliorini F, Colarossi G, Eschweiler J, et al. Antiresorptive treatments for corticosteroid-induced osteoporosis: a Bayesian network meta-analysis. Br Med Bull. 2022;143(1):46–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Nelson HD. Postmenopausal osteoporosis and estrogen. Am Fam Physician. 2003;68(4):606–10, 12. [PubMed] [Google Scholar]
- 46.Conti V, Russomanno G, Corbi G, et al. A polymorphism at the translation start site of the vitamin D receptor gene is associated with the response to anti-osteoporotic therapy in postmenopausal women from southern Italy. Int J Mol Sci. 2015;16(3):5452–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Mohebbi R, Shojaa M, Kohl M, et al. Exercise training and bone mineral density in postmenopausal women: an updated systematic review and meta-analysis of intervention studies with emphasis on potential moderators. Osteoporos Int. 2023;34(7):1145–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Moshi MR, Nicolopoulos K, Stringer D, et al. The clinical effectiveness of denosumab (Prolia(R)) for the treatment of osteoporosis in postmenopausal women, compared to bisphosphonates, selective estrogen receptor modulators (SERM), and placebo: a systematic review and network meta-analysis. Calcif Tissue Int. 2023;112(6):631–46. [DOI] [PubMed] [Google Scholar]
- 49.Cheng SH, Chu W, Chou WH, Chu WC, Kang YN. Cardiovascular safety of romosozumab compared to commonly used anti-osteoporosis medications in postmenopausal osteoporosis: a systematic review and network meta-analysis of randomized controlled trials. Drug Saf. 2025;48(1):7–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Longo UG, Loppini M, Denaro L, Maffulli N, Denaro V. Osteoporotic vertebral fractures: current concepts of conservative care. Br Med Bull. 2012;102:171–89. [DOI] [PubMed] [Google Scholar]
- 51.Longo UG, Loppini M, Denaro L, Maffulli N, Denaro V. Conservative management of patients with an osteoporotic vertebral fracture: a review of the literature. J Bone Joint Surg Br. 2012;94(2):152–7. [DOI] [PubMed] [Google Scholar]
- 52.Longo UG, Loppini M, Denaro L, et al. The effectiveness and safety of vertebroplasty for osteoporotic vertebral compression fractures. A double blind, prospective, randomized, controlled study. Clin Cases Miner Bone Metab. 2010;7(2):109–13. [PMC free article] [PubMed]
- 53.Andersen MO, Andresen AK, Hartvigsen J, et al. Vertebroplasty for painful osteoporotic vertebral compression fractures: a protocol for a single-center doubled-blind randomized sham-controlled clinical trial. VOPE2. J Orthop Surg Res. 2024;19(1):813. [DOI] [PMC free article] [PubMed]
- 54.Tang J, Wang S, Wang J, et al. Risk factors for secondary vertebral compression fracture after percutaneous vertebral augmentation: a single-centre retrospective study. J Orthop Surg Res. 2024;19(1):797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Wu H, Li C, Song J, Zhou J. Developing predictive models for residual back pain after percutaneous vertebral augmentation treatment for osteoporotic thoracolumbar compression fractures based on machine learning technique. J Orthop Surg Res. 2024;19(1):803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Migliorini F, Vecchio G, Weber CD, et al. Management of transient bone osteoporosis: a systematic review. Br Med Bull. 2023;147(1):79–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Shen L, Yang H, Zhou F, Jiang T, Jiang Z. Risk factors of short-term residual low back pain after PKP for the first thoracolumbar osteoporotic vertebral compression fracture. J Orthop Surg Res. 2024;19(1):792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Li D, Liu J, Guo B, et al. Osteoclast-derived exosomal miR-214-3p inhibits osteoblastic bone formation. Nat Commun. 2016;7:10872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Zhang Y, Xie RL, Croce CM, et al. A program of micrornas controls osteogenic lineage progression by targeting transcription factor Runx2. Proc Natl Acad Sci U S A. 2011;108(24):9863–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Wang X, Guo B, Li Q, et al. miR-214 targets ATF4 to inhibit bone formation. Nat Med. 2013;19(1):93–100. [DOI] [PubMed] [Google Scholar]
- 61.Kocijan R, Muschitz C, Geiger E, et al. Circulating microrna signatures in patients with idiopathic and postmenopausal osteoporosis and fragility fractures. J Clin Endocrinol Metab. 2016;101(11):4125–34. [DOI] [PubMed] [Google Scholar]
- 62.Seeliger C, Karpinski K, Haug AT, et al. Five freely circulating miRNAs and bone tissue miRNAs are associated with osteoporotic fractures. J Bone Miner Res. 2014;29(8):1718–28. [DOI] [PubMed] [Google Scholar]
- 63.Kang D, Shin J, Cho Y, et al. Stress-activated miR-204 governs senescent phenotypes of chondrocytes to promote osteoarthritis development. Sci Transl Med. 2019;11(486). [DOI] [PubMed]
- 64.Tan Y, Shen L, Gan M, et al. Downregulated miR-204 Promotes Skeletal Muscle Regeneration. Biomed Res Int. 2020;2020:3183296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Zeng X, Feng Q, Zhao F, et al. Puerarin inhibits TRPM3/miR-204 to promote MC3T3-E1 cells proliferation, differentiation and mineralization. Phytother Res. 2018;32(6):996–1003. [DOI] [PubMed] [Google Scholar]
- 66.Shi Y, Huang J, Zhou J, et al. Microrna-204 inhibits proliferation, migration, invasion and epithelial-mesenchymal transition in osteosarcoma cells via targeting Sirtuin 1. Oncol Rep. 2015;34(1):399–406. [DOI] [PubMed] [Google Scholar]
- 67.Presneau N, Duhamel LA, Ye H, et al. Post-translational regulation contributes to the loss of LKB1 expression through SIRT1 deacetylase in osteosarcomas. Br J Cancer. 2017;117(3):398–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Lu K, Wang Q, Hao L, et al. MiR-204 ameliorates osteoarthritis pain by inhibiting SP1-LRP1 signaling and blocking neuro-cartilage interaction. Bioact Mater. 2023;26:425–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Morgan EF, Pittman J, DeGiacomo A, et al. BMPR1A antagonist differentially affects cartilage and bone formation during fracture healing. J Orthop Res. 2016;34(12):2096–105. [DOI] [PubMed] [Google Scholar]
- 70.Huang F, Wang Y, Liu J, et al. Asperuloside alleviates osteoporosis by promoting autophagy and regulating Nrf2 activation. J Orthop Surg Res. 2024;19(1):855. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data can be shared upon reasonable request by the corresponding author. The data is in Supplementary Table 3.


